Selenium Yeast Mitigates Diquat-Induced Oxidative Stress in Rooster Testicles and Preserves Reproductive Performance

doi:10.21203/rs.3.rs-3453797/v1

Download PDF

Research Article

Selenium Yeast Mitigates Diquat-Induced Oxidative Stress in Rooster Testicles and Preserves Reproductive Performance

https://doi.org/10.21203/rs.3.rs-3453797/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background:Diquat (DQ) is a pro-oxidant that generates free radicals in cells through redox reactions, leading to the induction of oxidative stress. It is widely utilized in agricultural production across many countries. During the processes of growth and reproduction, poultry are particularly vulnerable to oxidative stress. Selenium yeast (SeY) serves as an organic selenium source characterized by high activity and low toxicity, imparting antioxidant effects. The objective of this study was to assess the protective effects of SeY against DQ-induced oxidative stress in rooster testicles and its impact on reproductive performance. A cohort of 60 healthy Kangle yellow roosters participated in this investigation. These roosters were randomly and equally divided into four groups: the control group, the DQ group, the SeY and DQ group, and the SeY group.

Results: The results demonstrated that SeY pretreatment mitigated DQ-induced oxidative damage in the testes. This mitigation encompassed the alleviation of inhibited spermatogenesis, reduced spermatogenic cell abundance, decreased expression of genes related to testosterone synthesis, and amelioration of impaired reproductive performance. Specifically, SeY pretreatment counteracted DQ-induced oxidative stress by activating the Nrf2/HO-1 antioxidant signaling pathway, enhancing the activity of antioxidant enzymes such as catalase (CAT) and total superoxide dismutase (T-SOD), and reducing the concentration of malondialdehyde (MDA). Furthermore, SeY pretreatment attenuated DQ-induced spermatogonia apoptosis by modulating the expression of apoptosis-related genes and proteins, including Bax, Bcl-2, Caspase3, and NF-κB. Additionally, SeY restored the proliferative capacity of spermatogenic cells by promoting the expression of the proliferation-related protein Ki67.

Conclusions: The aforementioned findings signify that SeY effectively safeguards the testes against DQ-induced damage through mechanisms involving the reduction of oxidative stress, inhibition of apoptosis, promotion of proliferation, and the preservation of reproductive performance in roosters. This study lays a solid theoretical foundation for future research aimed at safeguarding the reproductive health of male poultry exposed to agricultural pesticides.

rooster testicles

selenium yeast

diquat

oxidative stress

apoptosis

reproductive performance

Diquat (DQ), a non-selective bipyridine herbicide serving as a paraquat substitute, has found widespread application in agricultural production across numerous countries [1]. Residues of DQ in edible vegetables or inadvertent ingestion of this chemical can lead to substantial harm to various organs [2]. DQ operates as a pro-oxidant, generating free radicals via redox reactions and inciting oxidative stress within cells [3]. Due to these characteristics, DQ is frequently employed as an inducer of oxidative stress in the development of in vivo or in vitro oxidative stress models [4]. Studies have revealed that DQ-induced oxidative stress induces pathological alterations in the histological structure of the small intestine, liver, and kidneys in ICR mice. Moreover, it significantly elevates the apoptotic index in jejunal epithelial tissue [5]. Furthermore, DQ has been observed to reduce total superoxide dismutase (T-SOD) activity in serum and catalase (CAT) activity in the livers of broiler chickens, while concurrently increasing malondialdehyde (MDA) concentrations in both serum and liver tissues, resulting in oxidative damage to the chickens [6]. Consequently, DQ-induced oxidative stress can inflict severe harm on animals. Nonetheless, information concerning the effects of DQ on male reproductive health remains limited.

Selenium (Se) stands as an indispensable trace element for both humans and animals, playing pivotal roles in antioxidant defense, detoxification, and bolstering immune functions [7,8]. Several investigations have highlighted that Se deficiency can inflict varying degrees of harm on different organs and tissues in chickens, encompassing oxidative and apoptotic damage [9,10]. To fulfill the selenium requirements of broilers, dietary supplementation with inorganic or organic selenium is commonplace. Notably, the inclusion of organic selenium in the diet, as opposed to inorganic forms, has been shown to significantly enhance both reproductive performance and antioxidant capabilities in chickens [11]. One such organic selenium source, selenium yeast (SeY), is routinely incorporated into diets [12]. Nevertheless, it remains to be elucidated whether SeY can mitigate oxidative stress and testicular damage in roosters induced by DQ.

Our findings reveal that DQ can induce oxidative stress in rooster testes, resulting in damage to testicular structure and impaired reproductive performance. Importantly, SeY pretreatment effectively mitigates DQ-induced testicular injury by suppressing oxidative stress and apoptosis while preserving the expression levels of genes and proteins associated with testosterone synthesis. This study offers fresh perspectives on the detrimental impact of DQ on rooster reproductive biology and underscores the role of SeY in mitigating DQ-induced testicular impairments. These results are poised to facilitate future investigations into safeguarding the reproductive health of male poultry in the face of pesticides used in agriculture, ultimately contributing to enhanced animal welfare.

SeY ameliorates histoarchitectural damage of rooster testes induced by DQ

In our investigation of testicular injuries and the influence of SeY in response to DQ treatment in roosters, we conducted measurements of testicular histoarchitectures. Histological examination using H.E. staining revealed that DQ treatment led to a reduction in germinal epithelium height (Fig. 1a) and a decrease in the number of spermatogenic cells (p<0.05; Fig. 1b) compared to the control testes. Furthermore, spermatogenesis was significantly inhibited in response to DQ treatment when compared to control roosters, signifying compromised testicular spermatogenic function. Encouragingly, SeY pretreatment effectively shielded the roosters from testicular damage induced by DQ. As depicted in Fig. 1, SeY mitigated testicular injury, resulting in a reduced number of spermatogenic cells and inhibited spermatogenesis when administered alongside DQ. It is noteworthy that SeY pretreatment alone exhibited no discernible impact on spermatogenesis and testicular histoarchitectures (Fig. 1).

SeY protects testis against oxidative stress induced by DQ

TTo assess DQ-induced oxidative stress in the testes, we measured antioxidative indicators in testicular tissue. Comparing the DQ-treated group with the control testes, we observed a significant decrease (p<0.05) in the activities of antioxidant enzymes, catalase (CAT), and total superoxide dismutase (T-SOD), accompanied by a marked increase (p<0.05) in malondialdehyde (MDA) concentration (Fig. 2a, b, c). Notably, SeY pretreatment effectively reversed these changes induced by DQ (Fig. 2a, b, c). Furthermore, the mRNA expression levels of key antioxidative genes, namely Nrf2, HO-1, and Gpx1, were significantly reduced (p<0.05) in the DQ-treated group (Fig. 2d, e, f). SeY pretreatment substantially restored the diminished expression of these genes caused by DQ (p<0.05; Fig. 2d, e, f). Additionally, it's worth noting that both SeY pretreatment alone and in combination with DQ significantly elevated the mRNA expression levels of Nrf2 and Gpx1 in the testes when compared to control testes (p<0.05; Fig. 2d, f). Consequently, SeY effectively shielded the testes from DQ-induced oxidative stress by bolstering antioxidant enzyme activity and activating the Nrf2/HO-1 antioxidant signaling pathway.

SeY attenuates DQ-induced apoptosis in the rooster testes

A previous study has demonstrated that oxidative stress can induce apoptosis in cells [13]. Our results corroborate this observation as we found a notable increase in both the number and the rate of TUNEL-positive cells within the seminiferous tubules of the DQ-treated group, compared to the control group, signifying a significant induction of apoptosis (p<0.05; Fig. 3a, b, c). Remarkably, SeY pretreatment effectively mitigated this increase, indicating its role in alleviating DQ-induced testicular apoptosis (Fig. 3a, b, c). Furthermore, we assessed the expression of apoptosis-related markers, including Bax, Bcl-2, Caspase3, and NF-κB, using qRT-PCR and Western blot analyses. Our findings revealed that SeY reversed the upregulation of pro-apoptotic proteins such as Bax, Caspase3, and the Bax/Bcl-2 ratio, along with the inflammatory response-related molecule NF-κB. Additionally, it restored the downregulation of the anti-apoptotic protein Bcl-2, all of which were induced by DQ (p<0.05; Fig. 3d, e, f, g). Consistent with these results, qRT-PCR data mirrored the variations in mRNA and protein levels of these molecules (p<0.05; Fig. 3i, j, k). Notably, SeY pretreatment alone had no discernible impact on the expression levels of these proteins (Fig. 3d, e, f, g). Consequently, our findings firmly establish that SeY effectively inhibits DQ-induced testicular apoptosis in roosters.

Additionally, we assessed the expression pattern of the proliferation-associated protein Ki67 within the seminiferous tubules. As depicted in Fig. 4, a diminished number of Ki67-positive spermatogenic cells was evident in the DQ-treated group compared to the other three groups, and this decrease was effectively reversed by SeY treatment (p<0.05). These results underscore the pronounced testicular damage primarily localized within the seminiferous tubules, confirming that DQ-induced testicular injury is associated with inhibited cell proliferation.

SeY restores the DQ-disrupted expression levels of molecules related to testosterone synthesis

Testosterone synthesis plays a pivotal role in regulating rooster reproduction performance [14]. In our study, we investigated the expression of key markers associated with testosterone synthesis, namely StAR, P450scc, and 3β-HSD. Our Western blot results revealed a significant decrease (p<0.05) in the expression levels of StAR, P450scc, and 3β-HSD in the testes of DQ-treated roosters compared to the control group. Consistently, the mRNA expression patterns of these molecules followed the same variation trend. Importantly, SeY pretreatment effectively reversed these alterations, as depicted in Fig. 5. These findings strongly indicate that SeY restores the disrupted expression levels of molecules related to testosterone synthesis, thereby maintaining the normal reproductive performance of roosters.

Diquat (DQ) is a non-selective bipyridyl herbicide that has found extensive use in global agricultural production [15]. A survey study has documented DQ poisoning in humans, which can lead to rhabdomyolysis [16]. Notably, in the United States, between 1998 and 2013, 300 acute illnesses were associated with paraquat, while 144 were linked to DQ exposure, with herbicide spillage or splashing being a significant cause of such illnesses [17]. Furthermore, DQ exposure has been shown to damage multiple organs, including the kidneys, lungs, small intestines, liver, and central nervous system [18-21]. Hence, the detrimental effects of pesticides on animals warrant close attention. It is noteworthy, however, that DQ appears to have a relatively weaker impact on male reproductive function. Currently, low concentrations of DQ are widely used as inducers of oxidative stress in certain animal models [5,22]. In our study, we present evidence that DQ induces oxidative stress in rooster testes, resulting in histological damage to the testicular seminiferous epithelium and disruption of the expression of molecules involved in testosterone synthesis.

Selenium, an essential trace element for animals, is distributed throughout the body. Selenium in nature primarily exists in two forms: organic selenium and inorganic selenium. Previous studies have consistently demonstrated that selenium from organic sources exhibits greater bioavailability than its inorganic counterparts [23,24]. Selenium-enriched yeast (SeY) primarily consists of organic selenium compounds, such as selenomethionine, and their analogues [25]. Importantly, SeY has been shown to reduce the production of reactive oxygen species (ROS) and mitigate cellular oxidative damage in various animal species [26-28]. Our findings align with these previous reports, demonstrating that SeY effectively mitigates testicular oxidative damage and preserves normal reproductive performance in roosters exposed to DQ.

Prior research has extensively documented that Diquat (DQ) can generate reactive oxygen species (ROS) by interacting with molecular oxygen, disrupting the delicate balance between oxidation and antioxidant mechanisms in tissues, and subsequently leading to oxidative stress [29-31]. This oxidative stress is characterized by a decline in the activity of antioxidant enzymes, such as catalase (CAT) and total superoxide dismutase (T-SOD), alongside an elevation in malondialdehyde (MDA) levels [32]. Furthermore, oxidative stress is associated with a downregulation of expression levels of antioxidant-related molecules, including Nrf2, HO-1, and Gpx1 [33]. In our study, we observed a concordant trend in CAT, T-SOD, and MDA levels in rooster testes, consistent with the oxidative stress induced by DQ treatment. Additionally, the Nrf2/HO-1 antioxidant signaling pathway was found to be suppressed.

Oxidative stress can induce reproductive toxicity in mice, manifesting as a reduction in the number and motility of sperm, along with an increased rate of sperm deformity [34,35]. Similarly, in mice, DQ treatment has been shown to shorten the germinal epithelium height and reduce the number of spermatogenic cells [36], aligning with the findings of our study in rooster testes. Notably, selenium, a critical component of the enzyme glutathione peroxidase, plays a pivotal role in detoxifying lipid peroxides and protecting cells from ROS-induced damage [37]. Previous studies have demonstrated that selenium yeast (SeY) can rescue testicular toxicity induced by aluminum-induced oxidative stress in mice [38]. Our results further corroborate these findings, showing that SeY effectively reverses rooster testicular oxidative damage induced by DQ exposure, while also activating the Nrf2/HO-1 signaling pathway.

Previous studies have provided evidence that Diquat (DQ)-induced oxidative stress contributes to apoptosis in various animal models [1,29,31]. Consequently, we formulated the hypothesis that DQ-induced oxidative stress could trigger apoptosis in rooster testicular cells. As anticipated, the results of TUNEL staining revealed an increased number of apoptotic cells in the testes of roosters treated with DQ. Notably, spermatogenic cells appeared to be the most affected by DQ-induced apoptosis. In mice testes, DQ treatment has been shown to elevate the expression levels of pro-apoptotic proteins Bax and Caspase3, while diminishing the expression of the anti-apoptotic protein Bcl-2 [36]. The ratio of Bax to Bcl-2 has been proposed as a critical determinant in the regulation of apoptosis, with an increased ratio being indicative of apoptosis [33]. Conversely, treatment with selenium yeast (SeY) reduced Caspase3 expression and the Bax/Bcl-2 ratio. This aligns with previous reports suggesting that SeY can protect tissues from external damage through its synergistic anti-inflammatory, antioxidant, and anti-apoptotic properties [39,40].

Furthermore, a prior study demonstrated that the NF-κB/p53 signaling pathway, which is related to inflammatory responses, is implicated in DQ-induced mitochondrial dysfunction and apoptosis [41]. Our results indicate that SeY treatment can mitigate DQ-induced upregulation of NF-κB, thus offering a protective effect against these inflammatory responses and apoptotic processes.

The secretion of androgens and the production of normal sperm by the testes are pivotal for maintaining the normal reproductive function of males [42]. Furthermore, previous studies have elucidated the significant roles played by testosterone synthesis-related molecules, namely StAR, P450scc, and 3β-HSD, in the regulation of steroid synthesis [14]. Consequently, the preservation of testosterone synthesis assumes critical importance in upholding male reproductive performance. Notably, in mice testes, exposure to Bisphenol S (BPS) has been shown to induce oxidative stress by inhibiting the Nrf2/HO-1 signaling pathway, leading to a suppression in the expression of StAR, P450scc, and 3β-HSD, ultimately resulting in male reproductive toxicity [43].

In our study, we also examined the expression levels of these key testosterone synthesis-related molecules. As anticipated, the abundance of these molecules was diminished following Diquat (DQ) exposure. However, treatment with selenium yeast (SeY) effectively rescued the expression of these molecules, aligning with prior research in goats demonstrating that SeY can promote testicular development and spermatogenesis through the modulation of testosterone synthesis [44].

A prior study has provided evidence that selenium yeast (SeY) can enhance the antioxidant defense system in chicken kidneys by activating the Nrf2/Keap1 signaling pathway [40]. Furthermore, another study has demonstrated that selenium alleviates cadmium-induced cardiac oxidative damage through the activation of the AHR/CAR/PXR/Nrf2 signaling pathway [45]. Additionally, a previous investigation has shown that selenium ameliorates mercuric chloride-induced brain injury by mitigating apoptosis and inflammation, involving the activation of the BDNF/TrKB/PI3K/AKT pathway and the suppression of the NF-κB pathway [46]. However, there remains a scarcity of studies elucidating the specific molecular mechanisms underlying the role of SeY in alleviating oxidative stress and apoptosis in animals, particularly within the reproductive system.

In light of our findings, combined with previous reports, we conducted preliminary explorations into the protective effects of SeY against the reproductive damage induced by Diquat (DQ), as well as the associated molecular mechanisms. It is of great interest to propose that SeY may mitigate DQ-induced injury to rooster testes by inhibiting oxidative stress, apoptosis, and inflammation through the activation of the Nrf2/HO-1 signaling pathway and the concurrent suppression of the NF-κB signaling pathway. However, further comprehensive investigations are warranted to unravel the intricacies of these mechanisms.

To summarize, our findings demonstrate that SeY effectively safeguards rooster testes against oxidative stress and apoptosis induced by DQ by maintaining the expression levels of testosterone synthesis-related molecules. Consequently, our research offers a promising theoretical foundation for considering SeY as a potential preventive or mitigating agent to counteract the reproductive damage inflicted by DQ, a widely employed herbicide in agricultural practices. This holds significant implications for practical poultry production.

Animal treatments and samples collection

We obtained a group of sixty healthy Kangle yellow roosters at the age of 180 days from a farm in Jiangxi province. These roosters were carefully selected to have similar body weights, averaging 1.7 ± 0.1 kg, and were randomly divided into four groups, each consisting of 15 roosters. We prepared a SeY solution by dissolving it in distilled water and then mixing it with the basal diet to achieve a Se concentration of 0.5 mg/kg. DQ solutions were prepared using 0.9% NaCl as a solvent. The control group received injections of 0.9% NaCl and was fed a basal diet. In the DQ group, roosters received a single intraperitoneal injection of DQ at a dose of 15 mg/kg BW, along with the basal diet. The SeY group received 0.9% NaCl injections and was fed a basal diet supplemented with SeY. The DQ and SeY group also received a single intraperitoneal injection of DQ at a dose of 15 mg/kg BW, along with the basal diet containing SeY. The SeY groups were pre-treated with SeY for 14 days before DQ treatment, and they continued to be fed the basal diet containing SeY. DQ intraperitoneal injections were administered only once. After 4 days of DQ treatment, we collected testicular tissue samples, with some being fixed in 4% paraformaldehyde, some preserved in liquid nitrogen, and some placed in tissue lysate.

Paraffin sections preparation

Paraffin section preparation followed established procedures [47]. Rooster testicular tissue samples, fixed in 4% paraformaldehyde, underwent rinsing in running water overnight at room temperature, followed by graded alcohol dehydration. Subsequently, the samples were immersed in xylene and paraffin, and then embedded in liquid paraffin. Once solidified, the paraffin-embedded samples were sectioned into 5 μm slices using a rotary microtome (RM2235, Leica Biosystems, Buffalo Grove, IL, USA) and mounted on slides. All paraffin sections were stored at 4℃ for further analysis.

Hematoxylin-eosin staining (H.E. staining) and quantitative measurements of spermatogenic cells

The H.E. staining was performed as previously described [48]. Briefly, paraffin sections were deparaffinized in xylene and rehydrated with a graded series of ethanol (100% to 70%) and distilled water, and then stained with hematoxylin and eosin respectively. Subsequently, the sections were dehydrated in a graded series of ethanol (70% to 100%) and xylene, and then sealed with neutral resin. The sections were viewed and photographed using a digital optical microscope system. Ten visual fields (400×) were randomly selected in each group to counted the number of spermatogenic cells, including spermatogonium, primary spermatocyte, secondary spermatocyte and spermatid.

Enzyme activity assays

Various antioxidant-related parameters, including Catalase (CAT), Total Superoxide Dismutase (T-SOD), and Malondialdehyde (MDA), are measure through utilizing the Assay Kits and corresponding protocols provided by Beyotime Biotechnology (Shanghai, China).

Total RNA extraction and cDNA synthesis

Total RNA was extracted from testicular tissue samples using the HP Total RNA Kit (R6812, Omega, Guangzhou, China). The RNA concentration was determined with a NanoDrop 2000 spectrophotometer (NanoDrop Technologies Inc., Wilmington, DE, USA). Chromosomal DNA was removed from the RNA samples using the RQ1 RNase-Free DNase Kit (M6101, Promega, Beijing, China). Subsequently, the RNA samples were reverse-transcribed into cDNA using the HiScript® Ⅱ Q RT SuperMix for qPCR Kit (R222-01, Vazyme, Nanjing, China), and stored at -80 ℃ for subsequent quantitative real-time polymerase chain reaction (qRT-PCR) analysis.

qRT-PCR analysis

Quantitative real-time polymerase chain reaction (qRT-PCR) was performed using primers listed in Table 1. The cDNA was amplified using the ChamQ Universal SYBR qPCR Master Mix Kit (Q711-02, Vazyme, Nanjing, China) and analyzed on the CFA96 TouchTM Real-Time System (Bio-Rad, Richmond, CA, USA). Data analysis was conducted using the 2-ΔΔCt method, with relative expression levels normalized to β-Actin.

TUNEL staining

Terminal deoxynucleotidyl transferase dUTP nick-end labeling (TUNEL) staining was conducted following established protocols [49] to detect apoptotic cells using the In Situ Cell Apoptosis Detection Kit I (POD) (MK1015, Boster, Wuhan, China). As per the manufacturer's instructions, paraffin sections were deparaffinized and rehydrated, followed by washing with distilled water. Proteinase K treatment was carried out at 37 ℃ for 10 min. After three washes with PBS, endogenous peroxidase activity was inhibited using 3% H2O2 for 15 min. Subsequently, sections were balanced for 10 min following three PBS washes, and then treated with TUNEL working solution in a wet box at 37 ℃ for 1.5 h. Sections were next incubated with biotinylated digoxin antibody for 30 min at 37 ℃ and visualized with 3,3'-diaminobenzidine (DAB) solution (ZLI9018, Zhongshan Golden Bridge, Beijing, China). Hematoxylin was used for nuclei counter-staining. TUNEL-positive cells appeared brown, while nuclei were blue. The positive cells were identified, counted, and analyzed under a light microscope. Ten random visual fields (400×) were selected in each group for cell counting. The ratio of TUNEL-positive cells to the total number of cells in the seminiferous tubule was analyzed to assess cell apoptosis.

Protein extraction and western blot analysis

Western blotting was performed following previously established protocols [48]. In brief, testicular tissue samples were lysed in lysis buffer (R0010, Solarbio, Beijing, China), and protein concentration was quantified using the BCA Kit (AR0146, Boster, Wuhan, China). The lysates were separated on 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) gels and then transferred onto polyvinylidene difluoride (PVDF) membranes (Millipore Sigma, Bedford, MA, USA). After blocking with 5% skim milk (A600669, Sangon, Shanghai, China), the PVDF membranes were probed with specific antibodies for Bax (50599-2-lg, Proteintech, Wuhan, China), Bcl-2 (26593-1-AP, Proteintech, Wuhan, China), Caspase3 (PB9188, Boster, Wuhan, China), NF-κB (PB9149, Boster, Wuhan, China), StAR (A00051-1, Boster, Wuhan, China), P450scc (BA3699, Boster, Wuhan, China), 3β-HSD (A02856-2, Boster, Wuhan, China), and β-Actin (BM0627, Boster, Wuhan, China). The membranes were subsequently incubated with the corresponding secondary antibodies conjugated with HRP. Signal detection was carried out using the ECL Kit (WBLUC0500, Millipore, Danvers, MA, USA) and an imaging system (Amersham Imager 600, General Electric, Boston, Massachusetts, USA). Quantification of blot intensity was performed using ImageJ software (National Institutes of Health, Bethesda, Maryland, USA).

Immunohistochemistry

Immunohistochemistry procedures followed established protocols [48]. Paraffin sections were deparaffinized and rehydrated, and antigen retrieval was performed by microwaving sections in 10 mM sodium citrate buffer (pH 6.0) (AR0024, Boster, Wuhan, China) and cooling to room temperature. Endogenous peroxidase activity was quenched with 3% H2O2 for 15 min, and nonspecific binding was blocked with 10% horse serum for 1 h at 37 ℃. Sections were then incubated overnight at 4 ℃ with the Ki67 antibody (bs-23101R, Bioss, Beijing, China). Following incubation, sections were treated with a biotin-labeled goat anti-rabbit IgG antibody (BA1003, Boster) and a streptavidin-conjugated HRP complex (SP9002, Zhongshan Golden Bridge). Signal visualization was achieved using DAB solution, and nuclei were counter-stained with hematoxylin (resulting in blue nuclei and brown Ki67-positive cells). Positively stained cells were identified, counted, and analyzed under a light microscope. Ten random visual fields (400×) were selected in each group to count relevant cells. The ratio of Ki67-positive cells to the total number of cells in the seminiferous tubule was analyzed to assess cell proliferation.

Statistical analysis

Data in this study were presented as means ± standard deviation (SD) and analyzed using GraphPad Prism 5.01 software (GraphPad Software Inc., San Diego, CA, USA). Statistical analyses were conducted using SPSS 22.0 software (SPSS Inc., Chicago, IL, USA), including single-factor variance analysis after LSD multiple comparisons and two-way ANOVA. Significance was determined at p < 0.05.

SeY: Selenium yeast; DQ: Diquat; CAT: Catalase; T-SOD: Total superoxide dismutase; MDA: Malondialdehyde; TUNEL: Terminal deoxynucleotidyl transferase dUTP nick-end labeling; BPS: Bisphenol S; Nrf2: Nuclear factor erythroid 2-related factor 2; HO-1: Heme oxygenase-1; Gpx1: Glutathione peroxidase 1; Bax: Bcl-2-associated X protein; Bcl-2: B-cell lymphoma-2; Caspase3: Cysteinyl aspartate specific proteinases 3; NF-κB: Nuclear factor kappa B; StAR: Steroidogenic acute regulatory protein; P450scc: Cholesterol side-chain cleavage enzyme, 3β-HSD: 3β-hydroxysteroid dehydrogenase.

Acknowledgements

The authors thank Dr. Xiao-Wei Gu (Cincinnati Children's Hospital Medical Center, Cincinnati, USA) for his excellent technical assistance and valuable comments.

Funding

This work was supported by Science and Technology Project of Jiangxi Provincial Department of Education (No. GJJ2201729) and Initial Scientific Research Fund of Yichun University (No. 3360119068). The funder had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

WH and NX carried out the experimental design. NX and SL drafted the manuscript. NX, SL, YL, XD, BW and YL participated in paraffin sections preparation, H.E. staining, enzyme activity assays, TUNEL staining and immunohistochemistry. MF, BL and LZ carried the sampling and histological preparation, and participated in RNA isolation, qRT-PCR, protein isolation and WB. WZ participated in performed the statistical analysis. WH, NX and SL revised the manuscript. All authors read and approved the final manuscript.

Ethics approval and consent to participate

The animal care and experimental procedures used in this study conformed to the regulations and guidelines of the regional Animal Ethics Committee. All protocols used in the current study were approved by the Animal Care and Use Committee of Yichun University, Yichun, China (License number: JXSTUDKY2022009).

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Jin Y, Zhai Z, Jia H, Lai J, Si X, Wu Z. Kaempferol attenuates diquat-induced oxidative damage and apoptosis in intestinal porcine epithelial cells. Food Funct. 2021;12(15):6889-99.
Vanholder R, Colardyn F, De Reuck J, Praet M, Lameire N, Ringoir S. Diquat intoxication: report of two cases and review of the literature. Am J Med. 1981;70(6):1267-71.
Jones GM, Vale JA. Mechanisms of toxicity, clinical features, and management of diquat poisoning: a review. J Toxicol Clin Toxicol. 2000;38(2):123-8.
Koch RE, Hill GE. An assessment of techniques to manipulate oxidative stress in animals. Funct Ecol. 2017;31:9-21.
Zhang H, Liu Y, Fang X, Gu L, Luo C, Chen L, Wang Q. Vitamin D3 protects mice from diquat-induced oxidative stress through the NF-κB/Nrf2/HO-1 signaling pathway. Oxid Med Cell Longev. 2021;2021:6776956.
Zha P, Wei L, Liu W, Chen Y, Zhou Y. Effects of dietary supplementation with chlorogenic acid on growth performance, antioxidant capacity, and hepatic inflammation in broiler chickens subjected to diquat-induced oxidative stress. Poult Sci. 2023;102(3):102479.
Dalia AM, Loh TC, Sazili AQ, Jahromi MF, Samsudin AA. The effect of dietary bacterial organic selenium on growth performance, antioxidant capacity, and Selenoproteins gene expression in broiler chickens. BMC Vet Res. 2017;13(1):254.
Fan RF, Liu JX, Yan YX, Wang L, Wang ZY. Selenium relieves oxidative stress, inflammation, and apoptosis within spleen of chicken exposed to mercuric chloride. Poult Sci. 2020;99(11):5430-39.
Yang J, Hamid S, Cai J, Liu Q, Xu S, Zhang Z. Selenium deficiency-induced thioredoxin suppression and thioredoxin knock down disbalanced insulin responsiveness in chicken cardiomyocytes through PI3K/Akt pathway inhibition. Cell Signal. 2017;38:192-200.
Wan N, Xu Z, Chi Q, Hu X, Pan T, Liu T, Li S. microRNA-33-3p involved in selenium deficiency-induced apoptosis via targeting ADAM10 in the chicken kidney. J Cell Physiol. 2019;234(8):13693-704.
Wang Z, Kong L, Zhu L, Hu X, Su P, Song Z. The mixed application of organic and inorganic selenium shows better effects on incubation and progeny parameters. Poult Sci. 2021;100(2):1132-41.
Noruzi S, Torki M, Mohammadi H. Effects of supplementing diet with Thyme (Thymuas vulgaris L.) essential oil and/or selenium yeast on production performance and blood variables of broiler chickens. Vet Med Sci. 2022;8(3):1137-45.
He R, Cui M, Lin H, Zhao L, Wang J, Chen S, Shao Z. Melatonin resists oxidative stress-induced apoptosis in nucleus pulposus cells. Life Sci. 2018;199:122-30.
Heng D, Zhang T, Tian Y, Yu S, Liu W, Xu K, Liu J, Ding Y, Zhu B, Yang Y, Zhang C. Effects of dietary soybean isoflavones (SI) on reproduction in the young breeder rooster. Anim Reprod Sci. 2017;177:124-31.
Magalhães N, Carvalho F, Dinis-Oliveira RJ. Human and experimental toxicology of diquat poisoning: Toxicokinetics, mechanisms of toxicity, clinical features, and treatment. Hum Exp Toxicol. 2018;37(11):1131-60.
Feng D, Fu L, Du X, Yao L. Acute diquat poisoning causes rhabdomyolysis. Am J Med Sci. 2022;364(4):472-80.
Fortenberry GZ, Beckman J, Schwartz A, Prado JB, Graham LS, Higgins S, Lackovic M, Mulay P, Bojes H, Waltz J, Mitchell Y, Leinenkugel K, Oriel MS, Evans E, Calvert GM. Magnitude and characteristics of acute paraquat- and diquat-related illnesses in the US: 1998-2013. Environ Res. 2016;146:191-9.
Wu Y, Cui S, Wang W, Jian T, Kan B, Jian X. Kidney and lung injury in rats following acute diquat exposure. Exp Ther Med. 2022;23(4):275.
Zhou N, Tian Y, Liu W, Tu B, Xu W, Gu T, Zou K, Lu L. Protective effects of resveratrol and apigenin dietary supplementation on serum antioxidative parameters and mRNAs expression in the small intestines of diquat-challenged pullets. Front Vet Sci. 2022;9:850769.
Chen J, Su Y, Lin R, Lin F, Shang P, Hussain R, Shi D. Effects of acute diquat poisoning on liver mitochondrial apoptosis and autophagy in ducks. Front Vet Sci. 2021;8:727766.
Zhou JN, Lu YQ. Lethal diquat poisoning manifests as acute central nervous system injury and circulatory failure: A retrospective cohort study of 50 cases. EClinicalMedicine. 2022;52:101609.
Chen YP, Gu YF, Zhao HR, Zhou YM. Dietary squalene supplementation alleviates diquat-induced oxidative stress and liver damage of broiler chickens. Poult Sci. 2021;100(3):100919.
Zhang L, Liu XR, Liu JZ, An XP, Zhou ZQ, Cao BY, Song YX. Supplemented organic and inorganic selenium affects milk performance and selenium concentration in milk and tissues in the Guanzhong dairy goat. Biol Trace Elem Res. 2018;183(2):254-60.
Hadrup N, Ravn-Haren G. Absorption, distribution, metabolism and excretion (ADME) of oral selenium from organic and inorganic sources: A review. J Trace Elem Med Biol. 2021;67:126801.
Schrauzer GN. Nutritional selenium supplements: product types, quality, and safety. J Am Coll Nutr. 2001;20(1):1-4.
Yang X, Yang C, Tang D, Yu Q, Zhang L. Effects of dietary supplementation with selenium yeast and jujube powder on mitochondrial oxidative damage and apoptosis of chicken. Poult Sci. 2022;101(10):102072.
Liu L, Wu C, Chen D, Yu B, Huang Z, Luo Y, Zheng P, Mao X, Yu J, Luo J, Yan H, He J. Selenium-enriched yeast alleviates oxidative stress-induced intestinal mucosa disruption in weaned pigs. Oxid Med Cell Longev. 2020;2020:5490743.
Samo SP, Malhi M, Kachiwal AB, Gadahi JA, Parveen F, Kalhoro NH, Lei Y. Supranutritional selenium level minimizes high concentrate diet-induced epithelial injury by alleviating oxidative stress and apoptosis in colon of goat. BMC Vet Res. 2020;16(1):462.
Park A, Koh HC. NF-κB/mTOR-mediated autophagy can regulate diquat-induced apoptosis. Arch Toxicol. 2019;93(5):1239-53.
Xu Q, Liu M, Chao X, Zhang C, Yang H, Chen J, Zhao C, Zhou B. Acidifiers attenuate diquat-induced oxidative stress and inflammatory responses by regulating NF-κB/MAPK/COX-2 pathways in IPEC-J2 cells. Antioxidants (Basel). 2022;11(10):2002.
Xu Q, Liu M, Chao X, Zhang C, Yang H, Chen J, Zhou B. Stevioside improves antioxidant capacity and intestinal barrier function while attenuating inflammation and apoptosis by regulating the NF-κB/MAPK pathways in diquat-induced oxidative stress of IPEC-J2 cells. Antioxidants (Basel). 2023;12(5):1070.
Yang F, Pei R, Zhang Z, Liao J, Yu W, Qiao N, Han Q, Li Y, Hu L, Guo J, Pan J, Tang Z. Copper induces oxidative stress and apoptosis through mitochondria-mediated pathway in chicken hepatocytes. Toxicol In Vitro. 2019;54:310-6.
Li P, Li K, Zou C, Tong C, Sun L, Cao Z, Yang S, Lyu Q. Selenium yeast alleviates ochratoxin A-induced hepatotoxicity via modulation of the PI3K/AKT and Nrf2/Keap1 signaling pathways in chickens. Toxins (Basel). 2020;12(3):143.
Xie X, Deng T, Duan J, Xie J, Yuan J, Chen M. Exposure to polystyrene microplastics causes reproductive toxicity through oxidative stress and activation of the p38 MAPK signaling pathway. Ecotoxicol Environ Saf. 2020;190:110133.
Wei Z, Wang Y, Wang S, Xie J, Han Q, Chen M. Comparing the effects of polystyrene microplastics exposure on reproduction and fertility in male and female mice. Toxicology. 2022;465:153059.
Yang L, Cheng J, Xu D, Zhang Z, Hua R, Chen H, Duan J, Li X, Li Q. Melatonin ameliorates diquat-induced testicular toxicity via reducing oxidative stress, inhibiting apoptosis, and maintaining the integrity of blood-testis barrier in mice. Toxics. 2023;11(2):160.
Zachara BA. Mammalian selenoproteins. J Trace Elem Electrolytes Health Dis. 1992;6(3):137-51.
Cao C, Zhang H, Wang K, Li X. Selenium-rich yeast mitigates aluminum-mediated testicular toxicity by blocking oxidative stress, inhibiting NO production, and disturbing ionic homeostasis. Biol Trace Elem Res. 2020;195(1):170-7.
Lv L, Zhang H, Liu Z, Lei L, Feng Z, Zhang D, Ren Y, Zhao S. Comparative study of yeast selenium vs. sodium selenite on growth performance, nutrient digestibility, anti-inflammatory and anti-oxidative activity in weaned piglets challenged by Salmonella typhimurium. Innate Immun. 2020;26(4):248-58.
Li K, Cao Z, Guo Y, Tong C, Yang S, Long M, Li P, He J. Selenium yeast alleviates ochratoxin A-induced apoptosis and oxidative stress via modulation of the PI3K/AKT and Nrf2/Keap1 signaling pathways in the kidneys of chickens. Oxid Med Cell Longev. 2020;2020:4048706.
Choi SE, Park YS, Koh HC. NF-κB/p53-activated inflammatory response involves in diquat-induced mitochondrial dysfunction and apoptosis. Environ Toxicol. 2018;33(10):1005-18.
McBride JA, Coward RM. Recovery of spermatogenesis following testosterone replacement therapy or anabolic-androgenic steroid use. Asian J Androl. 2016;18(3):373-80.
Wang YX, Dai W, Li YZ, Wu ZY, Kan YQ, Zeng HC, He QZ. Bisphenol S induces oxidative stress-mediated impairment of testosterone synthesis by inhibiting the Nrf2/HO-1 signaling pathway. J Biochem Mol Toxicol. 2023;37(3):e23273.
Shi L, Song R, Yao X, Duan Y, Ren Y, Zhang C, Yue W, Lei F. Effects of maternal dietary selenium (Se-enriched yeast) on testis development, testosterone level and testicular steroidogenesis-related gene expression of their male kids in Taihang Black Goats. Theriogenology. 2018;114:95-102.
Ge J, Guo K, Huang Y, Morse PD, Zhang C, Lv MW, Li JL. Comparison of antagonistic effects of nanoparticle-selenium, selenium-enriched yeast and sodium selenite against cadmium-induced cardiotoxicity via AHR/CAR/PXR/Nrf2 pathways activation. J Nutr Biochem. 2022;105:108992.
Li LX, Chu JH, Chen XW, Gao PC, Wang ZY, Liu C, Fan RF. Selenium ameliorates mercuric chloride-induced brain damage through activating BDNF/TrKB/PI3K/AKT and inhibiting NF-κB signaling pathways. J Inorg Biochem. 2022;229:111716.
Hu W, Liang YX, Luo JM, Gu XW, Chen ZC, Fu T, Zhu YY, Lin S, Diao HL, Jia B, Yang ZM. Nucleolar stress regulation of endometrial receptivity in mouse models and human cell lines. Cell Death Dis. 2019;10(11):831.
Hu W, Ye T, Yang Y, Liu B, Zheng W. Effects of transport stress on pathological injury and expression of main heat shock proteins in the caprine stomach. BMC Vet Res. 2020;16(1):347.
Li Y, Xu P, Shan J, Sun W, Ji X, Chi T, Liu P, Zou L. Interaction between hyperphosphorylated tau and pyroptosis in forskolin and streptozotocin induced AD models. Biomed Pharmacother. 2020;121:109618.

Table 1 The primer sequence of the target gene.

Target Genes ^a	Primer sequence (5'-3')	Accession No. ^b	Product Length, bp
Nrf2	Forward (F): GATGTCACCCTGCCCTTAGA Reverse (R): TCGTTCCATTTGTTCCTTCTG	NM_205117.1	108
HO-1	F: TCATTGGCAAGAAGCATCCAGAGC R: GAACTTGGTGGCGTTGGAGACTC	HM237181.1	176
Gpx1	F: ACGGCGCATCTTCCAAAG R: TGTTCCCCCAACCATTTCTC	NM_001277853.2	73
Bax	F: GTGATGGCATGGGACATAGCTC R: TGGCGTAGACCTTGCGGATAA	XM_015290060.3	90
Bcl-2	F: AGTAGAGTCACCCAGTTTATCG R: CTTTAGCCAGGAAGTTGTTT	NM_205339.2	113
Caspase3	F: AAGGCTCCTGGTTTATTC R: CTGCCACTCTGCGATTTA	NM_204725.1	102
NF-κB	F: TCAACGCAGGACCTAAAGACAT R: GCAGATAGCCAAGTTCAGGATG	NM_205134.1	162
StAR	F: TCAGCCGGCGGATTTAAGG R: TGGTGGCTGCTACAAACACT	NM_204686.2	64
P450scc	F: TTTGCCTTGGAGTCTGTG R: GCCATGTCTTGGTGTTGA	NM_001001756.1	178
3β-HSD	F: AAGGCAGATGGCCAGATGT R: TGATGCGTCTGGCTTTCTGT	FJ_607242.1	250
β-Actin	F: CAGCCATCTTTCTTGGGTAT R: CTGTGATCTCCTTCTGCATCC	NM_205518.1	169

^aNrf2 = nuclear factor erythroid 2-related factor 2, HO-1 = heme oxygenase-1, Gpx1 = glutathione peroxidase 1, Bax = Bcl-2-associated X protein, Bcl-2 = B-cell lymphoma-2, Caspase3 = cysteinyl aspartate specific proteinases 3, NF-κB = nuclear factor kappa B, StAR = steroidogenic acute regulatory protein, P450scc = cholesterol side-chain cleavage enzyme, 3β-HSD = 3β-hydroxysteroid dehydrogenase; ^bthe reference sequence number is listed for primers whose source is the National Center for Biotechnology Information (NCBI) GenBank database (http://www.ncbi.nlm.nih.gov/genbank/)

No competing interests reported.

Supplementarymaterial.docx

Download PDF

Version 1

posted

You are reading this latest preprint version

Selenium Yeast Mitigates Diquat-Induced Oxidative Stress in Rooster Testicles and Preserves Reproductive Performance

Status:

Version 1

Abstract

Figures

Background

Results

Discussion

Conclusion

Methods

Abbreviations

Declarations

References

Table

Additional Declarations

Supplementary Files

Status:

Version 1