The intervention of OPG/RANKL/RANK signaling pathway by QGYKL mediated complement C3 and succinylation process on osteoporosis

doi:10.21203/rs.3.rs-3467063/v1

Download PDF

Research Article

The intervention of OPG/RANKL/RANK signaling pathway by QGYKL mediated complement C3 and succinylation process on osteoporosis

https://doi.org/10.21203/rs.3.rs-3467063/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Introduction:

Qiangguyin Keli(QGYKL)is a traditional Chinese medicine formula used in the clinical treatment of osteoporosis for over 20 years. The specific protective mechanism of QGYKL against osteoporosis is still unclear. Previous studies have found that silencing complement C3 can improve osteoporosis.

Objective

This study aims to investigate the effect of QGYKL on complement C3-related osteoporosis and explore its potential mechanisms.

Results

Researchers performed bilateral oophorectomy or sham surgery on female mice as a control, and then orally administered QGYKL (20 ml/kg/day) for 8 consecutive weeks, And found that oral administration of QGYKL can reduce complement C3, affect the succinylation key protein SIRT5, and improve osteoporosis; In cell experiments, researchers found that C3 levels increase when osteoclasts or osteoblasts differentiate. Among them, the C3 content changes more significantly during the differentiation process of osteoclasts. Inhibiting the expression of the C3 gene can upregulate the expression of OPG in BM-MSC cells, promote the expression of succinylation key protein SIRT5, and reduce the expression of RANKL.

Conclusion

These results indicate that QGYKL may improve osteoporosis by affecting the content of complement C3 and the succinylation process of complement C3, and subsequently intervening in the expression of OPG and RANKL.

Qiangguyin Keli

osteoporosis

complement C3

SIRT5

OPG

RANKL

Osteoporosis (OP) is a systemic metabolic bone disease that typically affects elderly people, especially postmenopausal women. More than 200 million people worldwide have been diagnosed with OP [1]. Due to the destruction of bone microstructure and increased bone fragility, OP patients are particularly prone to fractures [2, 3]. OP patients typically experience low back pain, spinal deformities, and limited mobility. OP seriously affects the overall health and quality of life of patients. QGY is a traditional Chinese herbal formula that has been used in the clinical treatment of osteoporosis for over 20 years [4–6]. Multicenter clinical trials have shown that 12 months of QGY treatment can safely and effectively improve bone density [5]. In preliminary experiments, researchers identified C3 as an important differential protein in QGY treatment of postmenopausal osteoporosis (PMOP) through proteomics and bioinformatics screening. Silencing the C3 gene will have a positive impact on bone formation [7, 8]. In the preliminary experiment, protein quantitative testing was conducted on the serum of patients with osteoporosis and the normal population. There were 35 quantitative proteins and 113 loci containing quantitative information; Compared with patients taking QGYKL, 53 downregulated proteins were detected in the serum of patients with osteoporosis, and it was found that complement C3 is one of the downregulated proteins[9]. QGYKL is an industrial purified concentrated formulation of QGY, which is easy to carry and take. Can QGYKL affect osteoporosis by affecting complement C3 and succinylation processes in this study?

2.1 Experimental animal

The experimental mice were all adult female Sprague Dawley (SD) mice raised without specific pathogens (temperature 23℃, dark circulation for 12 hours, humidity 50%, rats can freely drink and eat). This experiment was approved by the Animal Ethical and Welfare Committee of ZCMU(Approval No. 20220613-01).

2.2 Preparation of QGYKL medicines and pharmacy-containing serums

QGYKL is produced by the Drug Preparation Center of the Second Affiliated Hospital of Zhejiang Chinese Medicine University. It mainly includes Astragalus membranaceus, deer horn cream, rhizoma dynamite, eucommia ulmoides, teasel root, nidus vespae, cinnamon, ligusticum wallichii, Caulis pathology, Gentiana macrophylla, Saposhnikovia divaricata, caulis lonicerae.

The preparation method of drug-containing serum is as follows: 20 male SD rats weighing 280-300g were randomly divided into a drug group and a control group, with a gastric dose of 20mL/kg/d for the drug group rats. Rats were gavaged twice a day (with a dose of 10 milliliters per kilogram) and euthanized three days later. 1–2 hours after the last administration, blood was collected using the eyeball extraction method (sterile operation). Separate serum and use it for in vitro experiments.

2.3 Animal osteoporosis model

After 12 weeks of adaptive feeding of C57BL/6J mice, 5 mice underwent bilateral abdominal incisions (Sham), and 10 mice underwent bilateral salpingectomy (OVX) according to the previous experimental method. After 6 weeks of model establishment, OVX mice were randomly divided into two groups (n = 5): OP group (OVX) and QGY group (OVX + QGY, 20ml/kg/d). Both the OP group and the sham group received the same dose of physiological saline, and all groups received 6 weeks of treatment. After the experiment, a sample of the right femur of the mouse was collected for microscopic CT scanning and histological staining detection.

2.4 Histomorphometric analysis

Scanning femoral samples using micro CT (SCANCO Medical AG, Switzerland) for trabecular morphology analysis. CT resolution set to 10 µ m. The exposure time is set to 300ms. This study measured bone trabecular volume fraction (BV/TV,%), bone trabecular spacing (Tb. Sp, mm), bone trabecular number (Tb. N), and other related parameters to better understand the internal microstructure of the femur.

The femur sample was fixed in a 4% paraformaldehyde dehyde solution for 24 hours and then decalcified with 10% ethylenediaminetetraacetic acid. After dehydration with graded concentrations of ethanol, the tissue was washed with xylene embedded in paraffin and cut into 4 µ m sections. Follow the manufacturer's instructions for TRAP staining, followed by microscopic examination to confirm bone cell differentiation.

2.5 Bone cell culture and differentiation

Collect the femur and tibia of mice and rinse the bone marrow with L-DMEM. Collect bone marrow and centrifuge. Remove the supernatant. Resuspension bone marrow cells, use Percoll cell separation buffer to isolate monocytes, store them in L-DMEM, and then collect BMSCs. BMSCs were stored in DMEM-F12 (Gibco, USA) containing 10% fetal bovine serum (FBS, TaKaRa, China), 2 mL glutamine, and 1% penicillin streptomycin mixture, in an incubator containing 5% CO2 at a temperature set at 37 ° C.

RAW 264.7 cells were cultured using DMEM (containing 10% FES) and in an environment containing 5% CO2 at a temperature set at 37 ℃. RANKL (100ng/ml), M-CSF (100ng/ml), and TFLLR-NH2 (30µm) Stimulate to induce osteoclast formation.

2.6 CCK-8 detection

Cell viability was detected using Cell Count Kit 8 (CCK-8, Jiangsu, China), and each group of cells was inoculated into a 96-well plate (100 cells per well) µ Continue to culture the cell suspension, with the incubator containing 5% CO2 and the temperature set at 37 ℃. After 72 hours of cultivation in the incubator, add CCK-8 solution (20 µ L) to the well and incubate for 2 hours. Finally, use a microplate reader to measure absorbance at a wavelength of 450 nanometers.

2.7 Western Blot

This study used a protein extraction kit (C0062225-0050) to extract total proteins from cells. Simultaneously use the BCA protein quantification kit (C503021-0500) to determine protein content. After adding the first antibody C3 (1:1000, Abcam, ab97462), AHSG (1:2000, Abcam, ab187051), or GADPH (1:1000, Abcam, ab8245), the temperature during the cell culture process was set to 4 ° C. Then rinse the membrane three times and add biotin linked secondary antibody. After incubation for 1 hour, adjust the temperature to room temperature, observe the membrane using Image J software (Bethesda, USA), and detect the density of protein bands.

2.8 RT-qPCR

According to the manufacturer's instructions, use the Trizol reagent (Aidlab (Lot: 252250AX)) to remove total RNA from cells. CDNA is synthesized with HiScript Reverse Transcriptase (RNase H) (VAZYME (R101-01/02)). Perform real-time PCR using SYBR Green Master Mix (VAZYME (Q111-02)) on the ABI (QuantStudio 6) rapid real-time PCR system. The conditions for thermal cycling are as follows: insulation at 50℃ for 2 minutes, initial denaturation at 95℃ for 10 minutes, followed by denaturation at 95℃ for 30 seconds, extension at 60℃ for 30 seconds, and 40 cycles. The primers used for real-time PCR are as follows:(See Table 1.)

Table 1

Selection of primers for PCR experiment
Gene name	Gene sequence
C3	forward: 5’-GGGAGAAGTTCGGCATAGAG-3’
C3	reverse: 5’-GGTTGTTGAAGGCAGCATAG-3’
SIRT5	forward:5’-CATCACCCAGAACATTGACG-3’
SIRT5	reverse:5’-GGATTCTGGCGTCTTGAGTC-3’
OPG	forward: 5’-CCTGCCTGGGAAGAAGATCA-3’
OPG	reverse: 5’-TTGTGAAGCTGTGCAGGAAC-3’
RANKL	forward:5’ - GAAACATCGGGAAGCGTACC-3’
RANKL	reverse:5’- GTACGTCGCATCTTGATCCG9-3’
GAPDH	forward: 5‘- ATGGGTGTGAACCACGAG A-3’
GAPDH	reverse: 5’-CAGGGATGATGTTCTGGGCA − 3’

2.9 Statistical analysis

Statistical analysis was conducted using SPSS version 24.0 and GraphPad Prism 8.0.1. All data were presented as mean ± standard deviation (mean ± SD), using an independent sample T-test for comparison between the two groups. Intergroup comparisons were conducted using analysis of variance, followed by post hoc Tukey's test.

3.1 QGYKL improves bone condition in osteoporosis mice

To elucidate the role of QGYKL in reducing bone mass caused by estrogen deficiency, OVX mice were treated with QGYKL for 6 weeks. The micro CT results showed that compared with the Sham group, the number of bone trabeculae in the OVX group was significantly reduced, and the number of bone trabeculae increased after QGYKL administration (Fig. 1).

The analysis of image parameters in this study showed that compared to the Sham group, the OVX group had BV/TV and Tb The N index decreased, while TB The SP index has risen. After QGYKL treatment, BV/TV and Tb The N index rises, while the TB index rises. The SP index decreased (Fig. 2).

After TRAP staining, osteoclasts are wine red, so this method can identify differentiated osteoclasts and evaluate the effect of QGYKL on osteoclasts. The TRAP results showed a significant increase in the number of osteoclasts in the OVX group compared to the Sham group, while QGYKL treatment significantly reduced the number of osteoclasts (Fig. 3). These results indicate that QGYKL can improve the bone condition of osteoporosis rats, and this process may be closely related to osteoclasts.

3.2 QGYKL affects the expression of C3, OPG, and RANKL in the femoral tissue of osteoporotic mice

To investigate the mechanism of QGYKL improving osteoporosis in mice, the expression of C3, OPG, and RANKL-related mRNA in femoral tissue was evaluated. The RT-qPCR results showed that compared with the Sham group, the expression levels of C3 and RANKL genes in the femoral tissue of OVX group mice increased, while the expression levels of OPG and AHSG genes decreased. Meanwhile, after QGYKL treatment, the expression levels of C3 and RANKL genes decreased, while the expression levels of OPG genes increased (Fig.4). The above results indicate that in addition to RANKL and OPG, there may also be a certain correlation between C3 gene expression and osteoporosis.

3.3 QGYKL intervenes in the expression of OPG and RANKL in osteoblasts by inhibiting the expression of C3 in osteoclasts

To investigate the correlation between osteoblast and osteoclast differentiation and C3, qRT-PCR and Western Blot detection methods were used to determine the changes in C3 content in osteoblast and osteoclast differentiation. The qRT PCR and Western Blot detection results showed that the C3 content in the supernatant of BM-MSC cells decreased after Osteogenesis treatment; After Osteoclast induction treatment, the C3 content in the supernatant of RAW264.7 was significantly upregulated (Fig. 5). The above results suggest that the C3 content changes more significantly during osteoclast differentiation, so we chose osteoclasts as C3 transfected cells for subsequent experiments.

To investigate the effect of C3 on the expression of OPG and RANKL, an adenovirus expression vector was constructed to silence target genes, and qRT-PCR technology was used to detect the expression of OPG and RANKL proteins. Silencing the C3 gene through adenovirus and transfecting RAW264.7 cells. RAW264.7 cells were treated with control medium/NC shRNA/C3 shRNA + osteoclast inducer, and the supernatant was collected to treat BM-MSC cells. qRT-PCR results showed that compared with the control group, the NC shRNA group showed a decrease in OPG expression and an increase in RNAKL expression, while the C3 shRNA group showed an increase in OPG expression and a decrease in RNAKL expression (Fig. 6). The above results indicate that silencing the C3 gene can promote OPG expression and inhibit RANKL expression.

To further investigate the effect of QGYKL inhibiting C3 on the expression of OPG and RANKL, RAW264.7 cells were treated with NC shRNA/C3 shRNA + osteoclast inducer, followed by drug-containing serum and supernatant collection to treat BM-MSC cells. qRT-PCR results showed that OPG expression further increased and RNAKL expression further decreased in cells (Fig. 6). The above results suggest that QGYKL may intervene in the expression of OPG and RANKL by inhibiting C3 expression.

3.7 Osteoclast differentiation is associated with the succinylation process of complement C3

To investigate whether osteoclasts are related to the succinylation process, RAW264.7 cells were treated with a control medium/osteoclast induction medium. Western blot results showed that the expression level of SIRT5 mRNA in the osteoclast induction group decreased compared to the control medium. The results indicate that osteoclast differentiation is related to the succinylation process(Fig. 7).

To verify whether C3 undergoes succinylation during osteoclast differentiation, RAW264.7 cells were treated with control serum + NC shRNA/C3 shRNA + osteoclast inducer. qRT-PCR detection results showed that compared with the NC shRNA group, the mRNA expression level of SIRT5 in the C3 shRNA group increased, indicating a negative correlation between C3 expression and de-succinylation modification. To verify the association between QGYKL and the succinylation process, RAW264.7 cells were treated with control serum/drug containing serum + NC shRNA/C3 shRNA + osteoclast inducer. The qRT-PCR detection results showed that the mRNA expression level of SIRT5 in the drug-containing serum + NC shRNA group increased compared to the control serum + NC shRNA group; Compared with the control serum + C3 shRNA group, the mRNA expression level of SIRT5 in the drug-containing serum + C3 shRNA group increased(Fig. 8). This indicates that QGYKL may achieve the treatment of osteoporosis by promoting the process of C3 desuccinylation.

This study indicates that Qiangguyin Keli granules interfere with the OPG/RANKL/RANK signaling pathway and affect osteoporosis by inhibiting complement C3 and promoting the de-succinylation process (Fig. 9). Complement C3 can inhibit the expression of SIRT5, a key protein in the de-succinylation process, promote the expression of RANKL in osteoblasts, and inhibit the expression of OPG in osteoblasts, leading to the occurrence of osteoporosis. QGYKL can affect osteoporosis by inhibiting the secretion of complement C3 and succinylation by osteoclast precursor cells.

Complement C3 is a core protein in the complement activation pathway. Under high bone turnover conditions during mouse oophorectomy, C3 gene silenced mice experience reduced bone loss in multiple locations, increased femoral neck stiffness, and increased lumbar spine bone content and mineral deposition rate. It has been confirmed that the lack of C3 can reduce bone loss during oophorectomy and may improve mechanical performance [10]. Under the high bone turnover state of ovariectomy or RANKL injection in mice, the expression of the C3 gene in bone increased. Cell experiments have also confirmed that during the differentiation process of osteoclasts, the content of C3 increases, and the bioactive fragment C3a of C3 can promote osteoblast differentiation [11]. At the same time, there is also a connection between C3 and osteoclasts, and C3a has both direct and indirect regulatory effects on osteoclast formation. Even without RANKL and M-CSF, C3a can significantly induce osteoclast formation [12]. Adding anti-C3 antibodies to bone marrow culture can inhibit the appearance of osteoclasts and the growth of bone marrow stromal cells. Adding antibodies in the early stages of culture has the strongest inhibitory effect [13]. Our study found that the expression of complement C3 increases during RANKL and M-CSF-induced osteoclast differentiation. At the same time, adding an osteoclast culture medium that silences the C3 gene to the BM-MSC medium can promote the expression of OPG in osteoblasts and inhibit the expression of RANKL.

The study has shown that succinylation can induce more changes in protein structure and function compared to methylation and acetylation[14], Meanwhile, SIRT5 is the preferred target for succinylation [15]. In the preliminary research, By using non-standard quantification and succinylation enrichment techniques, as well as high-resolution liquid chromatography-mass spectrometry quantitative proteomics research strategies, protein quantitative detection was performed on serum samples from patients with osteoporosis and control groups. A total of 123 succinylation sites were identified on 41 proteins, and succinylation proteomics quantitative research was conducted on patients with osteoporosis and intervention groups, Among them, 113 succinylation sites of 35 proteins contain quantitative information, and 53 downregulated proteins were detected, including complement C3. This experiment validated the hypothesis that the de-succinylation target protein SIRT5 is indeed closely related to C3 based on bioinformatics analysis at the cellular level. Meanwhile, QGYKL can promote the expression of desuccinylation target proteins. This indicates that QGYKL may affect osteoporosis by inhibiting C3 expression and the succinylation process.

OPG/RANKL/RANK is a classic pathway in bone metabolism, and abnormal regulation of the OPG/RANKL/RANK pathway can lead to abnormal bone metabolism. Among them, OPG and RANKL are both produced by osteoblasts, and RANKL combines with RANK to differentiate osteoclast precursor cells into osteoclasts. OPG can competitively inhibit the binding of RANKL to RANK on osteoclast precursor cells, delay the activation of osteoclast precursor cells, inhibit bone resorption, and achieve the goal of maintaining bone metabolism balance. This study found that inhibiting C3 can promote OPG expression and RANKL expression. At the same time, an important target of QGYKL treatment for osteoporosis is that QGYKL can inhibit C3 expression and affect bone metabolism. In summary, this study provides new evidence that QGYKL can inhibit C3, and mediate the OPG/RANKL/RANK pathway to inhibit bone destruction ability, thereby playing a role in improving osteoporosis. The in vivo anti-osteoporosis effect of QGYKL further confirms the results we found in cell research. To our knowledge, current research has revealed the regulatory mechanism of C3 in the treatment of osteoporosis with this herbal formula for the first time.

Additional file 1: Figures included in this article (Fig.1 - Fig.9)

Ethics approval and consent to participate: This experiment was approved by the Animal Ethical and Welfare Committee of ZCMU(Approval No.: 20220613-01).

Consent for publication: Not applicable.

Funding: The study was funded by the National Natural Science Foundation of China (82274272); National Natural Science Foundation of China (81973884); Natural Science Foundation of Zhejiang Province (LY19H290004); Zhejiang Traditional Chinese Medicine Administration (2022ZZ020); Department of Education of Zhejiang Province, (Y202248737)

These funders had no role in the study design, data collection, and analysis, interpretation of data, and writing the manuscript.

Acknowledgments: We thank all colleagues working in the Second Affiliated Hospital of Zhejiang Chinese Medical University.

Authors’ contributions： Kang Liu and Xiaolin Shi designed the study. Minghao Tong, Shilong Meng, and Yang Yu performed the experiments. Zhang Yinkai analyzed the data. Minghao Tong and Shilong Meng wrote the manuscript. All authors read and approved the final manuscript. Minghao Tong and Shilong Meng have the same contribution to this work and they are both the first author.

Qian D, Zhou H, Fan P, et al. A Traditional Chinese Medicine Plant Extract Prevents Alcohol-Induced Osteopenia. Front Pharmacol. 2021;12:754088. Published 2021 Dec 15. doi:10.3389/fphar.2021.754088
Armas LA, Recker RR. Pathophysiology of osteoporosis: new mechanistic insights. Endocrinol Metab Clin North Am. 2012;41(3):475-486. doi:10.1016/j.ecl.2012.04.006
Qin XY, Niu ZC, Han XL, et al. Anti-perimenopausal osteoporosis effects of Erzhi formula via regulation of bone resorption through osteoclast differentiation: A network pharmacology-integrated experimental study. J Ethnopharmacol. 2021;270:113815. doi:10.1016/j.jep.2021.113815
Shi XL, Wu LG, Xu JC. Effect of qianggu drink on bone histomorphometry of lumbar vertebrae in ovariectomized rats. Zhongguo Gu Shang. 2008;21(4):287-288.
Shi ZY, Zhang XG, Li CW, Liu K, Liang BC, Shi XL. Effect of Traditional Chinese Medicine Product, Qiangguyin Keli, on Bone Mineral Density and Bone Turnover in Chinese Postmenopausal Osteoporosis. Evid Based Complement Alternat Med. 2017;2017:6062707. doi:10.1155/2017/6062707
Yuan Y, Sun J, Zhou H, et al. The effect of Qiangguyin Keli on osteoporosis through the AKT/mTOR/autophagy signaling pathway mediated by CKIP-1. Aging (Albany NY). 2022;14(2):892-906. doi:10.18632/aging.203848
Liang BC, Shi XL, Li CW, et al. Identification of human serum protein targets of Qianggu Decoction () in primary type I osteoporosis based on tandem mass tag labeling and liquid chromatography-tandem mass spectrometry technology. Chin J Integr Med. 2017;23(10):747-754. doi:10.1007/s11655-016-2600-4
Liu Kang, Tong Minghao, Tang Binbin, et al. Experimental study on the effect of complement C3 on bone formation by in vitro cell culture[J]. China Orthopedic Injury,2022,35(06):548-554.doi:10.12200/j.issn.1003-0034.2022.06.009
Zhang LL, Li CW, Liu K, et al. Discovery and Identification of Serum Succinyl-Proteome for Postmenopausal Women with Osteoporosis and Osteopenia. Orthop Surg. 2019;11(5):784-793. doi:10.1111/os.12519
MacKay DL, Kean TJ, Bernardi KG, et al. Reduced bone loss in a murine model of postmenopausal osteoporosis lacking complement component 3. J Orthop Res. 2018;36(1):118-128. doi:10.1002/jor.23643
Matsuoka K, Park KA, Ito M, et al. Osteoclast-derived complement component 3a stimulates osteoblast differentiation. J Bone Miner Res. 2014;29(7):1522-1530. doi:10.1002/jbmr.2187
Ignatius A, Ehrnthaller C, Brenner RE, et al. The anaphylatoxin receptor C5aR is present during fracture healing in rats and mediates osteoblast migration in vitro. J Trauma. 2011;71(4):952-960. doi:10.1097/TA.0b013e3181f8aa2d
Tu Z, Bu H, Dennis JE, et al. Efficient osteoclast differentiation requires local complement activation. Blood. 2010;116(22):4456-4463. doi:10.1182/blood-2010-01-263590
Xu X, Liu T, Yang J, et al. The first succinylome profile of Trichophyton rubrum reveals lysine succinylation on proteins involved in various key cellular processes. BMC Genomics. 2017;18(1):577. doi:10.1186/s12864-017-3977-y
Du Y, Hu H, Qu S, et al. SIRT5 deacylates metabolism-related proteins and attenuates hepatic steatosis in ob/ob mice. EBioMedicine. 2018;36:347-357. doi:10.1016/j.ebiom.2018.09.037

No competing interests reported.

SupplementaryFile1.rar

Download PDF

Version 1

posted

You are reading this latest preprint version

The intervention of OPG/RANKL/RANK signaling pathway by QGYKL mediated complement C3 and succinylation process on osteoporosis

Status:

Version 1

Abstract

Introduction:

Objective

Results

Conclusion

Figures

1. Introduction

2. Materials and methods

2.1 Experimental animal

2.2 Preparation of QGYKL medicines and pharmacy-containing serums

2.3 Animal osteoporosis model

2.4 Histomorphometric analysis

2.5 Bone cell culture and differentiation

2.6 CCK-8 detection

2.7 Western Blot

2.8 RT-qPCR

2.9 Statistical analysis

3. Result

3.1 QGYKL improves bone condition in osteoporosis mice

3.7 Osteoclast differentiation is associated with the succinylation process of complement C3

4. Discussion

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1