Molecular characterization of virulence factors in Staphylococcus aureus isolated from bovine subclinical mastitis in central Ethiopia

DOI: https://doi.org/10.21203/rs.3.rs-348241/v1

Abstract

Purpose: Staphylococcus aureus (S. aureus) is the most important pathogen involved in bovine mastitis in dairy production. S. aureus produces a spectrum of extracellular protein toxins and virulence factors which are thought to contribute to the pathogenicity of the organism. The aim of this work was to isolate and molecular characterize S. aureus associated with bovine subclinical mastitis in central part of Ethiopia.

Methods: A total of 265 lactating dairy cows from various dairy farms in four different geographical locations were screened by California mastitis test (CMT) for bovine subclinical mastitis. One-hundred thirty CMT positive milk samples were collected and transported to laboratory. Different biochemical tests and polymerase chain reaction (PCR) were used for the identification of S. aureus isolates. Finally, PCR was performed for molecular detection of virulence genes.

Results: From total of 265 lactating dairy cows screened, 49% (n=130) were positive for bovine subclinical mastitis. One-hundred thirty mastitic milk samples were subjected to bacterial culturing, one hundred (76%) S. aureus isolates were identified based on phenotypic characters. Sixty-eight confirmed S. aureus isolates were obtained using PCR. The confirmed S. aureus isolates were tested for six virulence genes (tsst-1, hlb, eta, sea, clfA and icaD) using PCR. Of the six virulence genes screened from all the isolates, only two (clfA and eta) were detected in the isolates. Out of 68 isolates, 25% and 22% were possessed the eta and clfA genes, respectively.

Conclusion: Presence of Staphylococcus aureus having virulence genes (eta and clfA) revealed that mastitis is a major concern nowadays affecting animal health, milk quality, and yield. Further genomic study of these isolates will provide broad new insights on virulence.

Background

Mastitis is considered to be the most frequent and most costly production diseases in dairy herds of developed and developing countries including Ethiopia. Mastitis is an inflammatory response of the teat canal as a result of bacterial infection (Song et al., 2020). Staphylococcus aureus (S. aureusisone of the most recognized pathogen causing many serious diseases in humans and animals worldwide, and is the most common causative agent of clinical and subclinical bovine mastitis (Ote et al., 2011).

Mastitis caused by S. aureus is the result of production of several virulence factors that can contribute in different ways of pathogenesis (Vaughn et al., 2020). Virulence factors of S. aureus can be grouped broadly into two major classes which include surface localized structural components that serve as virulence factors and secreted virulence factors, which together help this pathogen to evade the host's defenses and colonize mammary glands (Diep and Otto, 2008). Some of surface localized structural components that serve as virulence factors include membrane-bound factors (collagen binding protein, fibrinogen binding protein, elastin binding protein and penicillin binding protein ), cell wall-bound factors (protein A, β-Lactamase and protease) and cell surface associated factors (capsule and slime) (Diep and Otto, 2008). Some of the known secretory virulence factors are toxins (staphylococcal enterotoxins, toxic shock syndrome toxin 1, hemolysins and exfoliatin), enzymes (coagulase, staphylokinase, DNAase, phosphatase, lipase and phospholipase). In addition to specific virulence factor, S. aureus also possesses different mechanisms or traits such as biofilm formation, adhesion to and invasion into mammary epithelial cells and formation of small colony variant (SCV) that enable this pathogen to resist host defense mechanisms. Some of these toxins are known to function as superantigens that cause increased immunological reactivity in the host (Rollin et al., 2015; Bobbo et al., 2017).

The differences in pathogenicity of S. aureus strains could result from geographical distribution and from host-and tissue-related characteristics (van Leeuwen et al., 2005). The numbers and combination of virulence genes may be important contributions to pathogenic potential of S. aureus strains (Zecconi et al., 2006). High number of S. aureus genotypes present in bovine herds worldwide has been studied to develop better strategies of treating mastitis (Kot et al., 2016). The identification and characterization of virulence factors of S. aureus causing bovine mastitis will enhance our understanding of the pathogenesis of intramammary infection (Zecconi et al., 2006). In addition, the antibiogram of S. aureus needs to be studied which would indicate the pattern of resistance to various antibacterials contributing to their virulence properties (Graveland et al., 2011). These may in turn contribute to the development of methods to minimize the production losses due to mastitis. Further, the study of evolution of strain-specific transmission and virulence characteristics including antibiotic resistance in S. aureus isolated from bovine mastitis may help us to understand mechanisms behind emergence of new strains or shifts in mastitis epidemiology in response to control measures, including antibiotic treatment and vaccination (Yu et al., 2012).

However, at present few reports has been reported about the occurrence of virulence factors among S. aureus isolated from milk of cows suffering from mastitis but not identified by molecular technique in central part of Ethiopia. Furthermore, there is a literature dearth on the prevalence and genetic characterization of virulence determinants in S. aureus in Ethiopia. As to our knowledge, most of the researches in Ethiopia were done in association with prevalence of bovine mastitis cases and its associated risk factors (Abera et al., 2010; Tesfaye et al., 2010) but molecular data on S. aureus causing bovine mastitis in remain scarce. Therefore, the aim of this work was to isolate S. aureus associated with bovine subclinical mastitis and study of molecular characterization of virulence factors in that isolates in central part of Ethiopia.

Methods

Samples and study population

Two-hundred and sixty-five milk samples were collected from lactating dairy cows that showed subclinical mastitis symptoms. Milk samples were collected from intensive production system across different geographical locations (Adaberga, Ambo, Bishoftu and Holeta) in central part of Ethiopia since November 2018 to June 2019. Milk samples were collected and proceeded as described in previous study (Patel et al., 2017). Briefly, udders were wiped with 70% ethyl alcohol and few drops of milk were discarded initially. Simultaneously, CMT was executed on the site and on the basis of CMT score samples were collected (Bhatt et al., 2011; Patel et al., 2017). The study areas were purposively selected based on the agro-ecological differences and abundance of dairy farm milk sheds. The farms included in this study were involved in the production of milk for self-consumption and supplier to milk cooperative.

Bacterial isolation and identification

Milk samples were evaluated for mastitis-causing bacteria by bacteriological culture and biochemical tests following the National Mastitis Council Guidelines (Oliver et al., 2004). Briefly, 100μL of milk sample was inoculated onto nutrient broth media (Merck, Germany) with 5% sheep blood (Becton Dickinson Microbiology System, Cockeysville) and incubated at 37°C for 24 hr. Plates were evaluated for bacterial growth, colony morphology and hemolysis after 24 hr. Each pure colony was differentiated by Gram-stain. Followed by catalase test. Catalase positive cocci were considered Staphylococcus species and further confirmed by polymerase chain reaction (PCR), and tube coagulase test using rabbit plasma (NVI, Bishoftu, Ethiopia) to differentiate S. aureus from coagulase-negative Staphylococcus species. The resulting culture was used for bacterial DNA extraction and the remaining overnight culture of S. aureus isolate in tryptic soy broth (TSB) (BHI, Merck, Germany) was mixed with equal volume of sterile 85% Glycerol and stored in a -80°C freezer for further molecular work.

Bacterial DNA extraction

Staphylococcus aureus bacteria were sub-cultured on nutrient broth media (NB, Merck, Germany) and incubated at 37°C for 24 hr. Genomic DNA of all phenotypically positive S. aureus isolates was extracted from the culture using the Zymo Research Fungal and Bacterial Genomic DNA MiniPrepTM kit (Zymo Research, Irvine, USA) following the manufacturer’s instructions. Purity, quality and quantity of extracted DNA were measured using Nanodrop device (NanoDrop, Thermo Scientific, USA), gel electrophoresis and spectrophotometer. The extracted genomic DNA was stored at -20°C until next use.

Molecular confirmation of S. aureus and detection of virulence gene

Polymerase chain reaction (PCR) was used to amplify the 16SrRNA gene fragment of S. aureus isolates according to previously described protocol [17] using EdvoCycler™ PCR machine (Edvotek, Inc, Bethesda). Also, all isolates were tested by PCR for the presence of the staphylococcal enterotoxin A (sea), exfoliative toxin A (eta), beta hemolysin toxin (hlb), clamping factor A (clfa), intercellular adhesion D (icaD) and toxic shock syndrome toxin-1 (tsst-1) according to previously described protocol [18-21]. Primers used for the PCR amplification were synthesized by Sigma-Aldrich (Bonn, Germany) and master mix synthesized by BioBasic company (BioBasic, Canada). The primers used for molecular identification of different virulence-associated genes are indicated in Table 1. Lyophilized primers for the target genes were reconstituted using DNase-RNase free sterile water to obtain 1000µM stock solutions. All primers were stored at -20°C and then finally diluted to working concentration of 10µM. PCR was carried out in a total volume of 25μl containing 12.5μl of 1X Taq PCR Master Mix (Bio Basic, Canada), 1μl of forward primer and 1μl of reverse primer, 3μl of DNA template and 7.5μl sterile nuclease free water. The cyclic polymerase chain reaction conditions of the different primer sets are described on Table 2. PCR products were run on a 1% agarose (w/v) gel using electrophoresis, stained with gel red (Merck, Darmstadt, Germany) at 120 volts for 1hr and visualized under UV light using a BioDoc-itTM imaging system (Cambridge, UK). We used GeneRuler 100bp Plus DNA Ladder (Bioneer).

Statistical analysis

The data generated from the study was arranged, coded and entered to excel spread sheet (Micro oft® office excels 2010) and subjected to statistical analysis. The prevalence to every test was calculated as the number of positive cattle divided by the number of examined cases within the specified period. The Pearson Chi-square test (χ2) was applied to determine existence of any association between sampling areas and virulence associated genes using SPSS software version 22.0. The significance level was set at P-value (0.05) and 95% confidence level. In all cases, 95% confidence level and p-value less than 0.05 was consider as statistical significance.

Table 1: Description of the primers used for molecular identification of different virulence-associated genes detection in S. aureus isolates

 

Target gene

 

Primer name and its sequence (5’→3’)

 

Amplicon size (in bp)

 

Reference

16SrRNA

Staph. aureus specific

 

 

Sau234_F:  CGATTCCCTTAGTAGCGGCG

Sau1501_R:  CCAATCGCACGCTTCGCCTA

 

1267

 

(Riffon et al., 2001)

 

sea

 

SEA_F: TTGGAAACGGTTAAAACGAA

SEA_R: GAACCTTCCCATCAAAAACA

 

120

 

(Mehrotra et al., 2000)

 

 

tsst-1

 

TSST_F: ATGGCAGCATCAGCTTGATA

TSST_R: TTTCCAATAACCACCCGTTT

 

350

 

(Mehrotra et al., 2000)

 

eta

 

ETA_F: CGCTGCGGACATTCCTACATGG

ETA_R: TACATGCCCGCCACTTGCTTGT

 

676

 

(Li et al., 2018a)

 

 

hlb

 

HLB_F: GTGCACTTACTGACAATAGTGC

HLB_R: GTTGATGAGTAGCTACCTTCAGT

 

309

 

(Li et al., 2018a)

 

clfA

 

CLFA_F:  GCAAAATCCAGCACAACAGGAAACGA

CLFA_R: CTTGATCTCCAGCCATAATTG GTGG

 

638

 

(Kumar et al., 2009)

 

icaD

 

ICAD_F: AAGCCAGACAGAGGCAATATCCA

ICAD_R: AGTACAAACAAACTCATCCATCCGA

 

249

 

(Greco et al., 2008)

NB:  Sea = Staphylococcal enterotoxin a; tsst-1= Toxic shock syndrome toxin one; eta = Exfoliative toxin A; hlb = Beta hemolysin toxin; clfA = clumping factorA; icaD = Intracellular adhesive toxin

 

Table 2: Cyclic polymerase chain reaction conditions of the different primer sets

 

Target genes

 

Initial denaturation

 

Amplification (35 cycles)

 

Final extension

 

Denaturation

 

Annealing

 

Extension

16SrRNA

 S. aureus specific

 

94°C / 5 min

 

94°C / 30 sec

 

55 °C / 30 sec

 

72°C /45 sec

 

72°C / 5 min

sea

95°C / 10 min

94°C / 2 min

55 °C / 2 min

72°C / 1 min

72°C / 1 min

tsst-1

95°C / 10 min

94°C /2 min

55 °C / 2 min

72°C / 1 min

72°C / 1 min

eta

94°C / 5 min

94°C / 30 sec

57 °C / 30 sec

72°C / 45 sec

72°C / 10 min

hlb

94°C / 5 min

94°C / 30 sec

58 °C / 30 sec

72°C / 20 sec

72°C / 10 min

clfA

94°C / 10 min

94°C / 10 min

55 °C / 1 min

72°C / 1 min

72°C / 10 min

icaD

94°C / 10 min

94°C / 30 sec

53 °C / 30 sec

72°C /30 sec

72°C / 10 min

Results

Isolation and identification ofS. aureusisolates

In this study, of the 265 lactating dairy cows screened, 130 (49%) were positive for bovine mastitis based on CMT. One-hundred and thirty mastitic milk samples were subjected to bacterial culturing, 100 (76%) S. aureus isolates were identified based on the morphological and biochemical characters. From a total of 100 phenotypically positive S. aureus isolates, 68(68%) of them were confirmed S. aureus isolates through PCR amplification. The presence of 16SrRNA gene (1267bp) was confirmed by PCR in S. aureus-positive isolates (Fig. 1).

Prevalence of virulence genes inS. aureus

All 68 PCR confirmed S. aureus isolates were tested for six virulence genes including tsst-1, hlb, eta, sea, clfA and icaD using PCR amplification. Of the six virulence genes screened from all the isolates, only two (clfA and eta) were detected. The isolates for the current study were obtained from mastitic bovine milk samples representing four geographical locations (Adaberga, Ambo, Bishoftu and Holeta) in the central parts of Ethiopia. Out of 68 isolates, 17 (25%), 15 (22%) and 6 (8.8%) isolates were possessed eta, clfA and combination of eta and clfA genes, respectively. The large proportion of these isolates which harbor eta and clfA genes were obtained from Holeta (46%, 7/15) and Adaberga (52%, 9/17), respectively. The prevalence of virulence gene was not statistically significant between different sampling areas (X2 = 1.239; P = 0.744). The prevalence rates of the virulence genes were depicted in Fig. 3 below. The expected PCR product sizes obtained from these PCR products were 638 and 676bp for clfA and eta, respectively (Fig. 2).

Discussion

Staphylococcus aureus is one of the major cause of mastitis that leads to reduction of milk production in dairy cattle (Krishnamoorthy et al., 2017). The control of bovine mastitis is vital not only in Ethiopia but also in the world. Therefore, it is essential to investigate the pathogens using molecular techniques as vibrant components to control intra-mammary infections. In dairy industry the mastitis can be reduced by identification of exact pathogenesis and virulent factors present in infectious microorganisms. The molecular typing of infectious agents is known to be essential part of infection control strategies and is crucial to track and spread of contagious infections from one region to others or among different herds. Consequently, it is crucial to examine the mastitis causing bacteria using molecular methods as forceful tools to control IMI. Because S. aureus is the most commonly contagious mastitis pathogens worldwide, it is important to reveal virulence factors of these agents to develop effective control strategies against mastitis caused by this pathogen (Khan et al., 2013). In addition, an effective vaccine against IMI is not available, therefore prevention and control of mastitis needs detection of the principal antigenic determinants for the strategy and progress of more proficient vaccines against mastitis causing bacteria, especially S. aureus.

A number of studies have been conducted in Ethiopia on the prevalence of S. aureus in bovine milk (Abera et al., 2012; Mekonnen et al., 2017). Most of these researches focused on the importance of this pathogen as a cause of clinical and subclinical mastitis, however, its virulence determinants have not been well addressed. To our knowledge, there is no reliable information on molecular data of virulence genes in S. aureus from mastitic bovine milk samples in Ethiopia. Epidemiological studies indicates that S. aureus strains agents of milk produce a group of virulence factor and it is believed that there is a relationship between severity of infection and the virulence factors produced by S. aureus (Almaw et al., 2008). Hence, in this study, the prevalence of certain virulence genes such as sea, eta, hlb, clfA, icaD and tsst-1 for S. aureus was evaluated.

In this study, from a total of 130 CMT positive isolates, S. aureus was the most frequently encountered organism with an isolation rate of 76%. The predominance and primary role of S. aureus isolate in bovine mastitis has also been reported in other studies (Abera et al., 2012; Demissie et al., 2018). Apart from Ethiopia, S. aureus has also been reported as the chief etiological agent of mastitis in cattle by many studies from African and Asian countries (Abebe et al., 2016). Though direct comparisons among studies might be difficult, but in general, the variation in the prevalence between the present and previous studies might be due to differences in detection methods, geographical location of the study sites, and differences in farm management practices in each studied farms. S. aureus is adapted to survive in the udder and usually establishes mild subclinical infection of long duration from which it is shed through milk serving as source of infection for other healthy cows and transmitted during the milking process (Radostits et al., 2007). Hence, the organism has been assuming apposition of major importance as a cause of bovine mastitis.

Out of 100 phenotypically positive S. aureus isolates, 68 % of them were confirmed S. aureus isolates by using PCR amplification. The finding of this study was in agreement with (Li et al., 2018b). Regardless of the isolation and identification techniques employed, the confirmation of S. aureus in milk using molecular highlights the need for both strict farm management practices and proper sanitary procedures to be implemented during milking operations.

The pathogenicity of S. aureus is closely related to presence of various virulence genes (Kot et al., 2016). In this study, six virulence factors of the pathogen were screened but only two of them were positive based on PCR amplification. Our data showed that 15 out of 68 S. aureus isolates carried exfoliative toxin A (eta) (22.05%) and 17 out of 68 S. aureus isolates contained clfA (25%) genes. Of 68 S. aureus examined, 32 (47.05%) were positive for one or more virulence genes. About half (52.95%) of the isolates did not contain any of the virulence genes tested. The eta and clfA were found at higher frequencies whereas sea, hlb, icaD and tsst-1 were not found in all tested isolates. Five isolates harbored both eta and clfA genes. There has been no published information regarding clamping factor A (clfA) and exfoliative toxin A (eta) in the Ethiopian context. This is the first investigation regarding to these genes in Ethiopia and there is no other work on these virulence factors. This finding is different from (Srinivasan et al., 2006) who examined 78 S. aureus isolates from the milk of cows with mastitis for 16 enterotoxin genes and found that 73 (93.6%) of the isolates were positive for one or more enterotoxin genes from a similar area. However, (Srinivasan et al., 2006) tested for 16 enterotoxin genes whereas in this study only one enterotoxin genes were tested. This might be the reason for the low prevalence of positive isolates in this study. The presence of the clumping factor gene is considered as Staphylococcus species virulence gene in development and severity of mastitis in cows (Aarestrup et al., 1995). The above results suggested that S.aureus isolates with different genetic background have different ability to acquire mobile genetic elements such as plasmids, phages and pathogenicity islands.

Conclusions

High prevalence of virulence genes (clfA and eta) in S.aureus bacteria were the most important findings of our study. All of the S. aureus bacteria harbored clfA and eta putative virulence factors which showed that they can use as specific genetic markers for detection of pathogenic S.aureus bacteria in bovine subclinical mastitis cows. Presence of virulence factors in mastitis causing Staphylococcus aureus is an alarming spot for veterinarians, as several sources are there for spreading of microorganisms to human being. The emergence of different antibiotic resistance and virulence in the last two decades is exerting a lot of pressure in the health sector. Detailed genomic evaluation of particular antibiotic resistant strain with virulent factors may possess a great scope to develop new disease control strategy.

Abbreviations

clfA = clumping factor A; CMT = California mastitis test; DNA = Deoxyribonucleic acid; eta = Exfoliative toxin A; hlb = Beta hemolysin toxin; icaD = Intracellular adhesive toxin D; P –value = predictive value; PCR = polymerase chain reaction; Sea = Staphylococcal enterotoxin a; tsst-1 = Toxic shock syndrome toxin one; χ2 = Pearson chi-square;

Declarations

Ethics approval and consent to participate

This study was conducted after gaining full approval by the ethical review board of the College of Veterinary Medicine and Agriculture, Addis Ababa University, Ethiopia. Informed written consent was taken from all participants prior to participation in this study. Also, permission from dairy farm owners/managers was obtained before collection of milk samples

Consent for publication

Not applicable

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Competing interests

The authors declare that they have no competing interests

Funding

This study was supported by Ethiopian Institute Agricultural Research and Addis Ababa University. The institutions had no role on design of the study and collection, analysis and interpretation of data and in writing the manuscript.

Acknowledgments

Authors greatly appreciate the contribution made by Ethiopian Institute Agricultural Research, National Agricultural Biotechnology Research Center in funding this project and the staff of the Animal Biotechnology Research Laboratory for assisting during the bench work which has led to the success of this study. We thankful to the farmers and veterinarians who provided the milk samples used in this study.

Authors' information

1Ethiopian Institute of Agricultural Research, National Agricultural Biotechnology Research Center, Animal Biotechnology Research Program, P.O. Box 249, Holeta, Ethiopia,

2Addis Ababa University, College of Veterinary Medicine, Department of Veterinary Microbiology, Immunology and Public Health, P.O. Box 34, Bishoftu, Ethiopia

References

Aarestrup, F.M., Wegener, H., Rosdahl, V., 1995. Evaluation of phenotypic and genotypic methods for epidemiological typing of Staphylococcus aureus isolates from bovine mastitis in Denmark. Veterinary microbiology 45, 139-150.

Abebe, R., Hatiya, H., Abera, M., Megersa, B., Asmare, K., 2016. Bovine mastitis: prevalence, risk factors and isolation of Staphylococcus aureus in dairy herds at Hawassa milk shed, South Ethiopia. BMC veterinary research 12, 270.

Abera, M., Demie, B., Aragaw, K., Regassa, F., Regassa, A., 2010. Isolation and identification of Staphylococcus aureus from bovine mastitic milk and their drug resistance patterns in Adama town, Ethiopia. Journal of Veterinary Medicine and Animal Health 2, 29-34.

Abera, M., Habte, T., Aragaw, K., Asmare, K., Sheferaw, D., 2012. Major causes of mastitis and associated risk factors in smallholder dairy farms in and around Hawassa, Southern Ethiopia. Tropical animal health and production 44, 1175-1179.

Almaw, G., Zerihun, A., Asfaw, Y., 2008. Bovine mastitis and its association with selected risk factors in smallholder dairy farms in and around Bahir Dar, Ethiopia. Tropical animal health and production 40, 427-432.

Bhatt, V.D., Patel, M.S., Joshi, C.G., Kunjadia, A., 2011. Identification and antibiogram of microbes associated with bovine mastitis. Animal biotechnology 22, 163-169.

Bobbo, T., Ruegg, P., Stocco, G., Fiore, E., Gianesella, M., Morgante, M., Pasotto, D., Bittante, G., Cecchinato, A., 2017. Associations between pathogen-specific cases of subclinical mastitis and milk yield, quality, protein composition, and cheese-making traits in dairy cows. Journal of Dairy Science 100, 4868-4883.

Demissie, T.F., Menghistu, H.T., Mitiku, M.A., 2018. Prevalence of mastitis and identification of its bacterial causative agents in small holder dairy farms in and around Wukro of Tigray region, Ethiopia. Int. J. Adv. Res. Biol. Sci 5, 10-22.

Diep, B.A., Otto, M., 2008. The role of virulence determinants in community-associated MRSA pathogenesis. Trends in microbiology 16, 361-369.

Graveland, H., Duim, B., Van Duijkeren, E., Heederik, D., Wagenaar, J.A., 2011. Livestock-associated methicillin-resistant Staphylococcus aureus in animals and humans. International Journal of Medical Microbiology 301, 630-634.

Greco, C., Mastronardi, C., Pagotto, F., Mack, D., Ramirez‐Arcos, S., 2008. Assessment of biofilm‐forming ability of coagulase‐negative staphylococci isolated from contaminated platelet preparations in Canada. Transfusion 48, 969-977.

Khan, A., Hussain, R., Javed, M.T., Mahmood, F., 2013. Molecular analysis of virulent genes (coa and spa) of Staphylococcus aureus involved in natural cases of bovine mastitis. Pak J Agric Sci 50, 739-743.

Kot, B., Szweda, P., Frankowska-Maciejewska, A., Piechota, M., Wolska, K., 2016. Virulence gene profiles in Staphylococcus aureus isolated from cows with subclinical mastitis in eastern Poland. The Journal of Dairy Research 83, 228.

Krishnamoorthy, P., Suresh, K., Saha, S., Govindaraj, G., Shome, B., Roy, P., 2017. Meta-analysis of prevalence of subclinical and clinical mastitis, major mastitis pathogens in dairy cattle in India.

Kumar, J.D., Negi, Y.K., Gaur, A., Khanna, D., 2009. Detection of virulence genes in Staphylococcus aureus isolated from paper currency. International Journal of Infectious Diseases 13, e450-e455.

Li, X., Fang, F., Zhao, J., Lou, N., Li, C., Huang, T., Li, Y., 2018a. Molecular characteristics and virulence gene profiles of Staphylococcus aureus causing bloodstream infection. Brazilian Journal of Infectious Diseases 22, 487-494.

Li, X., Fang, F., Zhao, J., Lou, N., Li, C., Huang, T., Li, Y., 2018b. Molecular characteristics and virulence gene profiles of Staphylococcus aureus causing bloodstream infection. Braz J Infect Dis 22, 487-494.

Mehrotra, M., Wang, G., Johnson, W.M., 2000. Multiplex PCR for detection of genes forStaphylococcus aureus enterotoxins, exfoliative toxins, toxic shock syndrome toxin 1, and methicillin resistance. Journal of clinical microbiology 38, 1032-1035.

Mekonnen, S.A., Koop, G., Melkie, S.T., Getahun, C.D., Hogeveen, H., Lam, T.J., 2017. Prevalence of subclinical mastitis and associated risk factors at cow and herd level in dairy farms in North-West Ethiopia. Preventive veterinary medicine 145, 23-31.

Oliver, S., Gonzalez, R., Hogan, J., Jayarao, B., Owens, W., 2004. Microbiological Procedures for the Diagnosis of Bovine Udder Infection and Determination of Milk Quality, Verona, WI, USA: The National Mastitis Council. Inc.[Google Scholar].

Ote, I., Taminiau, B., Duprez, J.-N., Dizier, I., Mainil, J.G., 2011. Genotypic characterization by polymerase chain reaction of Staphylococcus aureus isolates associated with bovine mastitis. Veterinary microbiology 153, 285-292.

Patel, K., Joshi, C., Kunjadiya, A., 2017. Isolation and molecular identification of Staphylococcus spp. from bovine mastitis milk samples. Int J Adv Res 5, 2320-5407.

Radostits, O.M., Gay, C., Hinchcliff, K.W., Constable, P.D., 2007. A textbook of the diseases of cattle, horses, sheep, pigs and goats. Veterinary medicine 10, 2045-2050.

Riffon, R., Sayasith, K., Khalil, H., Dubreuil, P., Drolet, M., Lagacé, J., 2001. Development of a rapid and sensitive test for identification of major pathogens in bovine mastitis by PCR. Journal of clinical microbiology 39, 2584-2589.

Rollin, E., Dhuyvetter, K., Overton, M., 2015. The cost of clinical mastitis in the first 30 days of lactation: An economic modeling tool. Preventive veterinary medicine 122, 257-264.

Song, X., Huang, X., Xu, H., Zhang, C., Chen, S., Liu, F., Guan, S., Zhang, S., Zhu, K., Wu, C., 2020. The prevalence of pathogens causing bovine mastitis and their associated risk factors in 15 large dairy farms in China: An observational study. Veterinary Microbiology 247, 108757.

Srinivasan, V., Sawant, A.A., Gillespie, B.E., Headrick, S.J., Ceasaris, L., Oliver, S.P., 2006. Prevalence of enterotoxin and toxic shock syndrome toxin genes in Staphylococcus aureus isolated from milk of cows with mastitis. Foodbourne Pathogens & Disease 3, 274-283.

Tesfaye, G.Y., Regassa, F.G., Kelay, B., 2010. Milk yield and associated economic losses in quarters with subclinical mastitis due to Staphylococcus aureus in Ethiopian crossbred dairy cows. Tropical animal health and production 42, 925-931.

van Leeuwen, W.B., Melles, D.C., Alaidan, A., Al-Ahdal, M., Boelens, H.A., Snijders, S.V., Wertheim, H., van Duijkeren, E., Peeters, J.K., van der Spek, P.J., 2005. Host-and tissue-specific pathogenic traits of Staphylococcus aureus. Journal of bacteriology 187, 4584-4591.

Vaughn, J., Abdi, R.D., Gillespie, B.E., Dego, O.K., 2020. Genetic diversity and virulence characteristics of Staphylococcus aureus isolates from cases of bovine mastitis. Microbial Pathogenesis, 104171.

Yu, F., Li, T., Huang, X., Xie, J., Xu, Y., Tu, J., Qin, Z., Parsons, C., Wang, J., Hu, L., 2012. Virulence gene profiling and molecular characterization of hospital-acquired Staphylococcus aureus isolates associated with bloodstream infection. Diagnostic microbiology and infectious disease 74, 363-368.

Zecconi, A., Cesaris, L., Liandris, E., Daprà, V., Piccinini, R., 2006. Role of several Staphylococcus aureus virulence factors on the inflammatory response in bovine mammary gland. Microbial pathogenesis 40, 177-183.