Ethics for HCC samples collecting and animal experiments
HCC samples from patients were collected under the guidelines of the Ethics Committee. And the animal experiments were conducted under the guidelines of the Animal care and use committee. All nude mice were purchased from Shanghai SLAC Laboratory Animal Co., Ltd, and housed under room temperature and a 12-h light-dark cycle.
Total RNA extraction and quantitative PCR
Total RNA from human HCC samples and cell lines were extracted using Beyozol (R0011, Beyotime, Shanghai) according to the standard guidelines. The extracted total RNA was the reverse transcribed to complementary DNA using BeyoRT cDNA synthesis kit (D7168L, Beyotime, Shanghai). The expression levels of SNHG6 and HIF1A were quantitatively quantified using qPCR SYBR Green Master Mix (DRR041A, Takara, China). GAPDH was selected as the internal reference gene.
Culture and transfection of Hep3B and Huh7
Hep3B and Huh7 cells were purchased from ATCC and cultured in supplemented Minimum Essential Medium with Earle′s Balanced Salts (51415C, Sigma, America) supplemented with 10% FBS (fetal bovine serum) and 1% PS (penicillin and streptomycin). Cells were cultured at 37℃ using a humidified incubator containing a 5% CO2 and 95% air. The small interfering RNA targeting SNHG6 and its corresponding scramble siRNA were synthesized by Genewiz, Suzhou, China. The sequences of siRNA for SNHG6 were as follows: si-SNHG6: AAAUGCUGCAUGCCACACUUGAGGU; scramble, UUCUCCGAACGUGUCACGUTT. The siRNA oligonucleotides were annealed and then cloned into pSuper vectors for the expression of siRNAs. Cell transfection assays were conducted using Lipofectamine 3000 (L3000075, ThemoFisher, America) according to the standard procedures.
Immuno-histochemical staining
The cells were fixed with 4% paraformaldehyde (PFA) for 30 minutes at room temperature, washed with PBS for 3 times, and incubated with 0.5% Triton X-100 for 20 minutes. The proliferation status of the cells was then measured using BeyoClick™ EdU Cell Proliferation Kit (C0071, Beyotime, Shanghai). The human samples were collected, incubated in 4% PFA for fixation for 12 hours, and sectioned into 20μm slices. The slices were further incubated in 1% Triton X-100, primary antibody solutions (Ki67, ab15580, Abcam, American) and secondary antibody solutions.
Western blot
The lysate from Hep3B and Huh7 cells were prepared using RIPA lysis buffer (radio-immunoprecipitation assay buffer), and the protein concentration was measured with Pierce™ BCA Protein Assay Kit (23225, ThermoFisher, American). Finally, the level of SOX2 was detected with the anti-SOX2 antibody (2748, Cell signaling, American). HIF1A antibody (AF1935, R&D Systems, America), cleaved caspase3 antibody (8202S, Cell Signaling Technology, America) and PCNA antibody (GTX100539, GeneTex, China) were used in this study.
Migration and invasion assays
To assess the migration and invasion abilities of cells after down-regulation of SNHG6 and up-regulation of miR-6509-5p, 12 mm Transwell® with 3.0 µm Pore Polycarbonate Membrane Insert (3402, Corning, American) were employed. For the migration ability assessment, Hep3B and Huh7 cells were respectively seeded in the lower chamber at the density of 3 x 105 cells. Cells were incubated till covering the entire bottom, and then scratched using the pipette tips, cultured for two days. For the invasion ability assessment, the chamber of the transwell insert was coated with Matrigel. And Hep3B and Huh7 cells were respectively seeded in the chamber at the density of 3 x 105 cells. Two days later, cells without migration were gently removed. Cells were fixed and then stained with 0.1% crystal violet. Finally, the wound-healing status of cells was imaged using the optical microscope.
Luciferase assay
For the purpose of confirm the direct binding between SNHG6 and miR-6509-5p, SNHG6 fragment with the miR-6509-5p binding site and SNHG6 with mutated miR-6509-5p binding site were sub-cloned into the luciferase reporter vectors. The SNHG-WT or SNHG6-MUT luciferase reporter vectors and miR-6509-5p were co-transfected into Hep3B cells. To confirm the direct binding of miR-6509-5p and 3’UTR of HIF1A mRNA, we constructed luciferase reporter vectors of miR-6509-5p using the same strategy. The dual-luciferase reporter assay system (E1910, Promega, American) were employed to measure the luciferase activities under the guidelines supplied by the manufacturer.
Xenograft tumorigenesis
10 male BALB/C nude mice (6 weeks) were purchased from Shanghai SLAC Laboratory Animal Co.,Ltd, Shanghai, China and then randomly divided into two groups. To construct the SNHG6 stable down-regulated Huh7 cell lines, Huh7 cells were infected with lentivirus containing si-SNHG6 and scramble sequences respectively. 5 x 106 Huh7 cells stably expressing si-SNHG6 or its scramble siRNA were injected into the nude mice subcutaneously. 10 days after the tumor inoculation, the tumor tissues were dissected and analyzed.
RNA immunoprecipitation assay
MiR-6509-5p mimics and miR-6509-5p-NC mimics were respectively transfected into Hep3B cells using Lipofectamine 3000, and the lysate of the collected cells were prepared with centrifugation. To conduct the RNA immunoprecipitation assay, anti-AGO antibodies (MA5-23515, ThemoFisher, American) were employed. And to confirm the direct binding of miR-6509-5p and SNHG6, the expression level of SNHG6 were measured using RT-quantitative PCR.
Distant metastasis assay
We injected 2 × 106 Huh7 cells with stable down-regulated SNHG6 or 2 × 106 control Huh7 cells into nude mice through the tail vein injection. 6 weeks later, we dissected the lungs of these mice, and have the lungs fixed and stained for the counting of the number of metastatic lung nodules.
Statistical analysis
All statistical analyses were performed using GraphPad 8.0 under Students’ t test, and all data were presented as mean ± SEM from 3 to 6 independent experiments. Overall survival (OS) and progression-free survival (PFS) were presented using Kaplan-Meier curves. *P < 0.05, **P < 0.01, ***P < 0.001.