Patient samples and Cell lines
This study was approved by the Ethics Committee of BenQ Medical Center, the Affiliated BenQ Hospital of Nanjing Medical University (Nanjing, China), and patients consented to the use of the tissue specimens for research purposes. HNSCC tissues that were surgically resected were obtained from the department of pathology, BenQ Medical Center. The specimens were classified according to the 2018 NCCN criteria and TMN staging system. Histologic classification and tumor stage were reviewed by two pathologists. The HNSCC cell lines FaDu and SCC-9 were purchased from Guangzhou Cellcook Biotech Co., Ltd (Guangzhou, China). The cells were authenticated by STR profiling. FaDu cells were maintained in RPMI-1640 (Gibco, USA) medium with 10% fetal bovine serum (FBS, Gibco, USA) and 1% Penicillin/Streptomycin (Gibco, USA), SCC-9 cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM/F12, Gibco, USA) with 10% FBS and 1% Penicillin/Streptomycin, supplemented with sodium pyruvate (CellCook, China) and hydrocortisone (CellCook, China). 293T cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM/F12, Gibco, USA) with 10% FBS and 1% Penicillin/Streptomycin, All cells were cultured at 37 °C in a humidified 5% CO2 atmosphere.
Lentiviral Transduction
The overexpression and knockdown of RUNX1 and OPN were performed using a lentiviral packaging system. Cells were grown to 60% confluency and infected with lentiviral vectors targeting RUNX1 and OPN (Shanghai Genechem Co., Ltd. Shanghai, China), or with negative control vectors in the presence of 10 mg/mL Polybrene (hexadimethrine bromide). The supernatant was removed after 12 hours and was replaced with complete culture medium. After 72 hours of transduction, the cells were collected for further experiments.
Cell Proliferation Assay
A Cell Counting Kit-8 (CCK-8) (Dojindo, Japan) was used to determine cell viability. 1 × 103 cells were plated in 96-well plates and incubated for 12 hours. Then medium containing CCK-8 solution (10 mL CCK-8 in 100 mL medium) was added to each well at the same time every day for 3 days. The OD values were detected at absorbances of 450 nm and 630 nm. All experiments were performed in triplicate.
Colony Formation Assay
For clonogenicity analysis, 500 viable cells were seeded in 6-well plates. Culture medium was changed every two days. After 10 days of incubation, colonies were fixed with 4% paraformaldehyde and stained with giemsa (Solarbio, China). The cells were photographed and the numbers of colonies were scored.
Migration Assay
For the scratch assays, 4 × 105 cells were seeded in 6-well plates and allowed to adhere overnight until they reached 95% ~ 100% confluency. Cells were serum-starved for 8 hours prior to beginning the assay. Subsequently, a scratch was made across the cell layer using a 100 µl pipette tip, and cell migration was monitored by recording images after 24 hours. The area of the scratch was quantified using the MiToBo plug-in for ImageJ software and plotted as a percentage of total area. For the transwell migration assay, 5 × 104 cells were seeded in triplicate in migration chambers (BD Biosciences, Bedford, MA, USA) in serum-free medium. Cells were allowed to migrate through 8 µm pores toward medium containing 10% FBS for 48 hours. Non-migrating cells were removed and cells that migrated through the membrane were fixed with 4% paraformaldehyde. Fixed cells were stained with giemsa (Solarbio, China) solution and photographed. The number of cells on the membrane was determined by counting under a microscope.
Invasion Assay
For the invasion assay, 5 × 104 cells were seeded in triplicate in Matrigel invasion chambers (BD Biosciences, San Jose, CA, USA) in serum-free medium. Cells were allowed to invade through the Matrigel and 8 µm pores toward medium containing 10% FBS for 48 hours. Non-invading cells were removed using a cotton swab and cells that invaded through the membrane were fixed with 4% paraformaldehyde. The procedure for transwell migration described above was then followed to complete the experiments.
Immunohistochemistry
Both the human tissue and mouse tissue are the same immunohistochemical procedure. Following deparaffinization and rehydration, antigen retrieval was performed using DAKO Target Retrieval Solution (DAKO, Carpinteria, CA, USA), pH6.0 in 50% glycerol at 95 °C for 20 minutes. Sections were blocked for endogenous peroxidase using hydrogen peroxide in methanol followed by treatment with 1% bovine serum albumin, 10% normal goat serum and 0.1% Triton X-100. The tissue was incubated overnight at room temperature with anti-RUNX1 antibody (1:500, Abcam, USA) and anti-OPN antibody (1:1000, Abcam, USA). The sections were incubated with anti-rabbit IgG biotinylated secondary antibodies. After incubation with streptavidin-HRP for 30 min at room temperature, sections were analyzed using a Zeiss AxioPlan microscope.
Quantitative Pcr
Total RNA was extracted using TRIzol reagent (Thermo Fisher Scientific, USA) and cleaned by DNase digestion (Zymo Research, USA). Subcellular fractionation of nuclear and cytoplasmic RNA was isolated separately using the Cytoplasmic & Nuclear RNA purification kit (Norgen BioTek, Canada). RNA was reverse transcribed into cDNA with the Superscript III first-strand synthesis system (Thermo Fisher Scientific, USA). Quantification of gene expression was conducted using Power SYBR green PCR Master Mix and the StepOnePlus Real-Time PCR system (Thermo Fisher Scientific, USA). The expression of each target gene was determined with β-actin as the normalization control. The results were analyzed to obtain the Ct values of the amplified products, and data were analyzed by the 2−ΔΔCt method.
RUNX1 Forward: GTTTGTCGGTCGAAGTGGAAGA,
RUNX1 Reverse: AGGGTTAAAGGCAGTGGAGTGG;
OPN Forward: AGTTTCGCAGACCTGACATCC,
OPN Reverse: TTCCTGACTATCAATCACATCGG;
β-actin Forward: CACCCAGCACAATGAAGATCAAGAT,
β-actin Reverse: CCAGTTTTTAAATCCTGAGTCAAGC.
Western Blotting
Whole cell protein lysates were generated using RIPA buffer; nuclear and cytoplasmic protein lysates were generated using the NE-PER nuclear and cytoplasmic extraction kit (Thermo Scientific, USA). Both protein isolation reagents were supplemented with 25 µM MG132 and complete protease inhibitor cocktail (Roche Diagnostics, USA). Lysates were separated on a 10% acrylamide gel and immobilized on PVDF membranes (Millipore, USA). Blots were blocked using 5% bovine serum albumin (BSA, HyClone, China) before being incubated overnight at 4 °C with the following primary antibodies: anti-RUNX1 ((1:1000, Abcam, USA), anti-OPN (1:1000, Abcam, USA) and anti-GAPDH (1:1000, Proteintech, USA). GAPDH was used as loading controls. Secondary antibodies conjugated to HRP (Proteintech, USA) were used to detect proteins in conjunction with an enhanced chemiluminescent reagent (ECL; Millipore, USA) in a Bio-Rad Image Lab system. The bands were quantified using Imaging J analysis software.
Luciferase Reporter Assay
At 12–24 hours before transfection, 293T cells were plated at 2 × 105 cells per well in a six-well cell culture plate. A 2 µg measure of various DNA constructs and 0.3 µg of Renilla construct (Promega, USA) were mixed with 10 µl of lipo3000 (Qiagen, German). The mixture was incubated at room temperature for 20 minutes. After washing the cells with PBS, the DNA/ lipo3000 mixtures were transferred to the cells and incubated at 37 °C in a CO2 incubator for 6 hours. The supernatant was replaced with complete culture medium. When cotransfection with constructs expressed various transcription factors, appropriate control plasmids pGL3 was also transfected into separate cultured cells as controls, and DNA was maintained in equal amounts. Subsequently, the transfected cells were washed with PBS and cultured for an additional 48 hours. At the end of 48 hours incubation, the transfected cells were lysed with reporter lysis buffer (Promega, USA). The enzymatic activity was measured for firefly and Renilla luciferase using Dual-Luciferase Reporter assay System (Promega, USA) and a luminometer. All luciferase assays were carried out in duplicates or triplicates and experiments were carried out at least twice.
Chromatin Immunoprecipitation Analysis
ChIP assays were performed using a ChIP Kit (Thermo Scientific, USA) according to the manufacturer s instructions. Briefly, 5 × 106 cells were treated with 1% formaldehyde to cross-link chromatin-associated proteins to DNA. The cell lysates were subjected to ultrasound to shear the DNA into fragments. 10% of each sample was used as input reference control. Chromatin protein suspensions were then incubated with 10 µl of anti-RUNX1 antibody (Abcam, USA) or control anti-IgG antibody (CST, USA). All the above chromatin supernatants were incubated with 20 µL magnetic protein A/G beads overnight at 4 °C with rotation. The protein-DNA complexes were reversed and purified for pure DNA, and then were submitted to SYBR green (Applied Biosystems) qPCR analysis with an ABI Prism 7900HT Fast RealTime PCR system. The following primers were used for quantitative ChIP-PCR
RUNX1 Forward: TCCCGCTGGAATTAAGAAAA,
RUNX1 Reverse: CCCACGGGAATGATTCAATA.
In Vivo Xenograft Assay
Six-week-old athymic BALB/c nude female mice were used for in vivo xenograft assay. All animal experiments were performed according to the Southeast University Animal Care Facility and National Institutes of Health guidelines. Approximately 5 × 106 FaDu cells with different treatment conditions were harvested and suspended in 150 ml of PBS and Matrigel (BD Bio-science, USA) (1:1) and injected subcutaneously into the flank of each mouse. Mice were weighed, and the tumor size was measured using bilateral caliper measurements. The size of subcutaneous tumors and weight of the mice were recorded every two days. Tumor volume (V) was calculated according to the formula V = 0.5 × Tumor maximum diameter (L) × the right angle diameter to that axis (W)2. At the end of treatment, mice were sacrificed, and the tumors were removed and used for immunohistochemical staining.
Analysis of RUNX1 expression and patient survival using public data sets
RUNX1 expression and survival in HNSCC patients was analyzed using the Cancer Genome Atlas (TCGA) database (https://www.r-project.org/) and Ginos Head-Neck Statistics based on Oncomine database (http://www.oncomine.com)[18].
Statistical analysis
The SPSS 23.0 (IBM, USA) and GraphPad Prism (version 7.01, USA) statistical analysis software programs were used for statistical analysis of the experimental data. Each experiment was repeated at least three times. The differences in mean values among groups were evaluated and expressed as the mean ± SEM. A P-value less than 0.05 was considered statistically significant (*P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001). Student's t-test was used to analyze the expression of cell protein markers, cell viability, relative mRNA levels, migrated cells and invaded cells.