Inhibition of Rab25 correlates with proliferation, apoptosis, and migration of foreskin fibroblasts via the β1- integrin/EGFR pathway in hypospadias

doi:10.21203/rs.3.rs-3452400/v1

Download PDF

Article

Inhibition of Rab25 correlates with proliferation, apoptosis, and migration of foreskin fibroblasts via the β1- integrin/EGFR pathway in hypospadias

https://doi.org/10.21203/rs.3.rs-3452400/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Hypospadias is a common congenital abnormality of the penile. Abnormal spatiotemporal regulation of critical genes interfering with urethral development leads to hypospadias. This study investigated the role of Rab25 in hypospadias. The expression levels of various molecules in foreskin tissues and fibroblasts were confirmed using PCR, immunohistochemistry, and western blotting. Foreskin fibroblasts of silencing Rab25 were constructed by lentivirus transfection. Using CRISPR/Cas9 technology, Rab25^−/− mice were generated. The biological functions of Rab25 were investigated using Cell Counting Kit-8 solution, flow cytometry, and wound scratch assays. The genital tubercles (GTs) of male wild-type (WT) and Rab25^−/− fetal mice were collected on gestation day (GD) 18.5, and a scanning electron microscope (SEM) was used to visualize the external morphology of GT. We observed that the foreskin tissues of patients with hypospadias expressed less Rab25, β1-integrin, and EGFR. Moreover, Rab25 inhibition downregulated the β1-integrin and EGFR expressions, restrained proliferation and migration, and promoted apoptosis in foreskin fibroblasts. Abnormal GT morphology with incomplete fusion of the urethral fold and expanded distal cleft was observed in Rab25^−/− fetal mice. The distal mild hypospadias phenotype is reproduced in Rab25^−/− fetal mice. It suggests that Rab25 plays an important role in the hypospadias via the β1-integrin/EGFR pathway.

Biological sciences/Developmental biology

Health sciences/Urology

Hypospadias is a congenital external genital malformation in which the urethral folds are incompletely fused, resulting in an abnormal opening of the ventral urethra of the penile.¹ Urethral seam fusion is formed proximally to distally along the GT. Any obstruction during seam fusion or remodeling along the tubercle may lead to an abnormal urethral orifice in hypospadias.² Hypospadias is a heterogeneous and multifactorial disease influenced by a combination of genetic, hormonal, and environmental factors.³ Many studies have shown that bone morphogenetic protein (BMP), sonic hedgehog (Shh), fibroblast growth factor (FGF), transforming growth factor-β1 (TGF-β1), and other genes are involved in early urethral development.^4,5 A coordinated balance between androgens and estrogens in animals and humans is crucial to ensure normal penile development and function. Experiments with pregnant rats and mice treated with flutamide, an androgen receptor (AR) antagonist, resulted in hypospadias in the male offspring.^6,7 In addition, changes in estrogen levels might be a potential cause of hypospadias formation by mediating the action of androgens.⁸ Animal studies have demonstrated a clear link between maternal exposure to endocrine-disrupting chemicals and male reproductive malformations.^9,10 Therefore, exploring the underlying mechanism of hypospadias is crucial to reducing its incidence.

In the RAS superfamily of small GTPases, Rho, Rab, and Arf subfamilies are involved in integrin trafficking, and an essential function of Rab and Arf members is to regulate various cellular processes such as membrane dynamics, cell differentiation, and receptor transport. Rab proteins regulate vesicle transport and intracellular signal transduction for normal cellular activities.¹¹ Changes in Rab proteins and their effectors are associated with many human diseases, including cancer. Rab25 (Rab11c) enhances the aggression of tumor cells by participating in various pathways related to cell proliferation, apoptosis, viability, and regulation of integrin circulation.¹² Rab25 regulates cell polarity, proliferation, and apoptosis during the development of multiple cell lines.^11,13,14 Rab25 can act as either a tumor suppressor or promoter, depending on the cancer context. There has been extensive research on Rab25 in various cancers, but few studies have evaluated the effect of Rab25 on the formation of external genitalia and the induction of hypospadias. A previous study showed a loss of Rab25 expression in the hypospadias group compared with that in the control group.¹⁵ Therefore, a better understanding of the function of Rab25 can contribute to determining the role of Rab25 in urethral development.

Rab25 expression was decreased in foreskin fibroblasts transfected with lentivirus

The efficiency of silencing Rab25 was confirmed by western blotting and PCR. Rab25 protein (Fig. 1A) and mRNA (Fig. 1B) expression levels were significantly lower in the shRab25 group than in the NC group. The process of changes in foreskin fibroblasts after lentivirus transfection was described (Fig. 1C).

Rab25-mediated activation of the β1-integrin/EGFR signaling pathway

Western blotting and immunohistochemical results showed that, compared to the normal group, Rab25, β1-integrin, and EGFR protein levels were significantly decreased in the hypospadias group (Fig. 2A-B). After transfection, inhibition of Rab25 significantly reduced the protein/mRNA expression levels of β1-integrin and EGFR (Fig. 2C-D).

Cell proliferation was inhibited and apoptosis was promoted in the shRab25 group compared to the NC group after lentivirus transfection

Decreased protein/mRNA levels of cell cycle regulators (PCNA, Cyclin D, and CDK2) were found in the shRab25 group (Fig. 3A-B). To assess the effect of silencing Rab25 on the proliferation of foreskin fibroblasts, we used a CCK-8 assay. The results showed a decreased growth rate of transfected cells compared to those transfected with the NC-shRNA lentivirus (Fig. 3C). Cell cycle phase distribution after transfection with shRab25 was analyzed by flow cytometry. The proportion of cells in the G1 and G2 phases increased, while the proportion of S phase cells substantially reduced following Rab25 knockdown compared to that in the NC group (Fig. 3D).

Elevated Bax and Caspase3 but decreased Bcl-2, were observed in the shRab25 group compared to the NC group (Fig. 3E). The results of apoptosis-related mRNA levels in foreskin fibroblasts after transfection were consistent with the western blot results (Fig. 3F). Compared to the NC group, foreskin fibroblasts exhibited increased apoptosis in response to lentiviral shRNA targeting Rab25 transfection (Fig. 3G).

Cell migration was inhibited in foreskin fibroblasts transfected with lentivirus

A wound-healing assay was used to evaluate the effect of lentiviral shRNA targeting Rab25 on the migration ability of foreskin fibroblasts. The results showed that the migration rate of foreskin fibroblasts was lower in the shRab25 group than in the NC group (Fig. 4).

External morphology of GT in Rab25^−/− mouse

The GT of the WT male fetal mouse at GD 18.5 was molded, and its morphology was complete (Fig. 5A). Abnormal GT morphology with incomplete fusion of the urethral fold and expanded distal cleft was observed in Rab25^−/− male fetal mice (Fig. 5B).

In this study, we found that β1-integrin and EGFR expression was reduced in the foreskin of patients with hypospadias, and silencing Rab25 downregulated the expression levels of β1-integrin and EGFR, suggesting that the Rab25/β1-integrin/EGFR pathway may play an essential role in urethral development. After shRab25 transfection, foreskin fibroblasts exhibited increased apoptosis and decreased proliferation and migration. An expanded distal cleft was observed in GD 18.5 Rab25^−/− male fetal mice.

Hypospadias can occur if urethral folds do not fuse to form a urethral groove at the midline epithelial seam and curl into the tubular urethra.¹⁶ Failure of fusion of the original urethral groove and the second urethral groove that developed from the urethral plate causes defects in urethral masculinization.¹⁷ Furthermore, apoptosis and growth disorder in the peri-urethral mesenchyme may aggravate the interruption of urethral fold fusion along the ventral midline of the GT and incomplete urethral tubularization.¹⁸

Rab25, a member of the Rab11 subfamily, regulates the transport of membrane proteins (EGFR, α5β1-integrin) and receptors, which are essential for maintaining the cytoskeletal structure.^19,20 Many studies have reported the Rab25/β1-integrin pathway in knockout mice. Moreover, in the absence of Rab25, integrin turnover is suppressed, which affects integrin presentation on the cell membrane. In Rab25-deficient mice, lower β1-integrin expression was observed in the lateral membranes of villus cells than in the control groups.²¹ Immunohistochemical staining of EGFR showed that EGFR expression in the foreskin of patients with hypospadias was lower than that in controls.²² In a study of cleft lip and palate, similar to the pathology of hypospadias, cleft palate frequently occurs in EGFR-deficient mice.²³ Many studies have found that Rab25, β1-integrin, and EGFR work together to regulate cancer cell invasion, proliferation, resistance to apoptosis, and EMT.^24–26 In this study, we found that β1-integrin and EGFR decreased in the hypospadias group and Rab25-knockdown foreskin fibroblasts, and speculated that urethral development might be affected by the Rab25/β1-integrin/EGFR pathway.

As a fundamental process in embryonic development, cell proliferation and apoptosis are essential for eliminating degenerated tissue regions and maintaining cell population homeostasis.²⁷ It has been reported that the proliferation of skin, mammary, and intestinal epithelial cells is correlated with β1-integrin-mediated cell adhesion.^28–30 Apoptosis is necessary for the normal development of GT, and its regulatory pathways can be divided into internal and external pathways.³¹ Moreover, there is a direct correlation between caspase activity and the level of apoptosis at the midline epithelial seam during palatal fusion.³² The critical role of apoptosis in the tubularization of the urethral plate and the removal of the epithelial seam should be investigated during urethral development. Further research is needed to determine how mesenchymal cell apoptosis contributes to hypospadias formation.

Cell migration is a fundamental process during embryonic development, wound healing, inflammatory responses, cancer metastasis, and some pathological conditions.³³ Epithelial cells undergoing EMT can acquire fibroblast-like characteristics, ultimately increasing motility and decreasing cell-cell adhesion.³⁴ Conversely, the early stages of MET exhibited increased E-cadherin expression, reduced motor ability, and formation of cell aggregates.³⁵ Mesenchymal migration and condensation on both sides of the urethral plate are necessary for urethral development, and the driving force of migration is mainly controlled by actomyosin contraction.³⁶ In palatal tissue fusion, epithelial cell-derived actomyosin contractility contributes to confluence of the palatal mesenchyme by eliminating the midline epithelial seams.^37,38 Membrane trafficking has been reported to be regulated by Rab proteins, which play a role in membrane fusion, membrane movement, and vesicle formation.³⁹ Additionally, the proposed concept of partial EMT serves as a collective migration pattern. It is also associated with the endocytic protein Rab11.⁴⁰ In the process of urethral seam fusion, the driving factors of mesenchymal cell migration and how actomyosin provides power for mesenchymal condensation require further study.

The present study demonstrates that Rab25, as a candidate gene, is involved in the occurrence of hypospadias. However, a complete understanding of Rab25's role in urethral development and hypospadias formation needs to be improved. We briefly described the changes in the phenotype of Rab25 knockdown foreskin fibroblasts and Rab25^−/− mice, but did not elaborate on the interaction between phenotypes and the molecular mechanism underlying the phenotypes. Besides, we were only able to use foreskin fibroblasts instead of urothelial cells due to the lack of normal urothelium. Since Rab25 is an epithelial-related gene, the use of urothelial cells may be more suitable.

In conclusion, this study showed that Rab25 may be involved in hypospadias through the β1-integrin/EGFR pathway. In foreskin fibroblasts, silencing Rab25 promoted cell apoptosis and weakened proliferation and migration. Further studies are required to clarify the driving role of Rab25 in urethral development. Finally, our study provides new insights into the molecular mechanisms of external genital masculinization and the etiology of congenital urethral abnormalities.

Patients and samples

This study has been approved by the Institutional Review Board of the Children’s Hospital of Chongqing Medical University. Parents were given informed consent after the approval of the Institutional Review Board. Foreskin tissues were collected from children who underwent hypospadias repair surgery and circumcision at the Children’s Hospital of Chongqing Medical University. Children with phimosis were included in the normal group. The classification of hypospadias was not performed in this study.

Animals

Rab25 KO mice were provided by Shanghai Model Organisms Center, Inc. The CRISPR/Cas9 approach was used to construct Rab25^−/− mice in a C57BL/6J background. The C57BL/6J WT mice were obtained from the Experimental Animal Center of the Chongqing Medical University (Chongqing, China; SPF, License No.: SYXK (YU) 2022-0016). The mice were housed overnight (male: female ratio = 1:1), and their vaginal plugs were examined at 8:00 the next morning. The detection of a vaginal plug was designated GD 0.5, and the pups were dissected on GD 18.5. Male mice were identified using Sry PCR, and Rab25 genotype identification was performed using PCR. The primer sequences (5’→3’): P1: forward, TTGGAACGATGCCAGCAGAT, P2: reverse, ATGGTGGGCAGATCACATGG; P3: forward, TTGGAACGATGCCAGCAGAT, P4: reverse, GCAGTGAACCACATGAGGGA. All animals were maintained at the Experimental Animal Center of the Children’s Hospital of Chongqing Medical University (SPF, License No.: SYXK (YU) 2022-0002). All animal experiments were reviewed and approved by the Animal Ethics Committee of the Children’s Hospital of Chongqing Medical University (file number.: CHCMU-20220318).

Foreskin fibroblast isolation, culture, and lentivirus transfection

Foreskin tissue was obtained after circumcision in children and digested with 0.25% trypsin at 4°C overnight. The epidermis and dermis were separated using ophthalmic forceps. The dermis was washed three times with sterile PBS and cut into 1 mm³ tissue blocks. Tissue blocks were transferred into a centrifuge tube containing 0.2% type I collagenase solution and digested in a 5%CO₂ incubator at 37°C for 4h. The digestive solution was collected and centrifuged at 1000 rpm for 5 min. The supernatant was discarded and the cells were centrifuged again in the same manner. The cells were resuspended in F12/DMEM (GIBCO, Burlington, ONT, Canada) containing 10% fetal bovine serum (GIBCO) and 1% penicillin/streptomycin (Beyotime Biotechnology Co. Ltd, Shanghai, China) and seeded at 2.5×10⁵ cells/ml in 6 cm culture dishes in a 5%CO₂ incubator at 37°C. Lentivirus transfection was conducted and the cells were divided into negative control (NC) and shRab25 groups. To generate Rab25 knockdown cell lines, lentiviral shRNA targeting Rab25 (HBLV-h-RAB25 shRNA1-ZsGreen-PURO) and control empty vector (HBLV-ZsGreen-PURO NC) were synthesized by Hanheng Company (Hanheng Biotechnology Co. Ltd. Shanghai, China). The target sequence (5’→3’) of Rab25 used to construct lentiviral shRNA was GCCTTTGAGACTGTCCTGAAA. Lentivirus transfection of the fibroblasts was performed according to the manufacturer’s instructions. The stably transfected cells were cultured under puromycin (7 µg/mL) (Beyotime) selection for 2 weeks, at which point polymerase chain reaction (PCR) and western blotting were used to detect the expression levels of Rab25 mRNA/protein.

Polymerase chain reaction (PCR)

Total ribonucleic acid (RNA) was extracted from cell samples according to the instructions of the Simply P Total RNA Extraction Kit (Bioer Technology). RNA purity and concentration were measured using an ultraviolet spectrophotometer (ND2000; Thermo Fisher Scientific, Carlsbad, CA, USA). The extracted RNA was reverse-transcribed for mRNA analysis using RT Master Mix for qPCR II (HY-K0511A, MCE, Monmouth Junction, NJ, USA). SYBR Green qPCR Master Mix (HY-K0523, MCE) was used for this reaction. mRNA quantity was analyzed using a CFX96 Real-Time PCR detection system (Bio-Rad, Richmond, CA, USA). Primer sequences (5’→3’) were designed by Sangon Biotech and synthesized by Tsingke Biotechnology. Rab25: forward, CTAACCAAGCACCAGACCTAT; reverse, CTGAGGTCACTTTTGTTACCCA. β1-integrin: forward, TTGACCCTAATACCAACCTTCCT; reverse, CCCATAGTACAGCCCTTGATGTT. EGFR: forward, AGGCACGAGTAACAAGCTCAC; reverse, ATGAGGACATAACCAGCCACC. PCNA: forward, GAGACCAGCCAGAGCGACATAG; reverse, TACTCACTGCCACCTCCAACTTC. CDK2: forward, AGTATGCGTCTGAGAGGTGATCC; reverse, TGACATCCAGCAGCCTAGAGAAG. Cyclin D: forward, GATGGCTGGAGGCTGAGGAG-3'; reverse, GGAGGGCGGATTGGAAATGAAC. Bcl-2: forward, GTCTTCGCTGCGGAGATCAT; reverse, CATTCCGATATACGCTGGGAC. Bax: forward, CGTCCCTGATCCCGCCTCTG; reverse, GAGCACTCCCGCCACAAAGATG. Caspase 3: forward, GCCGAGACCACGCCACTG; reverse, AGGGAGGGAGACAGCACAGAG. GAPDH: forward, GACTTCAACAGCGACACCCACTC; reverse, CCCAGCCACATACCAGGAAATGAG. The conditions were as follows: denaturation at 95℃ for 5 min, denaturation at 95℃ for 10s, and annealing at 60℃ for 30s, a total of 40 cycles. The relative expression of target genes relative to GAPDH was calculated using the 2^−ΔΔCt method.

Western blotting

Proteins were extracted from foreskin tissues or transfected cells using RIPA lysis buffer (HY-101032, MCE) containing 1% Protease Inhibitor Cocktail (HY-B0496, MCE). The protein concentration was measured using the bicinchoninic acid (BCA) method, and the samples were added to 10% SDS-PAGE gels for electrophoresis. The loading volume for cells was 10 µg/well, and that for tissues was 15 µg/well. After electrophoresis, the proteins were transferred onto polyvinylidene fluoride (PVDF) membranes (Millipore, Billerica, MA, USA). The membranes were blocked in NcmBlot blocking buffer (NCM Biotech) and incubated with the primary antibody (1:1000) overnight at 4°C. The primary antibodies used were as follows: Rab25 (A12275, ABclonal Technology), EGFR (A11351, ABclonal Technology), Integrin-β1 (A19072, ABclonal Technology), PCNA (60097-1-Ig, proteintech), CDK2 (60312-1-Ig, proteintech), Cyclin D (A19038, ABclonal Technology), Bax (50599-2-Ig, proteintech), Bcl-2 (381702, Zen BioScience), Caspase3 (66470-2-Ig, proteintech), β-actin (AM1829B, abcepta). Finally, the membranes were incubated with secondary antibody (1:10000) at room temperature for 1h. Chemiluminescence reagents A and B (1:1) (Biotech) were mixed and added to the PVDF membranes. Protein signals were detected using the Bio-Rad imaging laboratory system (Bio-Rad). The band density was analyzed using the Image Lab software.

Immunohistochemistry

Before slicing, the foreskin tissue was processed as follows: 4% paraformaldehyde-fixed, dehydrated, paraffin-embedded, sliced (4µm). Slices were baked at 60°C for at least 3 h or 37°C for at least 1 day. After baking at 60°C for 2 h, the slices were dewaxed, hydrated, and repaired with sodium citrate solution. After antigen retrieval, the slices were washed with phosphate buffer (PBS) (3 times × 10 min). The slices were blocked with BSA solution after the addition of endogenous peroxidase inhibitor (reagent Ⅰ) (Zhongshan, Beijing, China). Primary antibodies (1:200) (ABclonal Technology) were incubated overnight at 4°C. After washing three times, the slices were added to a reaction-enhancing solution (reagentⅡ) and incubated with the corresponding secondary antibodies (reagentⅢ) (Zhongshan, Beijing, China). For staining, the slices were added to a DAB chromogenic solution (Zhongshan, Beijing, China). The coloration times of the other groups were consistent with the estimated coloration times of the positive group. Finally, the slices were counterstained with hematoxylin and sealed. The data were processed using BioRadCFXManager software.

Cell Counting Kit-8 (CCK-8) assay

Transfected cells were seeded in 96-well plates at a density of 3x10³ cells/well. At specified time points (0, 24, 48, and 72h), 10 µl of the CCK-8 (MCE) solution was added to each well. After 1 h incubation at 37°C, the absorbance was measured at 450 nm using a microplate reader. This experiment was conducted thrice with three replicates for both the NC and shRab25 groups. The cell-free background absorbance of the medium was subtracted from all absorbance measurements. The cell growth curve was sketched using the time on the horizontal axis and OD value on the vertical axis.

Flow cytometry analysis of cell cycle and apoptosis

The supernatant from the 10-cm culture dishes was placed in a centrifuge tube. The dishes were washed twice with calcium- and magnesium-free PBS. The washing liquid was then placed in the corresponding centrifuge tube. The attached cells were digested with 0.25% trypsin (without EDTA) (PWL061, Meilunbio) for 5 min, and the reaction was terminated with the medium. The cells digested from the culture dishes were transferred to the corresponding centrifuge tube, centrifuged at 1000 rpm for 5 min, washed, and centrifuged twice. Cells (1×10⁶) were resuspended in 500 µL of Binding Buffer and placed in a 1.5 mL EP tube. After incubation with 10µl Annexin V-APC, EP tubes were incubated at room temperature in the dark for 10 min and centrifuged at 1000 rpm for 5 min. After discarding the supernatant, EP tudes were added to 500 µL Binding Buffer containing 10 µL PI. To detect cell cycle distribution, transfected cells were collected, fixed with 75% ethanol at 4°C overnight, and resuspended in PBS after centrifugation. Cell samples were treated with RNase (50 µg/ml) and stained with phycoerythrin (PE, 50 µg/ml). After incubation at room temperature for 30 min in the dark, the samples were analyzed. Finally, the cells in the EP tudes were dispensed into flow tubes and detected using a flow cytometer CytoFLEX. CytExpert_2.4. software was used to process the data.

Wound-healing assay

Cells (2 × 10⁵ cells/well) were inoculated into 6-well plates, and a wound-healing assay was conducted until the cells covered the 6-well plates. The plates were wounded with 10ul short shotgun tips and washed 3 times with PBS. The 10% serum medium was replaced with 1% serum medium and cleaned before photography. Photographs were obtained every 12 h (0, 12, 24, and 36h). The migration rate was calculated as follows: migration rate (%) = (Area0–AreaN)/Area0 × 100%, where Area0 represents the area at 0 h, and AreaN represents the area at the indicated time. Each experiment was repeated thrice.

Scanning Electron Microscopy

Penile tissues were washed with saline, fixed with 3% glutaraldehyde, dehydrated in alcohol, and sputtered with gold before SEM examination (JSM-IT700HR/LV, Tokyo, Japan).

Statistical analysis

All quantitative data are presented as the mean ± standard deviation (SD) or rate (%). GraphPad Prism software (version 9.0) was used for the statistical analysis of each group. The ANOVA (One-way ANOVA) was used to analyze multiple groups of data, and data from the two groups were analyzed using an unpaired t-test. P < 0.05 was considered statistically significant.

Rab25: ras-associated binding protein 25, EGFR: epidermal growth factor receptor, SEM: scanning electron microscope, GT: genital tubercle GD, gestation day, WT: wild-type, EMT: epidermal-mesenchymal transition, MET: mesenchymal-epithelial transition, PCR: polymerase chain reaction

Acknowledgments: We would acknowledge the support of the Dept. of Urology of Children’s Hospital of Chongqing Medical University and the financial support of the National Natural Science Foundation of China and the Natural Science Foundation of Chongqing Science and Technology Commission.

Funding This study was funded by [National Natural Science Foundation of China] (Grant numbers [81970571]) and [Natural Science Foundation of Chongqing Science and Technology Commission] (Grant numbers [CSTB2022NSCQ-MSX1001]).

Author’s contributions Authors confirm contribution to the paper as follows: conceptualization, methodology, experimental execution, data analysis, writing: QZ; experimental execution, data analysis: CZZ, MZL, YXH, CW, and GXL; data analysis, software: JLS, LCL, and HGW; funding acquisition, supervision, validation, review: XL. All authors have critically reviewed and agreed the final manuscript.

Competing of interests Authors declare no conflict of interest.

Consent statement Each individual signed an informed consent in order to assure privacy and confidentiality. The Institutional Review Board, Children’s Hospital of Chongqing Medical University, reviewed and approved the studies involving human participants. Written informed permission to participate in this study was provided by the participant’s legal guardian/next of kin. Written informed permission was obtained from the individual(s) and minor(s)’ legal guardian/next of kin to publish any potentially identifiable images or data in this article.

Data Availability Datasets used and/or analyzed in the current study are available from the corresponding author upon reasonable request.

Thai, H. T. et al. A New Susceptibility Locus for Hypospadias on Chromosome 7q32.2-Q36.1. Hum Genet 124, 155–160 (2008).
Baskin, L. S. et al. Urethral Seam Formation and Hypospadias. Cell Tissue Res 305, 379–387 (2001).
Joodi, M. et al. The Genetic Factors Contributing to Hypospadias and Their Clinical Utility in Its Diagnosis. J Cell Physiol 234, 5519–5523 (2019).
Carmichael, S. L. et al. Hypospadias and Genes Related to Genital Tubercle and Early Urethral Development. The Journal of urology 190, 1884–1892 (2013).
Bouty, A., Ayers, K. L., Pask, A., Heloury, Y. & Sinclair, A. H. The Genetic and Environmental Factors Underlying Hypospadias. Sex Dev 9, 239–259 (2015).
Kojima, Y. et al. Spermatogenesis, Fertility and Sexual Behavior in a Hypospadiac Mouse Model. The Journal of urology 167, 1532–1537 (2002).
Uda, A. et al. Morphological Features of External Genitalia in Hypospadiac Rat Model: 3-Dimensional Analysis. The Journal of urology 171, 1362–1366 (2004).
Staib, P., Kau, N., Romalo, G. & Schweikert, H. U. Oestrogen Formation in Genital and Non-Genital Skin Fibroblasts Cultured from Patients with Hypospadias. Clin Endocrinol (Oxf) 41, 237–243 (1994).
Hass, U. et al. Combined Exposure to Anti-Androgens Exacerbates Disruption of Sexual Differentiation in the Rat. Environmental health perspectives 115 Suppl 1, 122–128 (2007).
Gray, L. E., Jr., Ostby, J. S. & Kelce, W. R. Developmental Effects of an Environmental Antiandrogen: The Fungicide Vinclozolin Alters Sex Differentiation of the Male Rat. Toxicol Appl Pharmacol 129, 46–52 (1994).
Cheng, K. W., Lahad, J. P., Gray, J. W. & Mills, G. B. Emerging Role of Rab Gtpases in Cancer and Human Disease. Cancer Res 65, 2516–2519 (2005).
Subramani, D. & Alahari, S. K. Integrin-Mediated Function of Rab Gtpases in Cancer Progression. Mol Cancer 9, 312 (2010).
Goldenring, J. R. & Nam, K. T. Rab25 as a Tumour Suppressor in Colon Carcinogenesis. Br J Cancer 104, 33–36 (2011).
Cheng, J. M. et al. Tumor Suppressor Function of Rab25 in Triple-Negative Breast Cancer. International journal of cancer 126, 2799–2812 (2010).
Zhang, Q. et al. Expression of Rab25 Is Down-Regulated in the Foreskin of Children with Hypospadias. Journal of pediatric urology (2023).
Yamada, G., Satoh, Y., Baskin, L. S. & Cunha, G. R. Cellular and Molecular Mechanisms of Development of the External Genitalia. Differentiation 71, 445–460 (2003).
Glenister, T. W. The Origin and Fate of the Urethral Plate in Man. J Anat 88, 413–425 (1954).
Qian, C. et al. Conditional Deletion of Platelet Derived Growth Factor Receptor Alpha (Pdgfra) in Urorectal Mesenchyme Causes Mesenchyme Apoptosis and Urorectal Developmental Anomalies in Mice. Cell Death Differ 26, 1396–1410 (2019).
Wang, X., Kumar, R., Navarre, J., Casanova, J. E. & Goldenring, J. R. Regulation of Vesicle Trafficking in Madin-Darby Canine Kidney Cells by Rab11a and Rab25. J Biol Chem 275, 29138–29146 (2000).
Welz, T., Wellbourne-Wood, J. & Kerkhoff, E. Orchestration of Cell Surface Proteins by Rab11. Trends Cell Biol 24, 407–415 (2014).
Nam, K. T. et al. Loss of Rab25 Promotes the Development of Intestinal Neoplasia in Mice and Is Associated with Human Colorectal Adenocarcinomas. J Clin Invest 120, 840–849 (2010).
Elbakry, A., Matar, A., Zalata, K., Zakaria, A. & Al Atrash, G. Microvasculature and Healing Potential of the Inner Versus Outer Preputial Skin: Preliminary Immunohistochemical Observations. Int Urol Nephrol 47, 217–222 (2015).
Miettinen, P. J. et al. Epidermal Growth Factor Receptor Function Is Necessary for Normal Craniofacial Development and Palate Closure. Nat Genet 22, 69–73 (1999).
Zhang, L. et al. Rab25-Mediated Egfr Recycling Causes Tumor Acquired Radioresistance. iScience 23, 100997 (2020).
Wang, J. et al. Rab25 Promotes Erlotinib Resistance by Activating the Β1 Integrin/Akt/Β-Catenin Pathway in Nsclc. Cell Prolif 52, e12592 (2019).
Jeong, B. Y. et al. Rab25 Augments Cancer Cell Invasiveness through a Β1 Integrin/Egfr/Vegf-a/Snail Signaling Axis and Expression of Fascin. Exp Mol Med 50, e435 (2018).
Suzuki, K. et al. Regulation of Outgrowth and Apoptosis for the Terminal Appendage: External Genitalia Development by Concerted Actions of Bmp Signaling [Corrected]. Development 130, 6209–6220 (2003).
Jones, R. G. et al. Conditional Deletion of Beta1 Integrins in the Intestinal Epithelium Causes a Loss of Hedgehog Expression, Intestinal Hyperplasia, and Early Postnatal Lethality. J Cell Biol 175, 505–514 (2006).
Brakebusch, C. et al. Skin and Hair Follicle Integrity Is Crucially Dependent on Beta 1 Integrin Expression on Keratinocytes. Embo j 19, 3990–4003 (2000).
Faraldo, M. M., Deugnier, M. A., Thiery, J. P. & Glukhova, M. A. Growth Defects Induced by Perturbation of Beta1-Integrin Function in the Mammary Gland Epithelium Result from a Lack of Mapk Activation Via the Shc and Akt Pathways. EMBO Rep 2, 431–437 (2001).
Green, D. R. Apoptotic Pathways: The Roads to Ruin. Cell 94, 695–698 (1998).
Huang, X., Yokota, T., Iwata, J. & Chai, Y. Tgf-Beta-Mediated Fasl-Fas-Caspase Pathway Is Crucial During Palatogenesis. J Dent Res 90, 981–987 (2011).
Ezratty, E. J., Bertaux, C., Marcantonio, E. E. & Gundersen, G. G. Clathrin Mediates Integrin Endocytosis for Focal Adhesion Disassembly in Migrating Cells. J Cell Biol 187, 733–747 (2009).
Ye, X. & Weinberg, R. A. Epithelial-Mesenchymal Plasticity: A Central Regulator of Cancer Progression. Trends Cell Biol 25, 675–686 (2015).
Zeisberg, M., Shah, A. A. & Kalluri, R. Bone Morphogenic Protein-7 Induces Mesenchymal to Epithelial Transition in Adult Renal Fibroblasts and Facilitates Regeneration of Injured Kidney. J Biol Chem 280, 8094–8100 (2005).
Acebedo, A. R. et al. Mesenchymal Actomyosin Contractility Is Required for Androgen-Driven Urethral Masculinization in Mice. Commun Biol 2, 95 (2019).
Kim, S. et al. Convergence and Extrusion Are Required for Normal Fusion of the Mammalian Secondary Palate. PLoS Biol 13, e1002122 (2015).
Teng, T., Teng, C. S., Kaartinen, V. & Bush, J. O. A Unique Form of Collective Epithelial Migration Is Crucial for Tissue Fusion in the Secondary Palate and Can Overcome Loss of Epithelial Apoptosis. Development 149 (2022).
Stenmark, H. & Olkkonen, V. M. The Rab Gtpase Family. Genome Biol 2, Reviews3007 (2001).
Aiello, N. M. et al. Emt Subtype Influences Epithelial Plasticity and Mode of Cell Migration. Dev Cell 45, 681–695.e684 (2018).

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Inhibition of Rab25 correlates with proliferation, apoptosis, and migration of foreskin fibroblasts via the β1- integrin/EGFR pathway in hypospadias

Status:

Version 1

Abstract

Figures

Introduction

Results

Rab25 expression was decreased in foreskin fibroblasts transfected with lentivirus

Rab25-mediated activation of the β1-integrin/EGFR signaling pathway

Cell migration was inhibited in foreskin fibroblasts transfected with lentivirus

External morphology of GT in Rab25^−/− mouse

Discussion

Materials and methods

Patients and samples

Animals

Foreskin fibroblast isolation, culture, and lentivirus transfection

Polymerase chain reaction (PCR)

Western blotting

Immunohistochemistry

Cell Counting Kit-8 (CCK-8) assay

Flow cytometry analysis of cell cycle and apoptosis

Wound-healing assay

Scanning Electron Microscopy

Statistical analysis

Abbreviations

Declarations

References

Additional Declarations

Status:

Version 1

Inhibition of Rab25 correlates with proliferation, apoptosis, and migration of foreskin fibroblasts via the β1- integrin/EGFR pathway in hypospadias

Status:

Version 1

Abstract

Figures

Introduction

Results

Rab25 expression was decreased in foreskin fibroblasts transfected with lentivirus

Rab25-mediated activation of the β1-integrin/EGFR signaling pathway

Cell migration was inhibited in foreskin fibroblasts transfected with lentivirus

External morphology of GT in Rab25−/− mouse

Discussion

Materials and methods

Patients and samples

Animals

Foreskin fibroblast isolation, culture, and lentivirus transfection

Polymerase chain reaction (PCR)

Western blotting

Immunohistochemistry

Cell Counting Kit-8 (CCK-8) assay

Flow cytometry analysis of cell cycle and apoptosis

Wound-healing assay

Scanning Electron Microscopy

Statistical analysis

Abbreviations

Declarations

References

Additional Declarations

Status:

Version 1

External morphology of GT in Rab25^−/− mouse