The Role and Therapeutic Potential of the TFAP2C-EIF5A Signaling Pathway in Bladder Cancer Development

doi:10.21203/rs.3.rs-3453188/v1

Download PDF

Research Article

The Role and Therapeutic Potential of the TFAP2C-EIF5A Signaling Pathway in Bladder Cancer Development

https://doi.org/10.21203/rs.3.rs-3453188/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Bladder cancer is a common malignant tumor, and the molecular mechanisms underlying its onset and progression are unclear. In this study, we analyzed the cellular heterogeneity and subpopulations of bladder cancer patients using single-cell sequencing data, and found that the expression levels of the transcription factor TFAP2C and the translation initiation factor EIF5A were significantly elevated in bladder cancer tissues and positively correlated with cancer mortality. Further in vitro experiments verified that TFAP2C could up-regulate the expression of EIF5A, thereby promoting the proliferation, migration and invasion ability of bladder cancer cells. In addition, we found that inhibition or activation of EIF5A could affect the function of TFAP2C. These results reveal the important role of the TFAP2C-EIF5A signaling pathway in bladder cancer development and provide new targets and strategies for the future treatment of bladder cancer.

bladder cancer

TFAP2C

EIF5A

Bladder cancer is a prevalent form of malignancy globally, ranking as the fourth most common malignancy in men. It exhibits a high incidence and mortality rate, with an estimated annual occurrence of around 500,000 new cases and 200,000 deaths worldwide¹. Bladder cancer is a commonly encountered but insufficiently investigated malignancy. Patients with bladder cancer who progress to a muscle-invasive stage face a dismal prognosis. Hence, elucidating the pathogenic mechanism of bladder cancer holds significance in enhancing patient prognosis, establishing the groundwork for anti-tumor experiments, and identifying novel targets for bladder cancer gene therapy.

The transcription factor TFAP2C, commonly referred to as AP-2γ, is a member of the activator protein-2 (AP-2) family of transcription factors. TFAP2C possesses transcriptional potential that encompasses DNA binding and regulation^{2, 3}. TFAP2C assumes a vital role in embryonic development, as indicated by human protein profiles that primarily localize TFAP2C in the skin or esophagus^{4, 5}. Recent studies have demonstrated the significant involvement of TFAP2C in regulating cell proliferation, cell cycle progression, apoptosis, and the development of multiple cancers, thereby impacting tumor sensitivity to chemotherapy^6–9. In colorectal cancer (CRC), TFAP2C facilitates chemoresistance through the regulation of the Hippo signaling pathway¹⁰. In seminoma, TFAP2C enhances resistance to cisplatin chemotherapy¹¹. Through the regulation of EGFR and NF-κB, TFAP2C downregulation sensitizes bladder cancer cells to cisplatin treatment¹². This finding highlights the crucial involvement of the transcription factor TFAP2C in tumor progression, particularly in bladder cancer.

The eukaryotic translation initiation factor 5A (eIF5A) is an 18 kDa protein encoded by the EIF5A gene and exhibits high conservation from archaea to humans. eIF5A is indispensable for normal mammalian development and plays a crucial role in translation elongation, mRNA transport, as well as cell cycle progression and proliferation^13–15. Vertebrates harbor two genes that encode highly homologous isoforms of eIF5A, namely eIF5A1 and eIF5A2, with an 84% similarity in humans. eIF5A1 exhibits ubiquitous expression in all tissues, whereas eIF5A2 expression is primarily limited to the brain and testis. Previous studies have demonstrated that spermidine serves as an eIF5A activator, promoting eIF5A expression¹⁶. GC7 sulfate functions as an eIF5A inhibitor, suppressing the hydroxyl putrescine lysine action of eIF5A¹⁷. While the precise role of eIF5A protein in protein synthesis remains incompletely understood, evidence suggests its association with oncogenicity in bladder cancer, non-small cell lung cancer, prostate cancer, and neuroblastoma tumor cells^{15, 18–23}. Both TFAP2C and eIF5A contribute to tumor cell proliferation, migration, and invasion, thereby facilitating the progression of bladder cancer. However, the potential synergistic effects and collaborative promotion of migration and invasion in bladder cancer cells by these factors have not been reported.

This study encompassed the collection of multiple sets of bladder cancer single-cell sequencing data, followed by integrated analysis, validation of the findings, and investigation of the regulatory relationship between TFAP2C-EIF5A signaling and bladder cancer progression. These investigations employed techniques such as RNA interference technology or overexpression vectors. The findings from this study indicate that TFAP2C enhances the proliferation, migration, and invasive capacity of bladder cancer cells by upregulating EIF5A.

The raw data for this study were obtained from the National Center for Biotechnology Information (GEO) database, specifically GSE135337 and GSE186520. The dataset comprised 10X genomic information from nine bladder cancer patients and three samples of paracancerous healthy bladder tissue. The sequencing data from the 12 samples were combined, and preprocessing and preliminary clustering analysis of the raw data were performed using R (version 3.5.1, https://www.r-project.org/) and the Seurat package (version 3.0, https://satijalab.org/seurat/).Initially, Seurat was employed to read the transcriptome data of the samples, initialize the Seurat object, and proceed with the data preprocessing. The initial preprocessing step involved quality control to identify high-quality cells. The screening criteria included a minimum and maximum threshold for the amount of detected RNA per cell (nFeature_RNA) (200 and 4000, respectively). A low nFeature_RNA value suggests the presence of dead cells or empty droplets, while excessively high nFeature_RNA and nCount_RNA values indicate potential encapsulation of multiple cells in a droplet. Additionally, cells with a mitochondrial gene content percentage (per cent.mt) below 10% were considered for further analysis [67].

The initial step in processing single-cell data involves clonotype identification analysis of the single-cell sequencing data. Subsequently, data quality control processing is performed using the Seurat package. The processed data are further analyzed using the R language to construct KNN graphs based on PCA. Nonlinear dimensionality reduction using UMAP is then executed, followed by UMAP dimensionality reduction visualization for the identification of cancer cell populations, utilizing the inferCNV package.

Differentially expressed genes were identified using the FindMarkers function in RStudio software. In this study, the "logic.threshold" was chosen as the threshold to determine differential gene expression.

The Metascape database (https:/ / metascape.org/gp/ index.html#/ main/ step1) was utilized to predict the functional information associated with the differentially expressed genes. The results were analyzed using GO enrichment analysis, KEGG pathway analysis, WikiPathways analysis, and Reactome PA analysis. A significance threshold of P value < 0.01 was applied.

The Gene Expression Profiling Interactive Analysis (GEPIA) database (http:// gepia2.cancer-pku.cn/ #index) was employed to examine the expression of TFAP2C and EIF5A in bladder cancer patients. Additionally, correlation analysis was conducted to determine the association between the two genes, as well as their correlation with overall tumor survival (OS).

Bladder cancer tissue

We selected tissue specimens from 30 patients with bladder cancer who underwent surgery at Second Hospital of Tianjin Medical University, between January 2020 and December 2022 to form the bladder cancer group. Corresponding tissue specimens from the same patients were chosen as the paracancerous group. The study was approved by the medical ethics committee of our hospital, and all patients provided informed consent.

Cell culture and transfection

SV-HUC-1, T24, UM-UC-3, 5637, and RT-112 cells were obtained from the cell bank of the Typical Culture Collection Committee of the Chinese Academy of Sciences. The cells were cultured in DMEM medium supplemented with 10% fetal bovine serum, 1×10^5 U/L penicillin, and 1×10^5 U/L streptomycin in a constant temperature incubator at 37 ℃ with 5% CO2. The medium was refreshed every 2 days, and the cells were subcultured every 3–4 days. Only cells in the logarithmic growth phase were used for the experiments.

The experimental cells were categorized into different groups: the control group (pcDNA3.1), TFAP2C overexpression group (pcDNA3.1-TFAP2C), EIF5A inhibition group (GC7), and TFAP2C overexpression combined with EIF5A inhibition group (pcDNA3.1-TFAP2C + GC7). The cells were plated in 6-well plates and transfected when they reached approximately 50%-60% confluence. The culture medium was replaced 5 hours after transfection. The next day, Lipofectamine 3000 was used to transfect the empty vector (EV) or TFAP2C overexpression plasmid, and the cells were transfected for functional assays after 48 hours. Similarly, for knockdown experiments, the cells were divided into the control group (sh-CTRL), TFAP2C knockdown group (sh-TFAP2C), EIF5A activation group (Spermidine), and TFAP2C knockdown combined with EIF5A activation group (sh-TFAP2C + Spermidine). Transfection experiments were carried out following similar procedures.

CCK8

Cell suspensions in the logarithmic growth phase were prepared and then seeded into 96-well plates at a density of 1,000 cells per well, with 5 wells per group as replicates. The absorbance (D) of each well was measured at 450 nm using an enzyme-linked immunosorbent assay (ELISA) reader, and the absorbance data were analyzed to generate the growth curve.

Clone formation assay

400 cells were seeded in each well of a 6-well plate, with 3 replicate wells per group. The cells were then incubated in a cell culture incubator for approximately 10–14 days until the clones reached the desired size. Once the clones were properly sized, the 6-well plates were carefully removed, and the cell culture medium was discarded. The wells were washed once with phosphate-buffered saline (PBS), followed by the addition of 1 mL of 4% paraformaldehyde to each well for a 60-minute fixation period. After the fixation step, the wells were washed with PBS again, and then 1 mL of a 0.25% crystal violet solution was added to each well. The clones were stained at room temperature for 15–30 minutes. Finally, the number of clones was counted.

Cell Migration and Invasion Assays

Cells to be assayed were collected in suspension using serum-free medium and then seeded into the upper chambers of a density configuration of 5,000 cells per well. For the transwell invasion assay, the inserts were pre-coated with a substrate at a dilution of 1:30 (BD Biosciences, Franklin Lakes, NJ, USA). In contrast, for the Transwell migration assay, the inserts were not pre-coated with a basement membrane matrix. The lower chambers were incubated with medium containing 10% fetal bovine serum for 48 hours. After the incubation period, non-invaded cells in the upper chambers were gently removed using a cotton swab, fixed with a 4% paraformaldehyde solution for 10 minutes, and subsequently stained with crystal violet solution for 30 minutes. The chambers were then carefully removed and images were captured using a microscope. At least 5 sets of photographs were taken for each treatment group.

Real-time qPCR

Total RNA was extracted using the RNAiso Plus kit (Takara) for RNA extraction. Subsequently, cDNA was synthesized using the PrimeScript™ RT reagent Kit with gDNA Eraser (Takara) reverse transcription kit. Quantitative PCR (qPCR) was performed using the TBGreen Premix Ex Taq (TaKaRa) kit. The PCR reaction parameters consisted of a two-step method with the following conditions: initial denaturation at 95 ℃ for 5 minutes, followed by denaturation at 95 ℃ for 15 seconds, annealing at 60 ℃ for 55 seconds, and a total of 38 cycles.

The primer sequences used for amplification were as follows: for TFAP2C, the upstream primer was CACCTGTTGCTGCACGATCAGA and the downstream primer was AGGAGCGACAATCTTCCAGGGA; for EIF5A, the upstream primer was AACGGCTTCGTGGTGCTCAAAG and the downstream primer was GCCCGTGAAAATATATCAATTCCAAC; and for the internal reference gene GAPDH, the upstream primer was GTCTCCTCTGACTTCAACAGCG and the downstream primer was ACCACCCTGTTGCTGTAGCCAA. The relative expression levels of TFAP2C mRNA and EIF5A mRNA were calculated using the 2-ΔΔCt method, with GAPDH as the internal reference gene.

Western blot

The total protein from each cell group was extracted, and the protein concentration was determined using the BCA (Thermo Scientific) method. PVDF membranes were used for protein transfer, and primary antibodies against GAPDH (1:5,000, Abcam, Cambridge, UK), EIF5A (1:1,000, Abcam, Cambridge, UK), and TFAP2C (1:10,000, Abcam, Cambridge, UK) were added to the membranes and incubated at room temperature for 1 hour. The PVDF membranes were then refrigerated overnight at 4°C. On the following day, the PVDF membranes were washed three times with TBST solution and incubated with corresponding secondary antibodies at room temperature for 1 hour. After washing the membranes three times with TBST for 10 minutes each, quantification was performed using Analyzer 4 software (Media Cybernetics, Inc., Rockville, MD, USA).

5-Bromo-2-deoxyuridine (BrdU) staining assay

The cells were plated in 24-well plates, transfected, and subsequently cultured in fresh medium. Upon reaching 80% confluence, the cells were exposed to 10 µmol/L BrdU and incubated at 37 ℃ for 4 hours. Following removal of the cell culture medium, the cells underwent three consecutive 5-minute washes with PBS. Subsequently, they were fixed with 70% anhydrous ethanol at 4 ℃ for 10 minutes, followed by three additional PBS washes of 5 minutes each. To denature the cellular DNA, 2 mol/L HCl was added and incubated at 37 ℃ for 40 minutes. Afterwards, 1.0% BSA was applied to the cells and incubated at room temperature for 1 hour. The cells were then rinsed three times with PBS for 5 minutes each. The PBS on the cell surface was aspirated, and BrdU monoclonal antibody (1:2000 dilution, 100 µL/well, Abcam, Cambridge, UK) was added and incubated overnight at 4°C. The following day, FITC-labeled goat anti-mouse fluorescent secondary antibody was added and incubated at room temperature for 2 hours. After counterstaining all cell nuclei with PI, observations were conducted using a fluorescent microscope (Nikon Corporation, Tokyo, Japan). Ten non-overlapping fields of view (×100) were randomly selected to count the number of BrdU-positive cells, and the mean value was calculated.

Statistical analysis

The data from this experiment were subjected to statistical analysis using GraphPad Prism Version 8.3 software. A paired or unpaired t-test was employed for comparing two groups, while ANOVA was utilized for comparing multiple groups. Statistical significance was determined based on the p-value, with * indicating P < 0.05, ** indicating P < 0.01, and *** indicating P < 0.001. All samples were independently replicated three times.

The expression of TFAP2C is elevated in patients with bladder cancer and demonstrates a positive correlation with cancer mortality.

For the comprehensive analysis of single-cell data collected from bladder cancer patients^24–26, we categorized the 12 human samples into three groups: normal, non-invasive, and invasive (Fig. 1A). By employing established markers, we successfully identified 16 distinct cell populations, namely epithelial (EPCAM, SFN), basal (EPCAM, SFN, KRT5), intermediate (EPCAM, SFN, KRT13), umbrella (EPCAM, SFN, KRT20, UPK3A), pro-epithelial (EPCAM, SFN, MKI67, TOP2A), fibroblasts (COL1A1, DCN, PDGFRA), adipocytes (COL1A1, DCN, TCF21, APOE), myofibroblasts (COL1A1, DCN, ACTA2, TAGLN), smooth muscle (ACTA2, TAGLN), pericytes (COL1A1, DCN, RGS5, PDGFRB), capillary (PECAM1, CLDN5, PTPRB, CD93), macrophages (PTPRC, CD68, C1QA, APOE), monocytes (PTPRC, CD14, S100A8), dendritic cells (PTPRC, CSF2RA, CD1C, LAMP3), B cells (PTPRC, CD79A, MS4A1), and T cells (PTPRC, CD3E, CD3D) (Fig. 1B-D). Additionally, we utilized the inferCNV package to accurately identify cancer cell populations (Fig. 1B-E).

Considering the initiation of bladder cancer within the bladder epithelium, we conducted an analysis of transcription factor activity in various cell types including cancer cells, epithelial cells, basal cells, intermediate cells, umbrella cells, and pro-epithelial cells. Our findings indicate higher transcriptional activities of FOS, EGR1, and TFAP2C in cancer cells compared to other cell types (Fig. 2A). Moreover, the expression levels of FOS, EGR1, and TFAP2C genes were significantly elevated in cancer cells when compared to normal epithelial cells (Fig. 2B). Further analysis utilizing the GEPIA database demonstrated a significant increase in TFAP2C expression levels in bladder cancer tissues as compared to normal tissues (Fig. 2C). Consistent with these findings, qPCR analysis revealed a marked increase in TFAP2C expression levels in bladder cancer tissues compared to normal tissues (Fig. 2D). This observation was corroborated by the significant elevation of TFAP2C protein levels in bladder cancer tissues (Fig. 2E-F). Notably, analysis using the GEPIA database revealed a significant negative correlation between high TFAP2C expression and the survival rate of bladder cancer patients (Fig. 2G). Taken together, these results strongly suggest that TFAP2C may play a crucial role in the development of bladder cancer.

EIF5A is a target protein of TFAP2C

Utilizing single-cell sequencing data, we employed computational methods to predict the target genes of FOS, EGR1, and TFAP2C, as illustrated in Fig. 3A. Our analysis revealed that EIF5A has been implicated in the progression of various cancers^{23, 27}. Hence, we proceeded to assess the correlation between TFAP2C and EIF5A expression levels in both the non-muscle invasive bladder cancer (NMIBC) and muscle invasive bladder cancer (MIBC) groups, using single-cell sequencing data (Fig. 3B). We observed an increased correlation between TFAP2C and EIF5A expression levels in cancer cells compared to normal epithelial cells. Furthermore, analysis using the GEPIA database corroborated these findings by demonstrating a positive correlation between TFAP2C expression levels in bladder cancer tissues and EIF5A expression levels (Fig. 3C). This consistency with the single-cell sequencing results suggests that TFAP2C likely regulates the expression of EIF5A. To further validate the regulatory role of TFAP2C on EIF5A, we conducted experiments using the bladder cancer cell line T24. Knocking down TFAP2C resulted in a significant reduction in EIF5A protein levels (Fig. 3D-E), while overexpressing TFAP2C led to a significant decrease in EIF5A protein levels (Fig. 3G-H). Similar results were observed in another bladder cancer cell line, 5637 (Fig. 3D, F, G, and I). Collectively, these findings strongly support the notion that TFAP2C positively regulates EIF5A expression.

The expression of EIF5A is elevated in patients with bladder cancer and exhibits a positive correlation with cancer mortality

We obtained three sets of differential genes through different comparisons: one set by comparing cancer cells with normal epithelium in the NMIBC group, another set by comparing cancer cells with normal epithelium in the MIBC group, and the last set by comparing cancer cells with epithelial cells in the normal control groups of both NMIBC and MIBC. By taking the intersection, we identified sixteen up-regulated genes and eight down-regulated differential genes (Fig. 4A and B). These differential genes underwent KEGG enrichment analysis, which revealed enrichment in the "Bladder cancer" pathway, indicating their potential involvement in bladder cancer progression (Fig. 4C). In both the NMIBC and MIBC groups, EIF5A showed a significant increase in expression levels in cancer cells compared to normal epithelial cells (Fig. 4D). Analysis using the GEPIA database confirmed significantly elevated EIF5A expression levels in bladder cancer tissues compared to normal tissues (Fig. 4E). Furthermore, qPCR assays demonstrated a significant increase in EIF5A expression levels in bladder cancer tissues (Fig. 4F). Consistent with these findings, EIF5A protein levels were significantly elevated in bladder cancer tissues (Fig. 4G and H). Additionally, analysis using the GEPIA database revealed a significant negative correlation between high EIF5A expression and the survival rate of bladder cancer patients (Fig. 4I). These results collectively suggest that EIF5A likely plays a crucial role in the development of bladder cancer.

TFAP2C enhances the proliferation, migration, and invasion of bladder cancer cells through its interaction with EIF5A

Using single-cell data, we classified cancer cells into two subpopulations based on the expression levels of TFAP2C and/or EIF5A. TFAP2C^high cancer cells exhibited significantly higher expression of genes related to cell proliferation (KI67, PCNA, MCM2) and migration (TNC, SNAI1, CTNNB1, CDH1, VIM, ITGB1) compared to TFAP2C^low cancer cells (sFig. 1A). Similarly, EIF5A^high cancer cells showed significantly higher expression of cell proliferation and migration-related genes than EIF5A^low cancer cells (Fig. 1B).

Moreover, the expression of cell proliferation and migration-related genes was significantly higher in TFAP2C^highEIF5A^high cancer cells compared to TFAP2C^lowEIF5A^low cancer cells (Fig. 5A). To further confirm the regulatory effect of TFAP2C on EIF5A in bladder cancer cells, we conducted experiments using the T24 bladder cancer cell line. We established a control group (pcDNA3.1), TFAP2C overexpression group (pcDNA3.1-TFAP2C), EIF5A inhibition group (GC7), and TFAP2C overexpression combined with EIF5A inhibition group (pcDNA3.1-TFAP2C + GC7).

The percentage of EdU-positive T24 cells was significantly increased in the pcDNA3.1-TFAP2C group compared to the pcDNA3.1 group, while it was significantly decreased in the pcDNA3.1-TFAP2C + GC7 group compared to the pcDNA3.1-TFAP2C group (Fig. 5B). CCK8 assay revealed enhanced proliferation ability in the pcDNA3.1-TFAP2C group compared to the pcDNA3.1 group, which was significantly reduced in the pcDNA3.1-TFAP2C + GC7 group compared to the pcDNA3.1-TFAP2C group (Fig. 5C). The number of T24 cell clones and migrating T24 cells were significantly increased in the pcDNA3.1-TFAP2C group compared to the pcDNA3.1 group, whereas they were significantly decreased in the pcDNA3.1-TFAP2C + GC7 group compared to the pcDNA3.1-TFAP2C group (Fig. 5D-E). Additionally, the pcDNA3.1-TFAP2C group displayed an increased number of invading T24 cells compared to the pcDNA3.1 group, while the pcDNA3.1-TFAP2C + GC7 group exhibited a decreased number of invading T24 cells compared to the pcDNA3.1-TFAP2C group (Fig. 5F).

Similar results were observed in the 5637 bladder cancer cell line (Fig. 5B-F). These findings indicate that TFAP2C overexpression promotes the proliferation, migration, and invasion abilities of bladder cancer cells, and inhibition of EIF5A impairs the pro-carcinogenic effect of TFAP2C.

We established experimental groups using two bladder cancer cell lines, T24 and 5637 cells, including a control group (sh-CTRL), a TFAP2C knockdown group (sh-TFAP2C), an EIF5A activation group (Spermidine), and a TFAP2C knockdown combined with EIF5A activation group (sh-TFAP2C + Spermidine).

Compared to the sh-CTRL group, the sh-TFAP2C group exhibited significantly reduced proliferation (Fig. 5G-I), migration (Fig. 5J), and invasion (Fig. 5K) of both T24 and 5637 cells. Moreover, the sh-TFAP2C + Spermidine group showed further reduction in proliferation (Fig. 5G-I), migration (Fig. 5J), and invasion (Fig. 5K) compared to the sh-TFAP2C group. These findings confirm that TFAP2C promotes the proliferation, migration, and invasion abilities of bladder cancer cells through upregulation of EIF5A.

The purpose of this study is to explore the roles of TFAP2C and EIF5A in the development of bladder cancer. Through the analysis of single-cell sequencing data and the GEPIA database, we have observed an increase in the expression levels of TFAP2C and EIF5A in bladder cancer tissues, which also exhibit a positive correlation with cancer mortality. Additionally, we have discovered that TFAP2C can upregulate the expression of EIF5A, thereby promoting the proliferation, migration, and invasive capabilities of bladder cancer cells. These findings provide novel insights and contribute to a better understanding of the mechanisms underlying the occurrence and progression of bladder cancer.

TFAP2C, an eminent transcription factor belonging to the esteemed AP-2 family, actively engages in a myriad of biological processes, including cell differentiation, proliferation, apoptosis, and migration^{12, 28} Its extraordinary expression aberrations have been witnessed in various malignancies, displaying a close correlation with tumor invasiveness and prognostic implications²⁸. Our findings impeccably demonstrate a remarkable surge in TFAP2C expression within bladder cancer tissues, a phenomenon that parallels the increased cancer mortality rates. This congruence with prior research underscores the oncogenic potential of TFAP2C in bladder cancer^{12, 29}. Moreover, we have uncovered an enthralling revelation - TFAP2C exerts an elevating influence on the expression of EIF5A, thereby fostering the proliferative, migratory, and invasive capabilities of bladder cancer cells. This cogently elucidates how TFAP2C may impact the biological behavior of bladder cancer cells by artfully regulating downstream genes.

EIF5A is a distinctive translational factor, a protein that stands alone in its possession of the non-natural amino acid, hypusine³⁰. It gracefully partakes in a multitude of biological processes, such as cell cycle regulation, apoptosis, autophagy, and inflammatory responses¹⁶. Remarkably, EIF5A's expression anomalies have been linked to various cancers, bearing a profound association with tumor invasiveness and prognosis^{23, 27}. Our findings eloquently reveal a noteworthy augmentation in EIF5A expression within bladder cancer tissues, impeccably aligning with an increase in cancer mortality rates. This congruence with prior research substantiates EIF5A's oncogenic role in bladder cancer^{27, 31}. Furthermore, we have uncovered a captivating revelation - TFAP2C's ability to upregulate EIF5A expression, thus diligently fostering the proliferative, migratory, and invasive capacities of bladder cancer cells. This insight illuminates the significance of EIF5A as a pivotal target gene of TFAP2C, playing a critical role in the orchestrated development of bladder cancer mediated by TFAP2C.

The outcomes of this investigation have bequeathed us with novel therapeutic targets. Given the augmented expression of TFAP2C and EIF5A in bladder cancer tissues, and the former's engagement in cancer progression by modulating EIF5A, they may indeed serve as pivotal molecular markers and therapeutic focal points for bladder cancer. Pharmacological intervention directed at the conjoint targets of TFAP2C and EIF5A could potentially wield efficacy as an adept approach in the future treatment of bladder cancer. For instance, suppressing TFAP2C's expression or activity while concurrently inhibiting EIF5A's purinyl modification might more effectively restrain the proliferative, migratory, and invasive capacities of bladder cancer cells, thus attenuating or thwarting the progression of bladder cancer^{23, 32}.

Certainly, this research is merely preliminary, and further investigations are imperative for validation. For instance, a greater corpus of clinical data is necessary to buttress the findings of this study, and an array of experiments must be embarked upon to delve into the exact mechanistic roles of TFAP2C and EIF5A in bladder cancer development. Furthermore, an assessment of the in vivo safety and efficacy of drugs targeting TFAP2C and EIF5A, alongside their synergistic effects with other therapeutic modalities, is also warranted. These endeavors will furnish us with more evidence to substantiate TFAP2C and EIF5A as potential targets for bladder cancer therapy.

This research also carries some limitations. Firstly, our exploration of TFAP2C and EIF5A's functions relied solely on two bladder cancer cell lines, which may not adequately represent the diversity and heterogeneity of bladder cancer cells. Future endeavors should incorporate a greater variety of bladder cancer cell lines and animal models to validate our discoveries. Secondly, we solely analyzed the relationship between TFAP2C and EIF5A at the transcriptional and protein levels without delving deeper into their molecular mechanisms. Utilizing gene editing techniques and proteomics can help unveil their mutual interactions and signaling pathways. Thirdly, we focused solely on TFAP2C and EIF5A's roles in bladder cancer cell proliferation, migration, and invasion, while neglecting their involvement in other aspects such as cell apoptosis, autophagy, and inflammatory responses. Future undertakings should comprehensively assess their overall contributions to bladder cancer cell biology.

Funding

Supported by the Key Laboratory Research Fund of Tianjin Medical University Second Hospital (grants 20120zdsys14).

Contributions

Dr. Liwei Liu had full access to all study data. Liwei Liu designed the research. MingDe Lei and Liwei Liu wrote the main manuscript text. MingDe Lei, Shicheng Zhang and Qi Han acquired data. Liwei Liu and MingDe Lei analysed and interpreted data. All authors have read and approved the final manuscript.

Conflict of interest

The authors have no relevant financial or non-financial interests to disclose.

Siegel, R. L.; Miller, K. D.; Jemal, A., Cancer statistics, 2018. CA Cancer J Clin 2018, 68 (1), 7-30.
Mazina, O. M.; Phillips, M. A.; Williams, T.; Vines, C. A.; Cherr, G. N.; Rice, R. H., Redistribution of transcription factor AP-2alpha in differentiating cultured human epidermal cells. J Invest Dermatol 2001, 117 (4), 864-70.
Aqeilan, R. I.; Palamarchuk, A.; Weigel, R. J.; Herrero, J. J.; Pekarsky, Y.; Croce, C. M., Physical and functional interactions between the Wwox tumor suppressor protein and the AP-2gamma transcription factor. Cancer Res 2004, 64 (22), 8256-61.
Wang, Y.; Chen, S.; Jiang, Q.; Deng, J.; Cheng, F.; Lin, Y.; Cheng, L.; Ye, Y.; Chen, X.; Yao, Y.; Zhang, X.; Shi, G.; Dai, L.; Su, X.; Peng, Y.; Deng, H., TFAP2C facilitates somatic cell reprogramming by inhibiting c-Myc-dependent apoptosis and promoting mesenchymal-to-epithelial transition. Cell Death Dis 2020, 11 (6), 482.
Sharma, N.; Kubaczka, C.; Kaiser, S.; Nettersheim, D.; Mughal, S. S.; Riesenberg, S.; Holzel, M.; Winterhager, E.; Schorle, H., Tpbpa-Cre-mediated deletion of TFAP2C leads to deregulation of Cdkn1a, Akt1 and the ERK pathway, causing placental growth arrest. Development 2016, 143 (5), 787-98.
Eckert, D.; Buhl, S.; Weber, S.; Jager, R.; Schorle, H., The AP-2 family of transcription factors. Genome Biol 2005, 6 (13), 246.
Pinto, L.; Drechsel, D.; Schmid, M. T.; Ninkovic, J.; Irmler, M.; Brill, M. S.; Restani, L.; Gianfranceschi, L.; Cerri, C.; Weber, S. N.; Tarabykin, V.; Baer, K.; Guillemot, F.; Beckers, J.; Zecevic, N.; Dehay, C.; Caleo, M.; Schorle, H.; Gotz, M., AP2gamma regulates basal progenitor fate in a region- and layer-specific manner in the developing cortex. Nat Neurosci 2009, 12 (10), 1229-37.
De Andrade, J. P.; Park, J. M.; Gu, V. W.; Woodfield, G. W.; Kulak, M. V.; Lorenzen, A. W.; Wu, V. T.; Van Dorin, S. E.; Spanheimer, P. M.; Weigel, R. J., EGFR Is Regulated by TFAP2C in Luminal Breast Cancer and Is a Target for Vandetanib. Mol Cancer Ther 2016, 15 (3), 503-11.
Kim, W.; Kim, E.; Lee, S.; Kim, D.; Chun, J.; Park, K. H.; Youn, H.; Youn, B., TFAP2C-mediated upregulation of TGFBR1 promotes lung tumorigenesis and epithelial-mesenchymal transition. Exp Mol Med 2016, 48 (11), e273.
Wang, X.; Sun, D.; Tai, J.; Chen, S.; Yu, M.; Ren, D.; Wang, L., TFAP2C promotes stemness and chemotherapeutic resistance in colorectal cancer via inactivating hippo signaling pathway. J Exp Clin Cancer Res 2018, 37 (1), 27.
Wei, J.; Yin, Y.; Zhou, J.; Chen, H.; Peng, J.; Yang, J.; Tang, Y., METTL3 potentiates resistance to cisplatin through m(6) A modification of TFAP2C in seminoma. J Cell Mol Med 2020, 24 (19), 11366-11380.
Xing, J.; Chen, W.; Chen, K.; Zhu, S.; Lin, F.; Qi, Y.; Zhang, Y.; Han, S.; Rao, T.; Ruan, Y.; Zhao, S.; Yu, W.; Cheng, F., TFAP2C Knockdown Sensitizes Bladder Cancer Cells to Cisplatin Treatment via Regulation of EGFR and NF-kappaB. Cancers (Basel) 2022, 14 (19).
Michael, A. J., Polyamines in Eukaryotes, Bacteria, and Archaea. J Biol Chem 2016, 291 (29), 14896-903.
Caraglia, M.; Park, M. H.; Wolff, E. C.; Marra, M.; Abbruzzese, A., eIF5A isoforms and cancer: two brothers for two functions? Amino Acids 2013, 44 (1), 103-9.
Fujimura, K.; Choi, S.; Wyse, M.; Strnadel, J.; Wright, T.; Klemke, R., Eukaryotic Translation Initiation Factor 5A (EIF5A) Regulates Pancreatic Cancer Metastasis by Modulating RhoA and Rho-associated Kinase (ROCK) Protein Expression Levels. J Biol Chem 2015, 290 (50), 29907-19.
Zhang, H.; Alsaleh, G.; Feltham, J.; Sun, Y.; Napolitano, G.; Riffelmacher, T.; Charles, P.; Frau, L.; Hublitz, P.; Yu, Z.; Mohammed, S.; Ballabio, A.; Balabanov, S.; Mellor, J.; Simon, A. K., Polyamines Control eIF5A Hypusination, TFEB Translation, and Autophagy to Reverse B Cell Senescence. Mol Cell 2019, 76 (1), 110-125 e9.
Giraud, S.; Kerforne, T.; Zely, J.; Ameteau, V.; Couturier, P.; Tauc, M.; Hauet, T., The inhibition of eIF5A hypusination by GC7, a preconditioning protocol to prevent brain death-induced renal injuries in a preclinical porcine kidney transplantation model. Am J Transplant 2020, 20 (12), 3326-3340.
Dever, T. E.; Gutierrez, E.; Shin, B. S., The hypusine-containing translation factor eIF5A. Crit Rev Biochem Mol Biol 2014, 49 (5), 413-25.
Gutierrez, E.; Shin, B. S.; Woolstenhulme, C. J.; Kim, J. R.; Saini, P.; Buskirk, A. R.; Dever, T. E., eIF5A promotes translation of polyproline motifs. Mol Cell 2013, 51 (1), 35-45.
Shang, Y.; Zhao, X.; Tian, B.; Wang, Y.; Ren, F.; Jia, B.; Zhai, Y.; Chen, W.; He, D.; Chang, Z., CHIP/Stub1 interacts with eIF5A and mediates its degradation. Cell Signal 2014, 26 (5), 1098-104.
Epis, M. R.; Giles, K. M.; Kalinowski, F. C.; Barker, A.; Cohen, R. J.; Leedman, P. J., Regulation of expression of deoxyhypusine hydroxylase (DOHH), the enzyme that catalyzes the activation of eIF5A, by miR-331-3p and miR-642-5p in prostate cancer cells. J Biol Chem 2012, 287 (42), 35251-35259.
Schultz, C. R.; Geerts, D.; Mooney, M.; El-Khawaja, R.; Koster, J.; Bachmann, A. S., Synergistic drug combination GC7/DFMO suppresses hypusine/spermidine-dependent eIF5A activation and induces apoptotic cell death in neuroblastoma. Biochem J 2018, 475 (2), 531-545.
Wei, J. H.; Cao, J. Z.; Zhang, D.; Liao, B.; Zhong, W. M.; Lu, J.; Zhao, H. W.; Zhang, J. X.; Tong, Z. T.; Fan, S.; Liang, C. Z.; Liao, Y. B.; Pang, J.; Wu, R. H.; Fang, Y.; Chen, Z. H.; Li, B.; Xie, D.; Chen, W.; Luo, J. H., EIF5A2 predicts outcome in localised invasive bladder cancer and promotes bladder cancer cell aggressiveness in vitro and in vivo. Br J Cancer 2014, 110 (7), 1767-77.
Lai, H.; Cheng, X.; Liu, Q.; Luo, W.; Liu, M.; Zhang, M.; Miao, J.; Ji, Z.; Lin, G. N.; Song, W.; Zhang, L.; Bo, J.; Yang, G.; Wang, J.; Gao, W. Q., Single-cell RNA sequencing reveals the epithelial cell heterogeneity and invasive subpopulation in human bladder cancer. Int J Cancer 2021, 149 (12), 2099-2115.
Wu, K.; Zeng, J.; Shi, X.; Xie, J.; Li, Y.; Zheng, H.; Peng, G.; Zhu, G.; Tang, D.; Wu, S., Targeting TIGIT Inhibits Bladder Cancer Metastasis Through Suppressing IL-32. Front Pharmacol 2021, 12, 801493.
Lok, C., Plans to reduce acceptable arsenic limit put on hold. Nature 2001, 410 (6828), 503.
Coni, S.; Serrao, S. M.; Yurtsever, Z. N.; Di Magno, L.; Bordone, R.; Bertani, C.; Licursi, V.; Ianniello, Z.; Infante, P.; Moretti, M.; Petroni, M.; Guerrieri, F.; Fatica, A.; Macone, A.; De Smaele, E.; Di Marcotullio, L.; Giannini, G.; Maroder, M.; Agostinelli, E.; Canettieri, G., Blockade of EIF5A hypusination limits colorectal cancer growth by inhibiting MYC elongation. Cell Death Dis 2020, 11 (12), 1045.
Alim, I.; Caulfield, J. T.; Chen, Y.; Swarup, V.; Geschwind, D. H.; Ivanova, E.; Seravalli, J.; Ai, Y.; Sansing, L. H.; Ste Marie, E. J.; Hondal, R. J.; Mukherjee, S.; Cave, J. W.; Sagdullaev, B. T.; Karuppagounder, S. S.; Ratan, R. R., Selenium Drives a Transcriptional Adaptive Program to Block Ferroptosis and Treat Stroke. Cell 2019, 177 (5), 1262-1279 e25.
Kolat, D.; Kaluzinska, Z.; Pluciennik, E., Fragile Gene WWOX Guides TFAP2A/TFAP2C-Dependent Actions Against Tumor Progression in Grade II Bladder Cancer. Front Oncol 2021, 11, 621060.
Barba-Aliaga, M.; Alepuz, P., Role of eIF5A in Mitochondrial Function. Int J Mol Sci 2022, 23 (3).
Chen, Z.; Yu, T.; Zhou, B.; Wei, J.; Fang, Y.; Lu, J.; Guo, L.; Chen, W.; Liu, Z. P.; Luo, J., Mg(II)-Catechin nanoparticles delivering siRNA targeting EIF5A2 inhibit bladder cancer cell growth in vitro and in vivo. Biomaterials 2016, 81, 125-134.
Zhou, B. F.; Wei, J. H.; Chen, Z. H.; Dong, P.; Lai, Y. R.; Fang, Y.; Jiang, H. M.; Lu, J.; Zhou, F. J.; Xie, D.; Luo, J. H.; Chen, W., Identification and validation of AIB1 and EIF5A2 for noninvasive detection of bladder cancer in urine samples. Oncotarget 2016, 7 (27), 41703-41714.

No competing interests reported.

sFigure1.docx

Download PDF

Version 1

posted

You are reading this latest preprint version

The Role and Therapeutic Potential of the TFAP2C-EIF5A Signaling Pathway in Bladder Cancer Development

Status:

Version 1

Abstract

Figures

Introduction

Material and method

Bladder cancer tissue

Cell culture and transfection

CCK8

Clone formation assay

Cell Migration and Invasion Assays

Real-time qPCR

Western blot

5-Bromo-2-deoxyuridine (BrdU) staining assay

Statistical analysis

Result

EIF5A is a target protein of TFAP2C

Discussion

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1