DOI: https://doi.org/10.21203/rs.2.12742/v1
Indigenous breeds of livestock represent valuable resource to their owners and their countries [1]. However, these breeds are often not fully evaluated and are neglected in terms of genetic improvement. Many indigenous breeds, particularly those adapted to harsh environments of developing countries, have not yet been sufficiently characterized [2]. Moreover, many of these breeds, especially in the Asian countries, have been subjected to crossbreeding with improved breeds in order to improve their productivity [3]. The adoption of controlled crossbreeding strategy does not always produce the expected results [4], because of adaptation problems faced by the crossbred animals. Indiscriminate crossbreeding is the main threat for indigenous breeds especially under smallholder farming conditions [5], and this has led to severe reduction of indigenous breeds in many countries [6]. Industrial livestock farming is also a great threat to indigenous breeds; a few improved commercial breeds have already replaced or are fast replacing the latter. Indigenous breeds may perish before their potentials are fully recognized and exploited [2]. Therefore, there is an urgent need to conserve indigenous breeds [7]. Understanding the origin and subsequent history of indigenous breeds as well as their genetic diversity is essential to design strategies for their sustainable use and conservation [8].
In Malaysia the Kedah Kelantan (KK) is the only indigenous cattle breed and is mainly kept for meat production. It is popular among the small farm owners because of its small compact body size and low maintenance requirement [9]. However, the owners of bigger herds prefer the larger KK crossbreds or the imported exotic breeds. Genetic improvement of the KK has been by controlled crossbreeding strategies adopted by the government of Malaysia [10] through the Department of Veterinary Services Malaysia (DVS) and the Malaysian Agriculture Research and Development Institute (MARDI) to improve its productivity and increase the local beef production. However, uncontrolled crossbreeding of the KK with improved beef breeds has also been popular, especially among farmers and smallholders [11], resulting in non-descript KK crossbred types. As a result of these activities, the population size of the purebred KK population is fast decreasing, and most of the current commercial beef cattle populations are actually crossbreds of KK. The KK breed faces risk of germplasm dilution due extensive crossbreeding and breed replacement practices. There is a lack of information on the genetic characteristics of the KK. The proportions of KK genes in the KK crossbred populations are also unknown. These make it necessary to evaluate the genetic makeup of the KK and KK crossbred breed types and evaluate the genetic variation among these populations. The objective of this study was to evaluate the genetic variability within and among the indigenous KK cattle and its crossbred breed types in Malaysia.
A total of 312 animals were used in this study. These animals could be classified into three groups: indigenous KK, KK crossbreds and exotic breed. The indigenous KK used in this study were from the nucleus herd at the DVS Livestock Centre in Tanah Merah, Kelantan. The crossbreds were of two types: the crossbreds developed through planned crossbreeding programmes, which included the Brakmas and Charoke, and the non-descriptive KK crosses. The Brakmas animals used in the present study were from the nucleus herd maintained at the MARDI Station in Muadzam Shah, Pahang, while the Charoke animals were from the MARDI Station in Kluang, Johor. The two non-descriptive crosses used are referred to as KK cross 1 (KKX1) and KK cross 2 (KKX2). The KKX1 herd initially began as a nucleus herd of pure KK. However, it was not maintained as such and the animals were mixed with other breeds of both Zebu and Taurine types. KKX2 was a herd belonging to a commercial meat production farm in Kluang, Johor (Kulim Livestock Sdn. Bhd.). This herd was the result of crossing KK with the Brahman breed. Since no breeding design was followed and mating was random these animals were considered as a non-descriptive KK cross. These latter two KK crossbred types were included in the present study as they represent many of the cattle herds in the country. The exotic breed used in the study was the Brahman breed. The animals were from the nucleus herd maintained at the DVS Livestock Centre in Kuala Berang, Terengganu. The Brahman has contributed to the beef industry development in Malaysia, and many owners of big farms have Brahman herds and smaller farm owners cross their cattle with the Brahman; therefore, this breed was included as an out-group, a non KK breed type. Figure 1 shows the locations of the sampled populations for each breed.
Samples
Blood samples from 56 random animals from each herd were used, except for the Brahman where samples from only 32 animals were used.
Microsatellite markers
Thirty microsatellite markers were investigated in the present study. These markers were those recommended by FAO/ ISAG advisory group for genetic diversity studies in cattle [12] (Table1).
Table 1. Microsatellite loci investigated with chromosomal location, primer sequences, annealing temperatures and reported allele size ranges
No. |
Marker |
Ch. |
Primer Sequence |
Annealing Temperature (OC) |
Allele Size Range |
1 |
BM1818 |
23 |
F: AGCTGGGAATATAACCAAAGG |
56-60 |
248-278 |
|
|
|
R: AGTGCTTTCAAGGTCCATGC |
|
|
2 |
BM1824 |
1 |
F: GAGCAAGGTGTTTTTCCAATC |
55-60 |
176-197 |
|
|
|
R: CATTCTCCAACTGCTTCCTTG |
|
|
3 |
BM2113 |
2 |
F: GCTGCCTTCTACCAAATACCC |
55-60 |
122-156 |
|
|
|
R: CTTCCTGAGAGAAGCAACACC |
|
|
4 |
CSRM60 |
10 |
F: AAGATGTGATCCAAGAGAGAGGCA |
55-56 |
79-115 |
|
|
|
R: AGGACCAGATCGTGAAAGGCATAG |
|
|
5 |
CSSM66 |
14 |
F: ACACAAATCCTTTCTGCCAGCTGA |
55-65 |
171-209 |
|
|
|
R: AATTTAATGCACTGAGGAGCTTGG |
|
|
6 |
ETH3 |
19 |
F: GAACCTGCCTCTCCTGCATTGG |
55-65 |
103-133 |
|
|
|
R: ACTCTGCCTGTGGCCAAGTAGG |
|
|
7 |
ETH10 |
5 |
F: GTTCAGGACTGGCCCTGCTAACA |
55-65 |
207-231 |
|
|
|
R: CCTCCAGCCCACTTTCTCTTCTC |
|
|
8 |
ETH152 |
5 |
F: TACTCGTAGGGCAGGCTGCCTG |
55-60 |
181-211 |
|
|
|
R: GAGACCTCAGGGTTGGTGATCAG |
|
|
9 |
ETH185 |
17 |
F: TGCATGGACAGAGCAGCCTGGC |
58-67 |
214-246 |
|
|
|
R: GCACCCCAACGAAAGCTCCCAG |
|
|
10 |
ETH225 |
9 |
F: GATCACCTTGCCACTATTTCCT |
55-56 |
131-159 |
|
|
|
R: ACATGACAGCCAGCTGCTACT |
|
|
11 |
HAUT24 |
22 |
F: CTCTCTGCCTTTGTCCCTGT |
52-55 |
104-158 |
|
|
|
R: AATACACTTTAGGAGAAAAATA |
|
|
12 |
HAUT27 |
26 |
F: TTTTATGTTCATTTTTTGACTGG |
57 |
120-158 |
|
|
|
R: AACTGCTGAAATCTCCATCTTA |
|
|
13 |
HEL1 |
15 |
F: CAACAGCTATTTAACAAGGA |
54-57 |
99-119 |
|
|
|
R: AGGCTACAGTCCATGGGATT |
|
|
14 |
HEL5 |
21 |
F: GCAGGATCACTTGTTAGGGA |
52-57 |
145-171 |
|
|
|
R: AGACGTTAGTGTACATTAAC |
|
|
15 |
HEL9 |
8 |
F: CCCATTCAGTCTTCAGAGGT |
52-57 |
141-173 |
|
|
|
R: CACATCCATGTTCTCACCAC |
|
|
No. |
Marker |
Ch. |
Primer Sequence |
Annealing Temperature (OC) |
Allele Size Range |
16 |
HEL13 |
11 |
F: TAAGGACTTGAGATAAGGAG |
52-57 |
178-200 |
|
|
|
R: CCATCTACCTCCATCTTAAC |
|
|
17 |
ILSTS005 |
10 |
F: GGAAGCAATGAAATCTATAGCC |
54-58 |
176-194 |
|
|
|
R: TGTTCTGTGAGTTTGTAAGC |
|
|
18 |
ILSTS006 |
7 |
F:TGTCTGTATTTCTGCTGTGG |
55ºC |
277-309 |
|
|
|
R: ACACGGAAGCGATCTAAACG |
|
|
19 |
INRA005 |
12 |
F: CAATCTGCATGAAGTATAAATAT |
55 |
135-149 |
|
|
|
R: CTTCAGGCATACCCTACACC |
|
|
20 |
INRA023 |
3 |
F: GAGTAGAGCTACAAGATAAACTTC |
55 |
195-225 |
|
|
|
R:TAACTACAGGGTGTTAGATGAACTC |
|
|
21 |
INRA032 |
11 |
F: AAACTGTATTCTCTAATAGCTAC |
55-58 |
160-204 |
|
|
|
R: GCAAGACATATCTCCATTCCTTT |
|
|
22 |
INRA035 |
16 |
F: ATCCTTTGCAGCCTCCACATTG |
55-60 |
100-124 |
|
|
|
R: TTGTGCTTTATGACACTATCCG |
|
|
23 |
INRA037 |
11 |
F: GATCCTGCTTATATTTAACCAC |
57-58 |
112-148 |
|
|
|
R: AAAATTCCATGGAGAGAGAAAC |
|
|
24 |
INRA063 |
18 |
F: ATTTGCACAAGCTAAATCTAACC |
55-5 |
167-189 |
|
|
|
R: : AAACCACAGAAATGCTTGGAAG |
|
|
25 |
MM12 |
9 |
F: CAAGACAGGTGTTTCAATCT |
50-55 |
101-145 |
|
|
|
R: ATCGACTCTGGGGATGATGT |
|
|
26 |
SPS115 |
15 |
F: AAAGTGACACAACAGCTTCTCCAG |
55-60 |
234-258 |
|
|
|
R: AACGAGTGTCCTAGTTTGGCTGTG |
|
|
27 |
TGLA53 |
16 |
F: GCTTTCAGAAATAGTTTGCATTCA |
55 |
143-191 |
|
|
|
R: ATCTTCACATGATATTACAGCAGA |
|
|
28 |
TGLA122 |
21 |
F: CCCTCCTCCAGGTAAATCAGC |
55-58 |
136-184 |
|
|
|
R:AATCACATGGCAAATAAGTACATAC |
|
|
29 |
TGLA126
|
20
|
F: CTAATTTAGAATGAGAGAGGCTTCT R: TGGTCTCTATTCTCTGAATATTCC |
55-58
|
115-131
|
30 |
TGLA227 |
18 |
F: CGAATTCCAAATCTGTTAATTTGCT |
55-56 |
75-105 |
|
|
|
R: ACAGACAGAAACTCAATGAAAGCA |
|
|
Ch.: chromosome, F: forward primer, R: reverse primer
PCR amplification of Microsatellites
DNA was extracted from the blood samples using the QIAamp DNA blood kit (Qiagen, Germany) according to the manufacturer’s instructions. PCR was carried out in a total volume of 15 μl containing 1X PCR buffer, 1.5 mM MgCl2, 0.2 mM dNTPs (Promega), 0.4 μM each of forward and reverse primers, 1U Taq DNA polymerase (Promega) and 50 ng/μl of genomic DNA. PCR was accomplished by using a touchdown programme. The PCR cycling conditions were as follows: initial denaturation for 8 min at 95 oC, followed by 40 cycles of denaturation at 95 oC for 45 s, annealing at temperatures ranging from 64 – 54 oC for 45 s, and extension at 72 oC for 1 min, and final extension at 72 oC for 10 min. The PCR products were separated using an automated capillary sequencer (CEQ 8000; Beckman Coulter). The CEQ 6.0 software was used to automate allele sizing by comparisons with size standard 400 (Beckman Coulter, USA), which includes DNA fragments from 60 to 420 bp. Data analysis was performed using the AE2 subroutine (dye mobility correction). This analysis included analysis of raw data to estimate the fragment sizes, and filtration of low quality and unwanted samples. Binning was also performed to estimate the allele sizes.
Data analyses
The mean of observed and effective number of alleles (MNA and MNE) and Shannon information index per locus per population were estimated using the Popgene software [13]. The informativeness of the marker and polymorphism information content (PIC) were calculated according to Botstein [14] using the Power Marker software [15]. The Popgene software was used to estimate the observed heterozygosity (HO) and expected heterozygosity (HE) and the deviation from Hardy-Weinberg equilibrium expectation for each locus in the six populations, as well as the inbreeding coefficient (FIS) for the populations. The genetic variation between KK and its crossbred breed types were evaluated by estimation of F-statistics, genetic admixture and genetic distance, as well as by analysis phylogenetic analysis and principal component analysis (PCA).
F-statistics (FIS, FST, and FIT) for each locus and overall, including breed pairwise FST and FIT values were calculated using the Popgene software. The genetic admixture in the KK and the non-descript KK breeds were estimated using two methods: Structure analysis and analysis for Zebu and Taurine diagnostic alleles. The Structure software version 2.3 [16] implements a model-based clustering for inferring population structure using genotype data. To choose the appropriate number of inferred clusters (K), two to seven inferred clusters were performed with three independent runs each. All analyses used a burn-in period of 10000 and 10000 iterations for data collection. The phenomenon that once the real K is reached the likelihood for larger K's (LnP(D)) plateaus and the variance among run increases were not observed. When K was increased, the LnP(D) increased continuously. Therefore, the Evanno method was used. The values of LnP(D) for each K were plotted and the delta K (DK) statistics were estimated, which is based on the rate of change in LnP(D) between successive K values [17]. One to ten inferred clusters were performed with 20 independent runs each. Based on references [18-20] that suggest groups of alleles which may be used as diagnostic markers of Indian zebu, African taurine and European taurine breeds, the frequencies of these alleles at the loci were averaged to estimate of proportion of introgression from the individual cattle groups.
Pairwise genetic distances between the six breed-types were estimated using Nei’s standard genetic distances (DS) [21]. Phylogenetic trees were constructed based on four genetic distance measures: Cavalli-Sforza [22], Nei’s DA genetic distances [23], Goldstein [24] and Shriver [25] using neighbour joining (NJ) method [26]. The robustness of tree topologies was evaluated with a bootstrap test of 1000 resampling across loci; the PowerMarker program [15] was used for this purpose. The phylogenetic trees were edited using MEGA 5 program [27]. The principal components analysis (PCA) was performed using the allele frequencies according to Cavalli -Sforza [28] with the aid of the Unscrambler X 10.1 software.
Microsatellite Loci Analysis
All 30 loci were amplified successfully and were polymorphic. As shown in Table 2 the total number of alleles (TNA) detected across the breed types was 360, and the mean number of alleles (MNA) per locus was 12. The most polymorphic loci were INRA035 and MM12 with 18 alleles each, and the least polymorphic were ETH10, INRA005 and TGLA126 with 8 alleles each. All microsatellite markers showed high polymorphism content in all the breed types. The observed allele size for all 30 loci were within the allele size ranges reported in the literature.
Table 2. Observed (Na) and effective (Ne) number of alleles, polymorphic information content (PIC), Shannon information index (I) and allele size ranges for the microsatellite loci investigated.
No. |
Locus |
Na |
Ne |
PIC |
I |
Allele Size Ranges (bp) |
|
Observed |
Reported in Literature |
||||||
1 |
BM1818 |
10 |
3.9 |
0.72 |
1.74 |
252- 270 |
248-278 |
2 |
BM1824 |
11 |
3.5 |
0.66 |
1.49 |
167-191 |
176-197 |
3 |
BM2113 |
11 |
6.6 |
0.83 |
2.04 |
120-140 |
122-156 |
4 |
CSRM60 |
15 |
7 |
0.84 |
2.22 |
81-111 |
79-115 |
5 |
CSSM66 |
12 |
4.9 |
0.78 |
1.97 |
175-197 |
171-209 |
6 |
ETH3 |
12 |
3.2 |
0.65 |
1.54 |
95-133 |
103-133 |
7 |
ETH10 |
8 |
4 |
0.72 |
1.64 |
205-221 |
207-231 |
8 |
ETH152 |
11 |
4.9 |
0.77 |
1.84 |
185-205 |
181-211 |
9 |
ETH185 |
15 |
3.9 |
0.73 |
1.9 |
204-240 |
214-246 |
10 |
ETH225 |
14 |
4.2 |
0.74 |
1.83 |
133-159 |
131-159 |
11 |
HAUT24 |
12 |
5.5 |
0.8 |
1.95 |
102-126 |
104-158 |
12 |
HAUT27 |
13 |
4.4 |
0.74 |
1.8 |
124-152 |
120-158 |
13 |
HEL1 |
12 |
4.2 |
0.74 |
1.85 |
95-117 |
99-119 |
14 |
HEL5 |
11 |
4.7 |
0.76 |
1.79 |
141-175 |
145-171 |
15 |
HEL9 |
12 |
6.3 |
0.82 |
2.06 |
141-165 |
141-173 |
16 |
HEL13 |
9 |
2.7 |
0.6 |
1.43 |
172-190 |
178-200 |
17 |
ILSTS005 |
11 |
5.2 |
0.79 |
1.92 |
174-196 |
176-194 |
18 |
ILSTS006 |
11 |
3.2 |
0.66 |
1.56 |
275-301 |
277-309 |
19 |
INRA005 |
8 |
5 |
0.77 |
1.69 |
131-145 |
135-149 |
20 |
INRA023 |
13 |
3 |
0.63 |
1.54 |
185-213 |
195-225 |
21 |
INRA032 |
12 |
6.3 |
0.82 |
2.02 |
154-202 |
160-204 |
22 |
INRA035 |
18 |
6.6 |
0.83 |
2.21 |
94-134 |
100-124 |
23 |
INRA037 |
13 |
5.8 |
0.81 |
2.01 |
112-148 |
112-148 |
24 |
INRA063 |
8 |
5.4 |
0.79 |
1.78 |
171-187 |
167-189 |
25 |
MM12 |
18 |
6 |
0.82 |
2.15 |
95-133 |
101-145 |
26 |
SPS115 |
9 |
5 |
0.77 |
1.8 |
240-256 |
234-258 |
27 |
TGLA53 |
13 |
2.4 |
0.56 |
1.46 |
149-181 |
143-191 |
28 |
TGLA122 |
17 |
7.9 |
0.86 |
2.29 |
132-164 |
136-184 |
29 |
TGLA126 |
8 |
4.1 |
0.72 |
1.64 |
113-127 |
115-131 |
30 |
TGLA227 |
13 |
2.6 |
0.58 |
1.44 |
72-98 |
75-105 |
Mean |
12 |
4.7 |
0.74 |
1.82 |
|||
Std Dev |
2.7 |
1.4 |
0.08 |
0.25 |
Genetic diversity within breeds
Table 3 shows the genetic variability at the 30 microsatellite loci typed in the KK cattle breed, its crossbred types and the Brahman. The results showed that the Brahman had the lowest TNA (232) and MNA (7.7), while KKX1 had the highest TNA (280) and MNA (9.3). The TNA and MNA of KK (245 and 8.2, respectively) were lower than the TNA and MNA of the crossbred types (TNA: 256 – 280, MNA: 8.5 – 9.3). The MNE values were less than the MNA values for all the breed types. As for heterozygosity, KK had lower mean observed (Ho) and expected (He) hetrozygosity (0.54 and 0.70, respectively) compared to the KK crossbreds (Ho: 0.57 – 0.65, He: 0.73 – 0.78) and the Brahman (Ho: 0.58, He: 0.75). The mean values of Ho were lower than the mean values of He for all breed types. All breed types had positive inbreeding coefficient (FIS) estimates, ranging from 0.149 in Charoke to 0.232 in KKX2. Of the 180 Hardy - Weinberg equilibrium (HWE) tests (30 loci in six breed types), 144 tests gave significant (p < 0.05) deviation from HWE. The deviations from HWE were for 27 loci in KKX2, 24 loci in KKX1, 23 loci in Brakmas, 22 loci in KK, 19 loci in Charoke and 18 loci in Brahman. No breed exhibited deviation from HWE for all the loci.
Table 3: Genetic variability at the microsatellites typed in the KK cattle breed and KK breed types
Breed |
N |
TNA |
MNA |
MNE |
Ho |
He |
FIS |
HWED |
Kedah Kelantan |
56 |
245 |
8.2 |
3.6 |
0.54 |
0.7 |
0.212 |
22 |
Brakmas |
56 |
259 |
8.6 |
4.0 |
0.58 |
0.73 |
0.205 |
23 |
Charoke |
56 |
271 |
9 |
4.7 |
0.65 |
0.78 |
0.149 |
19 |
KK crossbred 1 |
56 |
280 |
9.3 |
4.3 |
0.59 |
0.74 |
0.169 |
24 |
KK crossbred 2 |
56 |
256 |
8.5 |
4.1 |
0.57 |
0.74 |
0.232 |
27 |
Brahman |
32 |
232 |
7.7 |
4.1 |
0.58 |
0.75 |
0.215 |
18 |
N = number of individuals; TNA = total number of allele; MNA = mean number of allele; MNE = mean number of effective alleles; Ho = observed heterozygosity; He = expected heterozygosity; HWED = number of Hardy-Weinberg equilibrium deviated loci.
Genetic Variation and Relationship between KK and KK Crossbred Types
Table 4 shows the values of the gene differentiation (FST) and gene flow (NM) among the KK breed types and the Brahman. High FST value was found between KKX2 and Brahman (0.049), while the lowest value was found between KK and KKX1 (0.015). The latter FST and that between KK and KKX2 (0.018) was less than the FST between KK and Brakmas (0.03) and between KK and CK (0.041). The FST between Brahman and Brakmas (0.031) was less than the FST between KK and Brahman (0.045). As for the gene flow (NM), high value was observed between KK and KKX1 (16.84), while the lowest value was found between KKX2 and Brahman (4.88). The gene flow between KK and KKX1 (16.84) and KK and KKX2 (13.39) was higher than the gene flow between KK and Brakmas (8.067) and KK and Charoke (5.862). The gene flow between Brahman and Brakmas (7.873) was higher than the gene flow between KK and Brahman (5.321).
Table 4. FST and gene flow among the Kedah Kelantan and KK breed types.
Breed 1 |
Breed 2 |
FST |
NM |
KK |
Brakmas |
0.030 |
8.067 |
KK |
Charoke |
0.041 |
5.862 |
Brakmas |
Charoke |
0.047 |
5.039 |
KK |
KKX1 |
0.015 |
16.843 |
Brakmas |
KKX1 |
0.029 |
8.466 |
Charoke |
KKX1 |
0.027 |
9.037 |
KK |
KKX2 |
0.018 |
13.385 |
Brakmas |
KKX2 |
0.025 |
9.713 |
Charoke |
KKX2 |
0.038 |
6.348 |
KKX1 |
KKX2 |
0.018 |
13.646 |
KK |
Brahman |
0.045 |
5.321 |
Brakmas |
Brahman |
0.031 |
7.873 |
Charoke |
Brahman |
0.044 |
5.415 |
KKX1 |
Brahman |
0.035 |
6.804 |
KKX2 |
Brahman |
0.049 |
4.880 |
KK = Kedah Kelantan, KKX1 = Kedah Kelantan crossbred 1, KKX2 = Kedah Kelantan crossbred 2, FST = the degree of gene differentiation among populations in terms of allele frequencies, NM = gene flow.
Table 5 shows F-statistics for each locus based on pool data from all six breed types. FIS was positive (0.198), and FIT (0.242) exceeded FST (0.054) indicating inbreeding in all breeds. The level of genetic differentiation among KK and the KK crosses measured in terms of FST was moderate; 5.4 % of the total genetic variation corresponded to between breed differences, and 94.6% corresponded to within-breed differences.
Table 5. F-statistics and gene flow at the 30 microsatellite loci across the Kedah Kelantan and KK breed types.
Locus |
FIS |
FIT |
FST |
NM |
BM1818 |
0.272 |
0.295 |
0.031 |
7.87 |
BM1824 |
0.106 |
0.164 |
0.065 |
3.59 |
BM2113 |
0.084 |
0.119 |
0.037 |
6.43 |
CSRM60 |
0.203 |
0.250 |
0.058 |
4.03 |
CSSM66 |
0.011 |
0.057 |
0.046 |
5.15 |
ETH3 |
0.289 |
0.311 |
0.030 |
8.08 |
ETH10 |
0.191 |
0.252 |
0.075 |
3.07 |
ETH152 |
0.079 |
0.138 |
0.064 |
3.66 |
ETH185 |
0.217 |
0.243 |
0.034 |
7.10 |
ETH225 |
0.208 |
0.300 |
0.116 |
1.90 |
HAUT24 |
0.378 |
0.407 |
0.047 |
5.12 |
HAUT27 |
0.543 |
0.558 |
0.034 |
7.06 |
HEL1 |
0.154 |
0.221 |
0.079 |
2.92 |
HEL5 |
0.647 |
0.678 |
0.088 |
2.60 |
HEL9 |
0.106 |
0.135 |
0.033 |
7.37 |
HEL13 |
0.105 |
0.143 |
0.042 |
5.67 |
ILSTS005 |
0.182 |
0.225 |
0.052 |
4.53 |
ILSTS006 |
0.412 |
0.458 |
0.077 |
2.99 |
INRA005 |
0.129 |
0.165 |
0.041 |
5.88 |
INRA023 |
0.069 |
0.116 |
0.050 |
4.75 |
INRA032 |
0.047 |
0.089 |
0.045 |
5.33 |
INRA035 |
0.185 |
0.225 |
0.049 |
4.86 |
INRA037 |
0.158 |
0.196 |
0.045 |
5.29 |
INRA063 |
0.269 |
0.328 |
0.082 |
2.81 |
MM12 |
0.150 |
0.179 |
0.034 |
7.07 |
SPS115 |
0.074 |
0.133 |
0.064 |
3.65 |
TGLA53 |
0.314 |
0.373 |
0.086 |
2.66 |
TGLA122 |
0.117 |
0.154 |
0.042 |
5.76 |
TGLA126 |
0.215 |
0.254 |
0.050 |
4.75 |
TGLA227 |
0.105 |
0.133 |
0.031 |
7.82 |
Mean |
0.198 |
0.242 |
0.054 |
4.38 |
FIS = the deficiency or excess of average heterozygotes, FIT = the deficiency or excess of average heterozygotes in a group of populations, FST = the degree of gene differentiation among populations in terms of allele frequencies.
The genetic structure of the study populations is shown by the clustering assignment of the 312 animals representing the six breed types (Figure 3). The value of K = 3 was chosen as this showed the highest delta K (Figure 3) as suggested by Evanno [17].
Table 6 shows the average proportions of memberships (q) to the three clusters. KK, Charoke and Brahman were grouped in cluster 1, 2 and 3, respectively, with q ≥ 0.80; while KKX2 and Brakmas were grouped in cluster 1 and 3, respectively, with q ≤ 0.80. The KKX1 animals were split among the three clusters. The genetic compositions of the 56 KK individuals (q-values) are shown in Figure 4.
Table 6: Membership of each breed type in each of the three clusters inferred
Given population |
Proportion in inferred Clusters |
Number of individuals |
||
1 |
2 |
3 |
||
KK |
0.85 |
0.05 |
0.11 |
56 |
Brakmas |
0.17 |
0.05 |
0.78 |
56 |
Charoke |
0.08 |
0.85 |
0.07 |
56 |
KKX1 |
0.49 |
0.35 |
0.16 |
56 |
KKX2 |
0.73 |
0.09 |
0.18 |
56 |
Brahman |
0.05 |
0.13 |
0.82 |
32 |
Table 7 shows the zebu and taurine diagnostic alleles and the frequencies of these alleles in the KK and its crossbred types. As shown in Figure 5, all breeds had higher proportions of the zebu alleles compared to the taurine alleles. The mean percentage of zebu diagnostic alleles in the breed types ranged from 18.4% (Brakmas) to 25.8% (KKX2), while the mean percentage of African taurine diagnostic alleles ranged from 2.5% (KK) to 7.4% (Charoke). The mean percentage of European taurine diagnostic alleles ranged from 1.6% (KK) to 4.7% (Charoke).
Table 7. Zebu and Taurine diagnostic alleles and their frequencies in KK and its crossbred breed types.
Group |
Locus |
Allele |
Allele Frequency |
|||||
KK |
BK |
CK |
KKX1 |
KKX2 |
BR |
|||
Indian zebu |
BM2113 |
130 |
0.036 |
0.039 |
0.010 |
0.010 |
0.020 |
0.033 |
140 |
0.000 |
0.000 |
0.000 |
0.000 |
0.000 |
0.000 |
||
CSSM66 |
181 |
0.027 |
0.088 |
0.157 |
0.052 |
0.163 |
0.050 |
|
ETH10 |
207 |
0.100 |
0.060 |
0.091 |
0.155 |
0.239 |
0.121 |
|
209 |
0.582 |
0.420 |
0.318 |
0.409 |
0.424 |
0.293 |
||
211 |
0.046 |
0.000 |
0.000 |
0.046 |
0.076 |
0.017 |
||
ETH152 |
191 |
0.191 |
0.052 |
0.315 |
0.255 |
0.092 |
0.111 |
|
ETH225 |
153 |
0.536 |
0.524 |
0.000 |
0.524 |
0.509 |
0.481 |
|
155 |
0.036 |
0.000 |
0.363 |
0.024 |
0.155 |
0.000 |
||
HEL1 |
101 |
0.009 |
0.063 |
0.125 |
0.057 |
0.066 |
0.071 |
|
107 |
0.028 |
0.115 |
0.298 |
0.047 |
0.132 |
0.119 |
||
117 |
0.000 |
0.000 |
0.039 |
0.000 |
0.000 |
0.024 |
||
HEL13 |
182 |
0.000 |
0.090 |
0.046 |
0.031 |
0.123 |
0.096 |
|
186 |
0.028 |
0.000 |
0.011 |
0.021 |
0.038 |
0.058 |
||
TGLA122 |
144 |
0.000 |
0.020 |
0.075 |
0.051 |
0.028 |
0.091 |
|
Mean |
0.202 |
0.184 |
0.231 |
0.210 |
0.258 |
0.196 |
||
African taurine |
BM1824 |
181 |
0.000 |
0.050 |
0.010 |
0.048 |
0.052 |
0.000 |
BM2113 |
122 |
0.127 |
0.058 |
0.167 |
0.133 |
0.143 |
0.017 |
|
ETH10 |
219 |
0.000 |
0.000 |
0.000 |
0.000 |
0.000 |
0.000 |
|
ETH152 |
195 |
0.000 |
0.010 |
0.019 |
0.018 |
0.000 |
0.056 |
|
HEL1 |
109 |
0.037 |
0.031 |
0.000 |
0.000 |
0.019 |
0.048 |
|
HEL13 |
190 |
0.009 |
0.020 |
0.307 |
0.146 |
0.009 |
0.115 |
|
INRA23 |
199 |
0.000 |
0.096 |
0.018 |
0.009 |
0.018 |
0.000 |
|
Mean |
0.025 |
0.038 |
0.074 |
0.051 |
0.035 |
0.034 |
||
European taurine |
BM1824 |
189 |
0.000 |
0.000 |
0.000 |
0.000 |
0.000 |
0.036 |
CSSM66 |
183 |
0.009 |
0.000 |
0.059 |
0.000 |
0.031 |
0.017 |
|
ETH10 |
215 |
0.082 |
0.050 |
0.034 |
0.136 |
0.098 |
0.138 |
|
HEL1 |
113 |
0.000 |
0.021 |
0.144 |
0.000 |
0.019 |
0.000 |
|
HEL13 |
188 |
0.019 |
0.060 |
0.034 |
0.000 |
0.009 |
0.039 |
|
ILSTS6 |
289 |
0.000 |
0.000 |
0.037 |
0.000 |
0.010 |
0.044 |
|
TGLA122 |
150 |
0.000 |
0.070 |
0.021 |
0.010 |
0.047 |
0.091 |
|
Mean |
0.016 |
0.029 |
0.047 |
0.021 |
0.031 |
0.052 |
Table 8 shows the genetic distance among the breed types. The KK breed was found to be very similar to the KKX1 (GD = 0.074) and KKX2 (GD = 0.092), and was most distant from the Brakmas (GD = 0.159) and Charoke (GD = 0.254). The Brakmas and Charoke breeds had the highest genetic distance (GD = 0.335).
Table 8. Genetic distance and genetic identity among KK and KK breed types
Population |
Population |
|
|||||
KK |
BK |
CK |
KKX1 |
KKX2 |
BR |
|
|
KK |
**** |
0.853 |
0.776 |
0.929 |
0.912 |
0.769 |
|
BK |
0.159 |
**** |
0.715 |
0.843 |
0.866 |
0.831 |
|
CK |
0.254 |
0.335 |
**** |
0.833 |
0.768 |
0.717 |
|
KKX1 |
0.074 |
0.171 |
0.183 |
**** |
0.902 |
0.795 |
|
KKX2 |
0.092 |
0.143 |
0.264 |
0.103 |
**** |
0.723 |
|
BR |
0.263 |
0.185 |
0.333 |
0.230 |
0.324 |
**** |
Nei's genetic identity (above diagonal), genetic distance (below diagonal). KK = Kedah Kelantan, BK = Brakmas, CK = Charoke, KKX1 = Kedah Kelantan crossbred 1, KKX2 = Kedah Kelantan crossbred 2, BR = Brahman.
Figure 6 shows Phylogenetic trees of the study populations. All the trees were in agreement and revealed three clusters. The first cluster consisted of KK and KKX2, and the second cluster consisted of Brahman and Brakmas, while the third cluster contained Charoke and KKX1. Bootstrap values for the trees ranged from 56 to 89 indicating reliable topology of the phylogeny constructed from these distances.
Figure 7 shows an individual-animal-based NJ tree for the 312 individuals. This was built from the Nei’s DA genetic distance. The tree displayed three clusters; KK and KKX2 were clustered into one group, and Charoke and KKX1 into another cluster, while Brahman and Brakmas were in a third cluster.
The results of the PCA on the allele frequences of the 30 microsatellite loci in the six breed types are shown in Figure 8. The first axis, which accounted for 36% of the variation, separated KK, KKX2, KKX1 and Charoke from Brahman and Brakmas. The second axis accounted for 32% of the variation, and separated the KKX1 and Charoke from KK and KKX2, each in a different cluster.
Genetic Diversity at the Microsatellite Loci
A TNA of 360 was observed for the six breed types in the present study. This was higher than that reported for five Cuban cattle breeds (n = 317; TNA = 299) screened for the same 30 microsatellite loci [29]. This may be due to the fact that the Cuban cattle breeds were purebreds, while the present study included crossbred animals with a number of contributing breeds. The TNA was, however, lower than that reported for 27 indigenous Chinese cattle breeds (n = 1638; TNA = 480) for the same loci [30]. This most likely is due to the big sample size and larger number of breeds from different parts of China used in the Chinese study. The range of the PIC values, however, was similar to that reported for seven of the native Chinese cattle breeds (PIC = 0.74 – 0.75) [30] and for the five Cuban breeds [29]. In general, the high number of alleles and PIC values for the individual loci showed that the 30 microsatellite loci recommended by ISAG/FAO for genetic diversity evaluation of cattle are highly informative and suitable for the purpose.
Genetic Diversity within KK Cattle and KK Crossbred Types
The genetic diversity within the breed types was evaluated using the allelic variation. The MNA is consider as a good indicator of genetic variation. The Brahman breed exhibited the lowest MNA (7.7) among the six breed types. This may be due to the smaller sample size used (n = 32), but most likely due to founder effects and population bottlenecks as a result of breeding practices. The Brahman were introduced into Malaysia to be used for crossbreeding as well as to increase the local cattle population. The KK breed had lower MNA than the KK crossbred types. This may be attributed to crossbreeding incorporating the alleles of the parental breeds into the crossbred types [31]; the KK crossbred types would have the KK alleles as well as those of the other parental breeds, increasing the number of allele.
The MNA of KK and KK breed types were lower than that reported for four Chinese native cattle breeds (10.1-10.5) [30], but was higher than those reported for six Spanish native cattle breeds (4.9 - 6.7) [32]. This may be attribute to the differences in population sizes and the sampling technique used. The sample size for the Spanish breeds were between 29 to 50 individuals. Moreover, the breeds occurred as isolated populations and four of them were considered as endanger. Isolated small populations lose genetic variability over time but they become distinctively different.
The average heterozygosity is the best general measure of genetic variation [33]. The KK breed had the lowest Ho (0.54) and He (0.70) among the breed types studied, while the Charoke had the highest values (0.65 and 0.78, respectively). Low heterozygosity could be attributed to isolation and inbreeding, which if not addressed could eventually result in loss of unexploited genetic potential [31]. High heterozygosity in Cheroke could be attributed to the mixed nature of this breed type. The rest of the breed types generally showed similar Ho values, ranging from 0.57 (KKX2) to 0.59 (KKX1). The mean values of Ho were lower than the mean values of He for all the breed types, indicating heterozygous deficiency.
The Ho estimation for KK and Brahman (0.58) were lower than that reported for 27 Chinese native breeds (0.61–0.76) [30], six Indian breeds (0.60- 0.72) [34] and ten Ethiopian breeds (0.64-0.70) [35]. This may be due to the fact that China, India and Ethiopia are considered as cattle domestication centres, where it was believed there was contact between immigrant Asiatic indicine and taurine cattle [36]. Therefore, the high heterozygosity values observed in the cattle breeds in these countries most probably are the consequence of the initial admixture of B. indicus and B. taurus cattle that formed the foundation stocks in the past.
FIS value indicates excess or deficit of homozygotes. In the present study, the mean values of FIS were positive for all six breed types, which indicates excess of homozygotes due to inbreeding in all the breed types. This may be due to non-random mating which may be expected in livestock herds. Selection and controlled mating were practised to a certain extent in the farms concerned, especially the nucleus farms. However, proper record keeping was generally lacking; records were often available for growth traits but pedigree records were often not available. The observed FIS values were higher than that reported for Chinese and Ugandan native cattle breeds [30, 37] screened using the same 30 microsatellite loci.
A population is said to be in Hardy-Weinberg equilibrium (HWE) when the gene and genotype frequencies remain constant from generation to generation, and the latter is of a definite proportion [38]. In the present study the deviations from HWE was observed in all six breed types. Deviation from HWE could be attributed to many causes, among which are selection, assortative mating, migration and small population size, all of which could have influenced these populations. The overall numbers of loci that deviated from HWE were high compared to that reported for 10 Ethiopian and 10 Portuguese native cattle for the 30 microsatellite loci [35, 39].
In general, the low genetic diversity observed in the present study in terms of low mean number of the alleles, heterozygote deficiency and deviation from HWE could be attributed to many reasons, but the most probable reasons are inbreeding, small population sizes and assortative mating. The KK, Brakmas, Cheroke and Brahman animals used in the present study were from single nucleus herds. According to Phillips [40] there are many factors associated with establishing and managing nucleus cattle herd which lead to inbreeding. These include the nucleus herd size, whether the nucleus is open or close, the desired age structure of the nucleus, selection criteria and selection accuracy for the bulls and replacement cows, and completeness of the performance and pedigree records. When these factors were investigated, it was noticed that the records in these nucleus farms were limited and often incomplete. Vital pedigree information was often missing. Consequently, this would have affected the selection accuracy for the bulls and replacement cows. The record keeping at these farms has to be improved and the system reviewed regularly if genetic variability is to be maintained and herd performance is to be improved.
Genetic Variation and Relationship between the KK and KK Crossbred Breed Types
The genetic variation between KK and KK crossbred types were evaluated by estimation of F-statistics, gene flow, genetic admixture and genetic distance, as well as by phylogenetic analysis and principal component analysis (PCA). F-statistics (FIS, FST, and FIT) are measures of the deficit of hetrozygotes relative to expected HWE proportions in the specified population [33] For large, random mating populations, it is expected that the observed heterozygosity would be equal to the expected heterozygosity, and FIS would be equal or close to zero. In this case, FIT would be approximately equal to FST. However, when FIS is negative which implies no inbreeding, FST would generally exceed FIT. On the other hand, when FIS is positive, implying inbreeding in the population, FIT would exceed FST.
In the present study FIS was positive (0.198), and FIT (0.242) exceeded FST (0.054) indicating inbreeding in all breed types. The level of genetic differentiation among KK and its crossbred types measured in terms of FST (5.4%) was moderate. This mean that 5.4 % of the total genetic variation corresponded to between breed type differences, and 94.6% of the total genetic variation corresponded to within-breed type differences. This could be attributed to the fact that the most of the studied breed types were developed or originated from crosses with KK as the maternal line, and the Brahman breed too was involved in many of the crosses; thus the breeds types sharing some common alleles. The value of FST observed in the present study was lower than the FST values for the three Indian cattle breeds, Sahiwal, Hariana and Deoni (FST = 11.3 %), reported by [41] and 27 Chinese indigenous cattle breeds (FST = 8%) [30]. This was probably due to the fact that the breeds used in these earlier studies originated from different parts of the respective countries. For example, in the Indian study the Sahiwal breed was native to Pakistan and found along the India-Pakistan border in the North, while the Hariana and Deoni were found in northern and western India respectively. In the study by Zhang [30] the 27 breeds were representatives from all parts of the vast land area of China, from north, south, east and west. The FST value in the present study was, however, higher than that reported by [35] for 10 Ethiopian cattle breeds (FST = 1.3 %). The most probable cause of this low level of genetic differentiation in these Ethiopian breeds is the fact that Ethiopian cattle breeds have common historical origins, and shared common grazing lands and watering points. Moreover, an uncontrolled mating practice, which is predominant in Ethiopia, increases the gene flow among the breeds.
It is very clear that the FST between KK and KKX1 (FST = 1.5%) and between KK and KKX2 (FST = 1.8%), were lower than the FST between KK and Brakmas (FST = 3%) and between KK and Charoke (FST = 4%). KKX1 and KKX2 represent unplanned breed types and the KK was probably the most common breed used in the mating, thus being a major gene contributor. The Brakmas and Charoke are synthetic breeds developed using planned breeding design, and, therefore they are more different from the KK than the other KK crosses. The genetic makeup of a synthetic breed is not easy to manage and monitor; it is influenced by inbreeding and selection for fitness and desired traits (fertility, fleshing ability, mature weight and coat colour, etc.) which may be bias to one of the parental breeds. In this study, it is clear that all breed types were bias towards the KK breed genes.
The degree between breed differentiations indicated a relatively moderate to high gene flow between the six cattle breeds (Nm = 4.38). The highest gene flow (16.84 %) was between the KK and KKX1 population. The gene flow between the KK and KKX1 populations (16.84%), between KKX1 and KKX2 populations (13.65 %), and between KK and KKX2 populations (13.39%) reflect the genetic similarity between these three breeds, supporting the findings based on the F statistics. High gene flow was also observed between the Brakmas and KKX2 (9.71%) and the Charoke and KKX1 (9.04%) also indicating their genetic closeness between these two pairs. The earlier association may be due to the fact that both Brakmas and KKX2 are crossbreds of KK and Brahman. As for the second pair, both Charoke and KKX1 shared the same ancestral KK population which was then kept as a nucleus herd at MARDI Station in Kluang, Johor. However, due to funding shortage this KK herd was not maintained and the animals were crossed with the different available breeds. Moreover, since both these breed types were from the same farm, there is a possibility that at times there was interbreeding between the two herds. Although the Brakmas and Charoke are crossbreds of KK they showed low inter breed gene flow (5.04%) compared to the others pairs. This could be attributed to the physical separation of the two breeds, and the breeding and selection programs practised in the respective farms; the latter may have been bias towards the genes of the exotic breeds.
The genetic admixture in the KK cattle and the KK breed types was estimated using structure analysis and frequency analysis of the zebu and taurine diagnostic alleles. The results of the structure analysis showed that the studied populations were split into three clusters: KK and KKX2 in the first cluster, Brakmas and Brahman in the second cluster and Charoke in the third cluster. KKX1 was distributed in all three inferred clusters. KK, Charoke and Brahman had more than 80 % membership coefficients in their respective inferred clusters. The genetically defined clusters agreed with the breeds’ histories. Although the KK and Brahman breeds are assumed to be pure breeds, the results showed that both these breeds had admixed (hybrid) individuals. There were genetic contributions from the Brahman (11%) and Charoke (5%) breeds to the KK cattle. The Charoke contribution may be due to a possible use of Charolais or Charoke semen for artificial insemination in this herd. It could also be attributed to the introduction of KK crosses from other farms (government and non government) which may have had Charoke as one of its ancestors into the KK herd. The results of the present study are in agreement with Payne [9] who stated that the majority of indigenous cattle breeds of Southeast and East Asia are subjected to crossbreeding, and so have genes from the Bos taurus and Bos indicus species.
The existence of admixed individuals in the Brahman breed may be attributed to the fact that the Brahman cattle in the present study were imported from Australia (Australian Brahman), which in turn originates from founder population imported from United States of America (USA). According to the American Brahman Breeders Association (ABBA) the Brahman breed in the USA was developed in the early 1900s from progeny of four Indian cattle breeds with some infusion of British-bred cattle [42].
The structure analysis also showed that there were contributions from KK to Brakmas (17%) and the Charoke (8%), though these were less compared to the contributions of KK to the composite crosses, 49% to KKX1 and 73% to KKX2. These results are concordance with the F-statistics and gene flow results. Once again this could be attributed to the effects of the breeding designs and selection programs for both Brakmas and Charoke that ensured that high proportion of the genes from the exotic breeds maintained in the synthetic breeds. The KKXI was identified as having a complicated genetic background. The animals of this breed type displayed membership in all the three clusters. This finding was consistent with the KKX1’s history, which revealed that its ancestors were crossed with different breeds, which included both zebu and Taurine breeds. This explained the high TNA, MNA and Ho. These genetic characteristics of the KKX1 may also be the result of a lack of breeding goals and controlled mating for this herd. Although the KKX2 is outcome of unplanned crossing of KK and Brahman animals, the results revealed higher genetic similarity between the KK and the KKX2 than the Brahman. This result corroborated the gene flow results between KKX2 and KK (13.4%) and between KKX2 and Brahman (4.9%). This is as expected in outcome of most crossbreeding activities at non-research farms. The mating beyond the initial crosses producing the F1 are not controlled to ensure the desirable proportion of the parental breeds. Often the crosses are backcrossed with the indigenous breed as these animals are more readily available and in larger numbers, thereby, the eventual population losing a large proportion of the exotic genes incorporated into the crosses.
Concerning Zebu and Taurine diagnostic alleles, the results show that Charoke had the highest proportion of African and European Taurine diagnostic alleles among the six breed types (7.4% and 4.7%, respectively). This was as expected as Charoke was a Charolais (B. taurus) cross, whereas the other crosses were B. indicus types. The introgression of Indian Zebu genes into the KK and the KK breed types (18.4 – 25.8%) was higher than African zebu genes (2.5 - 7.4%) and the European Taurine genes (1.6 – 5.2 %). The high frequency of the Indian Zebu diagnostic alleles is supported by the history of introduction of Zebu animals into Southeast Asia, where it was believed that the Indian Zebu cattle was spread from India through the human migrations and ancient sea trading routes [9]. Similar levels of introgression of Indian zebu genes (17 − 26.3%) in seven indigenous cattle breeds in central and southern China have been reported by Zhang [30]. Higher level of introgression of Indian zebu genes into indigenous cattle breeds from North Ethiopia (55.16 - 63.78%) was reported by Zerabruk [43] and among west-central African cattle breeds (58.1−74.0%) by Ibeagha-Awemu [44]. This may be due to the fact that Ethiopia has been a gateway for cattle immigrations into Africa. It was believed that a major wave of B. indicus introgression may have started with the Arab settlements along the east coast of Africa [36]. In general, the analysis of the diagnostic alleles produced results suggesting that the KK and the Brahman breeds in the present study was not genetically pure Zebu; they exhibited a proportion of Taurine backgrounds. This result was in agreement with that of the structure analysis. As stated earlier the taurine alleles are possibly the result of historical crossbreeding activities in the country using taurine breeds to improve production of the local cattle.
All phylogenetic trees reconstructed from the NJ method, based on the four genetic distance methods yielded trees, which were consistent with the historical information. Generally, the accuracy of the phylogenetic tree is confirmed by bootstrap values; nodes with high bootstrap values (above 0.70) are considered significant, whereas nodes with low values (below 0.50) were considered not significant. The tree topologies generated in the present study were confirmed by relatively high bootstrap values, ranging from 56 to 89. Concerning the four genetic measures, all trees showed similar results. However, the trees obtained using Cavalli-Sforza [22] and Nei’s DA genetic distances had high bootstrap values (80 – 89) compared to the Goldstein’s and Shriver’s trees (56 – 73).
The PCA revealed the relationship between KK and the other breed types. The central position of Brakmas between KK and Brahman, and of KKX1 between KK and Chaoke as revealed by PCA have been clarified by their admixed nature. The distant positioning of Brakmas and Charoke is evidence of high genetic divergence between these two breed types. The results indicate high frequency of KK genes in KKX1 and KKX2 higher than those of the exotic breeds that have been used in the initial crossing. In contrary, the Brakmas and Charoke have high frequencies of the genes of the exotic breeds. This may be attributed to these breed types being developed through planned crossing and selection for high performance traits of the Brahman and Charolais, respectively. These results are in agreement with those of the structure analysis and the phylogenetic analysis.
In conclusion, the following salient findings are highlighted. The results showed that the microsatellite loci recommended by ISAG/FAO and used in the present study are highly informative and suitable for genetic diversity evaluation in the cattle breeds. There are some genetic variations present in the KK and the non-descript KK crossbreds. However, this genetic diversity risks being lost if no appropriate breeding practices are implemented. The KK is a zebu breed with a very low percentage of taurine alleles. The KK herd used in the present study is to be maintained as a nucleus herd and the purity of the KK has to be conserved. The animals identified as free from admixture should be strategically used for breeding. The non-descript KK crossbreds are very similar to the KK although the two populations exhibited different percentages of genes of exotic breeds. The Charoke and Brakmas are genetically distinct breeds. Proper mating designs should be adopted to maintain these, and the genetic structure of the herds should be monitored so that the time, effort and money invested in their development are not in vain.
bp |
base pair |
|
Ch |
chromosome |
|
DNA |
deoxyribonucleic acid |
|
dNTP |
deoxyribonucleotide triphosphates |
|
DVS |
Department of Veterinary Services Malaysia |
|
EDTA |
ethylenediaminetetraacetic acid |
|
FAO |
Food and Agriculture Organization of the United Nations |
|
FIS |
inbreeding coefficient |
|
FIT |
deficiency or excess of average heterozygotes in a group of populations |
|
FST |
degree of gene differentiation among populations |
|
HE |
expected heterozygosity |
|
HO |
observed heterozygosity |
|
HWE |
Hardy-Weinberg equilibrium |
|
ISAG |
International Society for Animal Genetics |
|
KK |
Kedah Kelantan cattle |
|
KKX1 |
Kedah Kelantan cross 1 |
|
KKX2 |
Kedah Kelantan cross 2 |
|
MARDI |
Malaysian Agriculture Research and Development Institute |
|
MgCl2 |
magnesium chloride |
|
ml |
milliliter |
|
mM |
millimole |
|
MNA |
mean number of allele |
|
MNE |
mean number of effective allele |
|
μl |
microliter |
|
μM |
micromole |
|
Na |
observed number of alleles |
|
Ne |
effective number of alleles |
|
ng |
nanogram |
|
NJ |
Neighbor-joining |
|
OC |
degree centigrade / celsius |
|
PCR |
polymerase chain reaction |
|
PIC |
polymorphic information content |
|
STR |
short tandem repeats |
|
TBE |
Tris/Borate/EDTA |
|
Tm |
melting temperature |
|
UPGMA |
Unweighted Pair Group Method with Arithmetic Mean |
|
UV |
ultraviolet |
|
Ethics approval and consent to participate
Blood samples were collected by veterinarians from the Department of Veterinary Services Malaysia (DVS) as part of their routine screening of animal herds in the country. Random samples were obtained by the researchers from DVS for the present study. We obtained written informed consent to use these animals in this study from the owner(s) of the animals.
Consent for publication
Not applicable
Availability of data and material
The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.
Competing interests
The authors declare that they have no competing interests.
Funding
This work was funded by the Ministry of Science, Technology and Innovation, Malaysia (eScience project 02-01-04-SF0076). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Authors' contributions
H A, J P, R S designed the research. H A conducted the research. H A and J P analysed the data. H A, H Y and J P prepared the manuscript. H A is responsible for the final content. All authors read and approved the final manuscript.
Acknowledgements
The authors would like to thank the Ministry of Science, Technology and Innovation Malaysia (MOSTI) for funding the study. The authors also thank the Malaysian Agriculture Research and Development Institute (MARDI), Department of Veterinary Services Malaysia (DVS) and Kulim Livestock Sdn. Bhd. for granting permission to use blood samples from their herds for this project.