Sex drives colonic mucin sialylation in wild mice

doi:10.21203/rs.3.rs-3512708/v1

Download PDF

Article

Sex drives colonic mucin sialylation in wild mice

https://doi.org/10.21203/rs.3.rs-3512708/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 23 Mar, 2024

Read the published version in Scientific Reports →

You are reading this latest preprint version

Mucin protein glycosylation is important in determining biological properties of mucus gels, which form protective barriers at mucosal surfaces of the body such as the intestine. Ecological factors including: age, sex, and diet can change mucus barrier properties by modulating mucin glycosylation. However, as our understanding stems from controlled laboratory studies in house mice, the combined influence of ecological factors on mucin glycosylation in real-world contexts remains limited. In this study, we used histological staining with ‘Alcian Blue, Periodic Acid, Schiff’s’ and ‘High-Iron diamine’ to assess the acidic nature of mucins stored within goblet cells of the intestine, in a wild mouse population (Mus musculus). Using statistical models, we identified sex as among the most influential ecological factors determining the acidity of intestinal mucin glycans in wild mice. Our data from wild mice and experiments using laboratory mice suggest estrogen signalling associates with an increase in the relative abundance of sialylated mucins. Thus, estrogen signalling may underpin sex differences observed in the colonic mucus of wild and laboratory mice. These findings highlight the significant influence of ecological parameters on mucosal barrier sites and the complementary role of wild populations in augmenting standard laboratory studies in the advancement of mucus biology.

Biological sciences/Biochemistry/Glycobiology

Biological sciences/Ecology/Molecular ecology

Biological sciences/Physiology/Reproductive biology

Mucus provides front line defence of the mucosal surfaces of the body such as the gut, lungs, and the cervix against physical, chemical or infectious insult [1]. The key structural components of the mucus barrier are gel-forming mucins [2]. These glycoproteins are extremely large polymers (2-100MDa in humans), which are extensively glycosylated (up to 80% glycan, by weight) [3]. Mucin glycans are predominantly O-linked, with chains constructed via the sequential incorporation of monosaccharide units by glycosyltransferase enzymes [4]. Diversity in glycan chains arises through alterations in the sequence and linkage of monosaccharide sugars added to the mucin polypeptide. Variations in the glycan species present on gel forming mucins have implications for the protective properties of the mucus gel, the interactions between the mucus gel and microbiota, and the signalling capacity of mucins to host cells [5]. Altered mucin glycosylation is associated with pathologies such as inflammatory bowel disease, parasite infection and allergy [6]–[9]. Given its association with disease, control of mucin glycosylation at the intestinal mucus barrier is an active area of study. For example, the incorporation of sialic acid into mucins alters the rheological properties of the mucus gel, and sulphation is associated with resistance to endoparasitic infection [7], [10].

Numerous parameters alter the profile of mucin glycans at the intestinal barrier, including: diet, sex, age, microbiome and infection [11]–[13]. However, these effects have largely been evidenced through laboratory experiments. While laboratory studies have been successful in identifying individual influences on mucin glycosylation and uncovering underlying mechanisms, they fail to capture the combined influence of multiple factors on mucin glycosylation patterns. Recent studies employing wild Mus musculus exemplify the power of an ecological approach in identifying novel immune phenotypes which stem from environmental variation [14]–[17].

The objective of this study was to investigate the primary factors influencing colonic mucin glycosylation, specifically sialylation and sulphation, in wild mice and to validate findings in controlled laboratory studies. A histological examination of colonic tissues in a wild population of Mus musculus was carried out and statistical modelling including ecological parameters was performed. Sex was identified as the primary driver of colonic goblet cell mucin glycan acidity. This observation was validated in laboratory housed C57BL/6 mice, where a significant increase in sialomucin content was observed in females compared to males. Additionally, molecular analysis of estrogen receptors and glycosyltransferase expression in wild animals revealed strong associations between the expression of Esr1 and sialyltransferase expression. These data implicate systemic sex hormone signalling as an important driver of intestinal mucus barrier properties

1. Sex is associated with acidic mucin staining in the proximal colon of wild Mus musculus.

Following capture of animals and excision of proximal colonic tissue, Alcian blue combined with Periodic acid, Schiff’s (AB+PAS) staining was carried out. This allowed visualisation of the goblet cells, and examination of the acidic nature of mucins stored within secretory granules. Alcian blue is a positively charged dye molecule which binds to and stains negatively charged sialic acid and sulphate residues on mucin glycans. PAS stains neutral glycan structures, but can also stain non-acetylated sialic acids in mucin glycans (Table 1). Importantly for this study, AB-positive but PAS-negative staining goblet cells contain predominantly acidic glycan structures (Figure 1A).

The proportion of PAS-negative staining goblet cells within the colons of 268 wild mice was highly variable, ranging from 0% to 77%, while 31.5% of mice (48 individuals) possessed no PAS-negative goblet cells (Figure 1B). Following this, model averaging using general linear models was undertaken to determine which environmental parameters were most associated with an animal’s possession of a population of PAS-negative goblet cells within the colon (parameters fully listed in Suppl. Figure 1A). Sex was reported to be the most significant predictor of PAS-negative goblet cells in the wild mouse population (full model output in Suppl. Figure 1B).

When comparing the cohort as a whole, the median percentage of goblet cells staining PAS-negative was similar between males, at 19.1% (inter quartile range (IQR): 34.4), and females, at 18.0% (IQR: 22.5) (Figure 1C). However, when the whole cohort was stratified by whether or not an individual possessed any PAS-negative goblet cells, a significantly greater proportion of female mice were seen to possess PAS-negative colonic goblet cells than male mice, a finding consistent across both 2018 (Figure 1H) and 2019 (Figure 1I). This suggests acidic glycan modifications are more widespread in the colonic goblet cells of wild female mice compared to male mice.

To further understand the differences in mucin-glycosylation between male and female mice, High-Iron diamine (HID) staining was performed to determine if the variation in the percentage of PAS-negative goblet cells was due to alterations in the sulphate or sialic acid content of mucin glycans. The HID procedure allows the visualisation of sulphate structures specifically, and when counterstained with Alcian blue, indicates sulphomucin-containing goblet cells (staining black), and goblet cells containing exclusively sialomucins (light blue staining) (Figure 1D).

The percentage of HID-positive goblet cells/crypt varied between individual mice in the wild population, with the median percentage of HID-positive goblet cells per crypt being 22.6% (IQR: 23.8) (Figure 1E). The proportion of PAS-negative and HID-positive goblet cells correlated significantly, but with a weak coefficient (R = 0.25) (Figure 1G). This suggests that although increased mucin sulphation may contribute to an increased prevalence of PAS-negative goblet cells, it may not be the major determinant. From this we conclude that increased sialylation of mucin glycans is the major change in glycosylation giving rise to increased population of PAS-negative staining goblet cells.

2. In laboratory C57BL/6 mice, sulphation of colonic mucins is associated with the estrus cycle of female mice, but colonic mucin sialylation underpins the difference between males and females.

Following the observation that sex associates with the proportion of sialomucin-containing goblet cells in wild mice, this was validated in laboratory-housed C57BL/6 mice. Goblet cells in the proximal colons of naive male and female C57BL/6 mice were examined using AB+PAS and HID staining. Differences between male and female laboratory mice were more pronounced than among wild mice, though variation within both sexes was reduced. Male mice presented with no PAS-negative stained goblet cells, whereas in female mice a median of 36.9% (IQR: 10.5) of goblet cells stained PAS-negative (Figure 2A). The extent of mucin sulphation as assessed by HID staining appeared similar among male (median = 3.4% ) and female mice (median = 4.6%) (Figure 2B). This supports our observation from wild mice that mucin sialylation underpins the differences in PAS-negative goblet cell incidence observed between male and female mice.

Next, we explored the role of systemic sex hormone signalling in relation to the observed sex-dependent differences of the colonic goblet cell staining among wild and laboratory mice. Female C57BL/6 mice were staged via histology of vaginal tissue [18] (Suppl. Figure 2), and after staging colonic tissue histology performed to characterise the acidic nature of the mucins within goblet cells. Quantifying the percentage of PAS- negative goblet cells did not reveal any differences between estrus cycles stages (Figure 2C). However, HID staining revealed a cyclical relationship between the extent of mucin sulphation within colonic goblet cells with respect to the estrus cycle stage of female mice, ranging from a median of 3.3% in the estrus stage, to 11.2% in the diestrus stage (Figure 2D).

3. An estrogenic diet is able to induce changes in the sulphation of goblet cell mucins.

In the wild mouse study, sunflower seeds were used to bait traps, resulting in a short (<12hr) availability of a novel, phytoestrogen-rich diet. Sunflower seeds contain phytoestrogens which can influence sex hormone signalling in mammals [19]. In order to assess the influence of sunflower seeds upon colonic mucin glycosylation, male C57BL/6 were fed on sunflower seeds for a period of 12 hours, 36 hours or 2 weeks.

No change in the percentage of PAS-negative goblet cells per crypt was seen at 12 hours, although the median percentage of HID-positive goblet cells increased from 1.5% to 14.5% at this timepoint. Further changes in mucin glycosylation were apparent by 2 weeks, with male mice displaying populations of PAS-negative goblet cells as high as 20% in some cases (Figure 2E). Additionally, an increase in mucin sulphation was observed with 100% of goblet cells containing HID-positive mucins in 3 of the 4 mice at the 2 week time point (Figure 2F).

4. Esr1 expression associates with the expression of sialyltransferase enzymes.

Transcriptomic analysis was carried out to identify what differential signalling events may be occurring in mice with varying degrees of mucin sialylation in the proximal colon. Twenty-four wild mice were selected for bulk RNA-sequencing analysis of colonic tissue, based upon the results of AB+PAS staining in the colon, which reflects changes in sialic acid and sulphate species within the mucin glycans. Mice were selected with the aim of encompassing a normal distribution of staining ‘profiles’ (Figure 3A). Sex, month and location were all controlled for within the 24 mice. Using IPA pathway analysis of the top 1000 most variable genes with respect to colour score, an index of AB+PAS staining. Esr1 activation was identified as the strongest predicted regulator of changes in gene expression (Figure 3B).

RNA sequencing confirmed that Esr1 was expressed in the colonic tissue of mice, while Esr2 was not, as observed in previous publications [19], [20] (Figure 3C). The expression of other sex-hormone receptors (Esr2, Pgr, Ar) was examined in the RNA sequencing dataset, and were not detected in proximal colonic tissue. Given that Esr1 was linked to PAS-negative goblet cell staining via RNA sequencing analysis, qPCR analysis of proximal colon tissue in the 2019 cohort was conducted to determine if mice possessing greater relative proportions of colonic sialomucins had increased expression of Esr1 (Suppl. Figure 3). However, levels of Esr1 expression had no association with PAS-negative goblet cell staining (Figure 3D). Female wild mice also exhibited no significant difference in the relative expression of Esr1 compared to male wild mice (Figure 3E).

Sialyltransferase enzymes catalyse the transfer of sialic acid from CMP-sialic acid to glycan structures [21]. In the context of mucin O-glycans, common substrates for the sialyltransferase enzymes are N-acetylgalactosamine (typically favoured by the St6GalNAc family), and galactose (favoured by the St3Gal family) [22]. The sialyltransferase genes St3gal1, St3gal2, St3gal3, St6galNAc1, St6galNAc2 and St6galNAc4 are all known to be expressed in the mouse colon, therefore the expression of those sialyltransferases was examined via qPCR. Interestingly, all sialyltransferase enzymes examined demonstrated a strong positive association with the expression of Esr1 (Suppl. Figure 4).

Finally, given the multi-variate environment within which the wild mice live and the many host-intrinsic and extrinsic variables at play, we asked whether certain variables could explain the variation in sialyltransferase enzyme expression via a redundancy analysis. The choice of variables used was informed by the ecological factors found to be most influential on goblet cell staining from general linear models (Suppl. Figure 1F) as well as Esr 1 expression, diet and age. Esr1 expression was the most highly significant factor (p = 0.001) in describing changes in the expression of sialyltransferases and associated with a general increase in the expression of all the sialyltransferase enzymes quantified (Figure 4, full output in Suppl. Figure 4). The age of mice was also approaching significance (p=0.07) (Suppl. Figure 4 D), and was particularly associated with the expression of St6galNAc1 (Figure 4).

This study investigated differences in colonic goblet cells within a population of wild house mice, focusing specifically on the acidic glycan content of mucin-containing goblet cells. By combining histology and ecological information through linear regression models, sex was identified as a strong influencer of mucin glycosylation. Consistently across two years, a higher proportion of wild female mice displayed sialomucin-containing goblet cells than wild male mice. Interestingly, under highly controlled conditions in laboratory mice, the sex differences were even more pronounced, with female C57BL/6 mice having significantly more goblet cells containing predominantly-acidic mucins than their age matched male equivalents. As in wild mice, the absence of sex differences in HID-staining of colonic goblet cells infers differences in acidity due primarily to sialomucins rather than sulphomucins. Furthermore, our results clearly demonstrate a high heterogeneity in the relative abundance of acidic and neutral glycan content within the colonic mucins of a wild mouse population. This heterogeneity within sexes is not reflected in laboratory C57BL/6 mice.

The more pronounced sex-dependent changes in the acidic glycans in colonic goblet cells observed in laboratory mice compared to wild mice may arise due to the more highly controlled environmental parameters in the laboratory setting, where the effects of sex could be analysed in the absence of other factors such as age and diet. Importantly however, in the multivariate environment in which the wild mice live, significant sex dependent differences in acidic glycan were still apparent. Based on our laboratory experiments and molecular analysis we developed the hypothesis that estrogen signalling modulates mucin sialylation. If estrogen signalling indeed underlies the relationship between sex and goblet cell staining, wild male mice may be encountering more sources of exogenous estrogen (e.g., through diet) than the laboratory housed males resulting in staining characteristics more similar to female mice. Nonetheless, our study on wild mice demonstrates that whilst the influence of sex may be less pronounced than observed in the laboratory, there is still a quantifiable and reproducible difference in the characteristics of colonic mucin glycans between male and female mice.

Thus far, the effects of estrogen on mucus barriers have primarily focused on reproductive tissues. One study identified positive associations between estrogen and sialomucins, as well as between progesterone and sulphomucins, in the mucus produced by human endocervical cells [23]. The physical properties of the cervical mucus barrier in mammals are known to change during the estrus cycle [24], and it is possible that cyclical changes in the glycosylation of mucins at reproductive tissues modulates these physical characteristics of the mucus barrier [25]. Furthermore, mucin sialylation in the colon has been shown to be an important mediator of host-commensal homeostasis, with ST6-family enzyme mutations being linked to inflammatory bowel disease in patients and mouse models [26].

Experiments were performed using laboratory models to further explore the association between sex and mucin glycosylation. To investigate the role of systemic sex hormones, the stage of the estrus cycle in female mice was determined. A cyclical increase in colonic mucin sulphation was observed, peaking at the diestrus stage of the cycle. Additionally, male mice fed with an estrogenic diet exhibited an induction in acidic glycosylation of colonic mucins, suggestive of the effects of phytoestrogens on the glycosylation of colonic mucins [27]. Importantly, length of exposure to sunflower seeds in traps on the Isle of May (< 12 hours), was not sufficient to drive significant changes in sulphation or sialylation, with significant changes only apparent at the latter two time points of 48hrs and 2 weeks. It should also be noted that changes in the mucus barrier arising from altered diet are not necessarily or wholly driven by phytoestrogens. Changes in diet have been reported to have effects upon the glycosylation of mucins, independently of hormonal changes [28]. Furthermore, diet-induced changes in the microbiome also have the potential to influence mucin glycosylation [29],[30], and these aspects were not controlled for in our experiments. Together, these in vivo experiments suggest mucin sialylation is the most important aspect of the sex dependent differences of mucin glycosylation of laboratory animals, and also that mucin sulphation may be associated with systemic sex hormone signalling in male and female mice.

Unbiased molecular analysis of wild animal tissue identified Esr1 as an upstream regulator of alterations in gene expression associated with different histological staining in wild mice. Further molecular analysis was focused upon the expression of sialyltransferase enzymes, revealing a robust association between the expression of Esr1 and sialyltransferase enzymes in wild mice. No significant differences observed in the colonic expression of Esr1, which indicates that putative differences in Esr1 signalling are not mediated by alterations in the transcription of the Esr1 gene product. They may instead be controlled either at the protein level or through differences in Esr1 receptor activation. Future studies would benefit from the examination of either the levels of circulating estrogen in subjects, or the activation of downstream markers of estrogen signalling to provide a more rigorous examination of the hypothesis that acidic mucin glycosylation is increased in response to estrogenic signalling. Furthermore, ecological parameters beyond sex, such as age, may also contribute to the sialylation of mucin glycans.

Alterations in protein glycosylation are implicated in a number of pathological processes. For instance, respiratory viruses such as influenza and coronavirus often bind to sialic acid structures on epithelial cells before invading them [31]. Sex mediated differences in sialic acid expression are proposed to be one mechanism contributing to the increased morbidity and mortality of males during the Covid-19 pandemic [32]. Thus, understanding the drivers of glycosylation in multi-variate environments is an urgent need.

As far as we are aware, we present the first detailed study characterising the colonic mucus barrier, a site naturally important in pathogen defence, in wild house mice. Previous studies have used semi-wild systems where genetically identical laboratory mice have been released into uncontrolled environments [13], or presented only brief observations [33]. In these studies, no differences were observed in the penetrability or production-rate of colonic mucus in feralised laboratory mice compared to conventionally raised laboratory animals, though increased expression of mucus-barrier associated proteins was observed [13]. Our study illustrates the importance of considering the holistic influence of an animal’s ecological niche, and that elucidating the effects of single parameters on mucus barriers in complex populations benefits from robust ecological study design.

In conclusion, through the use of a wild population of Mus musculus and subsequent corroboration in laboratory-housed C57BL/6 mice we show that in a multivariate environment sex is an important determinant of colonic mucin glycosylation. Histological and molecular analysis of the wild mouse population indicated that sex dependent differences in colonic mucin glycosylation among the wild population were at least partly mediated by an association between Esr1 signalling and mucin sialylation. Furthermore, in vivo experiments highlighted variations in colonic mucin sulphation during the estrus, cycle and in response to dietary-estrogen intervention.

Wild mice

Wild Mus musculus were live-trapped on the Isle of May (56.18˚N 2.55˚W). Trapping occurred between November and December of 2018 at 3 trapping grids, and between September and December of 2019 at 2 trapping grids. Trapping grids of 96 Longworth traps were arranged in a 6x16 grid, with traps 8–10 metres apart. Traps were baited with sunflower seeds and contained Sizzle nesting material (Datesand, CS1A09), as described in Mair, et al. 2021 [17].

Laboratory mice

Inbred male C57BL/6 mice (Envigo, UK) aged 6–8 weeks, were housed within the University of Manchester’s Biological Science Facility. Mice were kept in individually ventilated cages under a 12 hour light/ dark cycle at 22 ± 1˚C and 65% humidity. Unless otherwise stated, animals were fed on a standard chow diet; food and water were provided ad libitum.

Home office licencing

All experiments were performed on laboratory and wild mice were done in accordance with the UK Animals (Scientific Procedures) Act (1986); the work on laboratory mice was approved by the University of Manchester Local Animal Welfare and Ethical Review Body. The wild mouse study was approved by the University of Nottingham Animal Welfare and Ethical Review Body, and in accordance with the ARRIVE guidelines.

Alcian blue and PAS (AB + PAS) staining

Methacarn-fixed tissues were dehydrated and paraffin-embedded according to standard protocols [34]. Specimens were cut to produce 5µm sections prior to histological staining.

Sections were dewaxed in citroclear, followed by rehydration down an ethanol gradient (100%-50%), to ddH₂O. Slides were incubated in Alcian blue (3% glacial acetic acid, 1% 8GX Alcian blue at pH2.5) for 5 minutes, washed, and then incubated in 1% periodic acid for 5 minutes. Slides were washed again prior to incubation in Schiff’s reagent (Sigma-Aldrich, S5133) for 10 minutes. After staining with Schiff’s reagent, slides were developed in ddH₂O for 10 minutes, then counterstained with Mayer’s Haemotoxilyn (Sigma-Aldrich, MHS32) for 10 seconds. Finally, slides were washed, dehydrated using an ethanol gradient (50%-100%), then cleared in citroclear and coverslipped (using DPX mounting medium (Thermo Fisher Scientific, D/5319/05)) [35].

An index of goblet cell staining, termed colour score was used during the selection of animals for RNA sequencing. Colour score was derived using the following formula:

Colour score = (% of GCs that stain Light blue)-(% of GCs that stain magenta).

High-Iron diamine (HID) staining

As described for AB + PAS staining, sections were dewaxed and rehydrated. Slides were washed in PBS and incubated in the dark for 18 hours with HID solution (0.24% N,N,dimethyl-m-phenylenediamine (Sigma 219223), 0.04% N,N, dimethyl-p-phenylenediamine (Sigma 193992), 1.68% Iron (III) chloride (sigma 157740)). Slides were then incubated for 5 minutes in 1% Alcian blue, washed in PBS, dehydrated through an alcohol gradient, cleared with citroclear and coverslips mounted using DPX [36].

Determining Estrus cycle stage of mice

Vaginal tissue was excised from female mice at the point of culling. Following the Methacarn fixation and AB + PAS staining, vaginal tissue allowed assessment of estrus cycle stage [18] (Suppl. Figure 2). Briefly, the presence of mucin containing cells within the epithelium indicated proestrus phase (Suppl. Figure 2A), shedding of the stratum corneum indicated estrus phase (Suppl. Figure 2B), leukocyte infiltration indicated metestrus phase (Suppl. Figure 2C), and a thin stratum corneum without mucin producing cells indicated the diestrus phase (Suppl. Figure 2D).

RNA extraction and qPCR.

Following excision, colonic tissue was stored in 1mL of phenol reagent, and immediately frozen with dry ice before being stored at -80˚ C RNA was extracted using standard precipitation protocols using chloroform and isopropanol. Following this cDNA was synthesised from extracted RNA using Tetro cDNA synthesis kit, and primers listed in table 2 used for qPCR quantification of genes.

RNA-sequencing analysis

RNA sequencing was performed and analysed by the Genomic Technologies core facility at the University of Manchester. A notebook containing the scripts used for analysis is provided in https://figshare.manchester.ac.uk/collections/6326849.

General statistical analyses

All data analyses were carried out using R version 4.3.0. Relevant statistical tests are described in the results section and figure legends.

General linear modelling

Logistic regression was used for predicting binary outcomes (I.e., presence or absence of PAS-negative goblet cells following AB + PAS staining) from a set of continuous predictor variables. This was performed using the glm base R function.

Redundancy analysis

Redundancy analyses were performed using the vegan package in Rstudio. Redundancy analyses was visualised using ordination plots generated with the ggord package. Values further than 1.5*IQR from the median were excluded as outliers. R² is determined using the following formula[37]:

$${R}^{2}= \frac{{SS}_{regression}}{{SS}_{total}}$$

Data availability:

The dataset analysed during this study is available from the Biostudies ArrayExpress repository https://www.ebi.ac.uk/biostudies/arrayexpress/studies/E-MTAB-13517?key=0e70be5c-d0ea-43a6-a3b6-92aa0e8ee5eb (accession number: E-MTAB-13517).

Acknowledgements

We would like to thank Nature Scotland for permission to carry out work on the Isle of May; David 631 Steel (Nature Scotland), Bex Outram (Nature Scotland) and Mark Newell (Centre for Ecology and 632 Hydrology) for support with fieldwork; and our many fieldwork volunteers. We thank the University of Genomic Technologies Core Facility and Histology core facility for their technical support.

Author contributions:

DJT, KJE and JEB conceived the project and should be considered joint last authors. IM, KJE, DJT and AB designed laboratory experiments. AW and JEB designed the fieldwork. AW, AL and IM organized the fieldwork. IM, AW, AL, JEB, KJE, AB, AM, HS and JF collected field data and LL assisted in the archiving of wild-mouse samples. AB performed laboratory experiments and analysed the data. IM, KJE and DJT interpreted the data. AB led the writing of the paper, with significant feedback and contribution from KJE, IM and DJT. All authors reviewed the manuscript.

Funding information:

This work was supported by the Biotechnology and Biological Sciences Research Council awarded to JEB and KJE (grant number BB/P018157/1). AB was supported by a Biotechnology and Biological Sciences Research Council Doctoral Training Partnership PhD stduentship. RNA sequencing was supported by the Helen Muir fund (Wellcome Trust Centre for Cell Matrix Research).

Additional Information:

The authors declare no conflict of interest.

M. T. Lopez-Vidriero, “Mucus as a natural barrier.,” Respiration, vol. 55 Suppl 1, pp. 28–32, 1989, doi: 10.1159/000195748.
D. Fass and D. J. Thornton, “Mucin networks: Dynamic structural assemblies controlling mucus function.,” Curr Opin Struct Biol, vol. 79, p. 102524, Feb. 2023, doi: 10.1016/j.sbi.2022.102524.
A. Allen, D. A. Hutton, and J. P. Pearson, “The MUC2 gene product: a human intestinal mucin,” Int J Biochem Cell Biol, vol. 30, pp. 797–801, 1998.
E. P. Bennett, U. Mandel, H. Clausen, T. A. Gerken, T. A. Fritz, and L. A. Tabak, “Control of mucin-type O-glycosylation: A classification of the polypeptide GalNAc-transferase gene family,” Glycobiology, vol. 22, no. 6, pp. 736–756, 2012, doi: 10.1093/glycob/cwr182.
Y. Yao et al., “Mucus sialylation determines intestinal host-commensal homeostasis.,” Cell, vol. 185, no. 7, pp. 1172-1188.e28, Mar. 2022, doi: 10.1016/j.cell.2022.02.013.
C. Sharpe, D. J. Thornton, and R. K. Grencis, “A sticky end for gastrointestinal helminths; the role of the mucus barrier.,” Parasite Immunol, vol. 40, no. 4, p. e12517, Apr. 2018, doi: 10.1111/pim.12517.
S. Z. Hasnain et al., “Immune-driven alterations in mucin sulphation is an important mediator of Trichuris muris helminth expulsion,” PLoS Pathog, vol. 13, no. 2, pp. 1–20, 2017, doi: 10.1371/journal.ppat.1006218.
J. Martel, S. Chang, Y. Ko, T. Hwang, J. D. Young, and D. M. Ojcius, “Endocrinology & Metabolism Gut barrier disruption and chronic disease,” Trends in Endocrinology & Metabolism, vol. 33, no. 4, pp. 247–265, 2022, doi: 10.1016/j.tem.2022.01.002.
A. Parrish, M. Boudaud, A. Kuehn, M. Ollert, and M. S. Desai, “Intestinal mucus barrier: a missing piece of the puzzle in food allergy.,” Trends Mol Med, vol. 28, no. 1, pp. 36–50, Jan. 2022, doi: 10.1016/j.molmed.2021.10.004.
M. Guslandi, “Sialic acid and mucus rheology,” Clinica Chimica Acta, vol. 117, no. 1, pp. 3–5, 1981, doi: 10.1016/0009-8981(81)90003-6.
M. Mastrodonato, D. Mentino, P. Portincasa, G. Calamita, G. E. Liquori, and D. Ferri, “High-fat diet alters the oligosaccharide chains of colon mucins in mice.,” Histochem Cell Biol, vol. 142, no. 4, pp. 449–459, Oct. 2014, doi: 10.1007/s00418-014-1221-2.
L. Huang et al., “Elevated miR-124-3p in the aging colon disrupts mucus barrier and increases susceptibility to colitis by targeting T-synthase,” Aging Cell, vol. 19, no. 11, pp. 1–14, 2020, doi: 10.1111/acel.13252.
H. Arnesen et al., “Microbial experience through housing in a farmyard-type environment alters intestinal barrier properties in mouse colons,” Sci Rep, vol. 13, no. 1, Dec. 2023, doi: 10.1038/s41598-023-40640-5.
S. Abolins et al., “The ecology of immune state in a wild mammal, Mus musculus domesticus,” PLoS Biol, vol. 16, no. 4, pp. 1–24, 2018, doi: 10.1371/journal.pbio.2003538.
S. Abolins et al., “The comparative immunology of wild and laboratory mice, Mus musculus domesticus.,” Nat Commun, vol. 8, no. May, p. 14811, 2017, doi: 10.1038/ncomms14811.
A. Muir et al., “The wild mouse bone marrow has a unique myeloid and lymphoid composition and phenotype,” Discovery Immunology, vol. 2, no. 1, Jan. 2023, doi: 10.1093/discim/kyad005.
I. Mair et al., “A lesson from the wild: The natural state of eosinophils is Ly6Ghi,” Immunology, vol. 164, no. 4, pp. 766–776, 2021, doi: 10.1111/imm.13413.
F. R. Westwood, “The Female Rat Reproductive Cycle: A Practical Histological Guide to Staging,” Toxicologic Pathology, vol. 36, no. 3. pp. 375–384, 2008. doi: 10.1177/0192623308315665.
S. Alexander V., “Phytoestrogens and their effects,” European Journal of Pharmacology, vol. 741. Elsevier, pp. 230–236, Aug. 23, 2014. doi: 10.1016/j.ejphar.2014.07.057.
G. Thangavelu, M. G. Colazo, M. K. Dyck, E. K. Okine, and J. Ambrose, “Fecal and Urinary Lignans, Intrafollicular Estradiol, and Endometrial Receptors in Lactating Dairy Cows Fed Diets Supplemented with Hydrogenated Animal Fat, Flaxseed or Sunflower Seed,” 2008.
A. K. Datta and J. C. Paulson, “The sialyltransferase ‘sialylmotif’ participates in binding the donor substrate CMP-NeuAc.,” J Biol Chem, vol. 270, no. 4, pp. 1497–1500, Jan. 1995, doi: 10.1074/jbc.270.4.1497.
S. Takashima, “Characterization of mouse sialyltransferase genes: Their evolution and diversity,” Biosci Biotechnol Biochem, vol. 72, no. 5, pp. 1155–1167, 2008, doi: 10.1271/bbb.80025.
E. Gaton, L. Zejdel, D. Bernstein, M. Glezerman, B. Czernobilsky, and V. Insler, “The effect of estrogen and gestagen on the mucus production of human endocervical cells: a histochemical study.,” Fertil Steril, vol. 38, no. 5, pp. 580–585, Nov. 1982, doi: 10.1016/s0015-0282(16)46638-0.
T. Tsiligianni et al., “Association between physical properties of cervical mucus and ovulation rate in superovulated cows,” Canadian Journal of Veterinary Research, vol. 75, no. 4, 2011.
F. A. Meyer, M. King, and R. A. Gelman, “ON THE ROLE OF SIALIC ACID IN THE RHEOLOGICAL PROPERTIES OF MUCUS,” 1975.
Y. Yao et al., “Mucus sialylation determines intestinal host-commensal homeostasis,” Cell, vol. 185, no. 7, pp. 1172-1188.e28, Mar. 2022, doi: 10.1016/j.cell.2022.02.013.
N. Du et al., “Phytoestrogens protect joints in collagen induced arthritis by increasing IgG glycosylation and reducing osteoclast activation,” Int Immunopharmacol, vol. 83, Jun. 2020, doi: 10.1016/j.intimp.2020.106387.
B. O. Schroeder et al., “Bifidobacteria or Fiber Protects against Diet-Induced Microbiota-Mediated Colonic Mucus Deterioration.,” Cell Host Microbe, vol. 23, no. 1, pp. 27-40.e7, Jan. 2018, doi: 10.1016/j.chom.2017.11.004.
A. Cardilli et al., “Impact of High Salt-Intake on a Natural Gut Ecosystem in Wildling Mice,” Nutrients, vol. 15, no. 7, Apr. 2023, doi: 10.3390/nu15071565.
M. S. Desai et al., “A Dietary Fiber-Deprived Gut Microbiota Degrades the Colonic Mucus Barrier and Enhances Pathogen Susceptibility.,” Cell, vol. 167, no. 5, pp. 1339-1353.e21, Nov. 2016, doi: 10.1016/j.cell.2016.10.043.
L. Nguyen et al., “Sialic acid-containing glycolipids mediate binding and viral entry of SARS-CoV-2,” Nat Chem Biol, vol. 18, no. 1, pp. 81–90, Jan. 2022, doi: 10.1038/s41589-021-00924-1.
M. Chatterjee, J. P. M. van Putten, and K. Strijbis, “Defensive Properties of Mucin Glycoproteins during Respiratory Infections-Relevance for SARS-CoV-2.,” mBio, vol. 11, no. 6, Nov. 2020, doi: 10.1128/mBio.02374-20.
H. E. Jakobsson et al., “The composition of the gut microbiota shapes the colon mucus barrier,” EMBO Rep, vol. 16, no. 2, pp. 164–177, Feb. 2015, doi: 10.15252/embr.201439263.
Holde Puchtler, F. Sweat Waldrop, S. N. Meloan, M. S. Terry, and H. M. Conner, “Methacarn (Methanol-Carnoy) Fixation Practical and Theoretical Considerations,” 1970.
H. R. Wabinga, “Mucin secretion by gastric carcinoma cells: PAS alcian blue stain study.,” East Afr Med J, vol. 73, no. 5 Suppl, pp. S19-20, May 1996.
H. Munakata, M. Isemura, and Z. Yosizawa, “An Application of the High-Iron Diamine Staining for Detection of Sulfated Glycoproteins (Glycopeptides) in Electrophoresis on Cellulose Acetate Membrane,” Tohoku J Exp Med, vol. 145, no. 3, pp. 251–257, 1985, doi: 10.1620/tjem.145.251.
A. F. Zuur, E. N. Ieno, and G. M. Smith, Statistics for Biology and Health: Analysing Ecological Data. 2007. doi: https://doi.org/10.1007/978-0-387-45972-1.

Stain	Alcian blue (AB)	Periodic acid Schiff’s (PAS)	Alcian blue + Periodic acid and Schiff’s (AB+PAS)	High-Iron diamine (HID)
Substrate	Binds to negatively charged sialic and sulphate residues.	Binds vicinal diols on neutral glycan structures and non-acetylated sialic acid.	Stains acidic and neutral glycans	Positively charged ammonium salts bind to negatively charged sulphate residues.
Colour	Light blue	Magenta	Dark blue	Black

Table 1: Chemical histological stains used in the analyses

Gene	(5’-) Forward sequence (-3’)	(5’-) Reverse sequence (-3’)
Βeta-actin	GGCTGTATTCCCCTCCATCG	CCAGTTGGTAACAATGCCATGT
Rpl13a	GGGCAGGTTCTGGTATTGGAT	GGCTCGGAAATGGTAGGGG
Esr1	CCCGCCTTCTACAGGTCTAAT	CTTTCTCGTTACTGCTGGACAG
St3Gal1	CCACAACGCTCTGATGGAGG	AACAGTTCCTTGACGGTGTCG
St3Gal2	CTGCTCTTCACCTACTCGCAC	GCTGTAGTCCTGAATAGCCTGG
St3Gal3	AAGCTGGACTCTAAACTGCCT	TGCTGGCTTGGAGAACCTG
St6GalNAc1	ATGGAAGAATGACGCAAGTGC	AACTGACAGAGGTTGTCTCCT
St6GalNAc2	CCTCATGCTGTACTCCTCGG	CTCGTGGGTACGCCATGTT
St6GalNAc4	AGCCTCTTATCCGAGAACTGT	GGCCTGAACCCAGCATCTG

Table 2: qPCR primer sequences used for analysis of selected gene expression of mouse tissue

No competing interests reported.

Supplementaryinformation.pdf

Download PDF

Journal Publication

published 23 Mar, 2024

Read the published version in Scientific Reports →

Editorial decision: Revision requested
06 Jan, 2024
Reviews received at journal
29 Dec, 2023
Reviewers agreed at journal
21 Dec, 2023
Reviews received at journal
13 Nov, 2023
Reviewers agreed at journal
13 Nov, 2023
Reviewers agreed at journal
11 Nov, 2023
Reviewers invited by journal
10 Nov, 2023
Editor assigned by journal
10 Nov, 2023
Editor invited by journal
07 Nov, 2023
Submission checks completed at journal
07 Nov, 2023
First submitted to journal
30 Oct, 2023

You are reading this latest preprint version

Sex drives colonic mucin sialylation in wild mice

Status:

Journal Publication

Version 1

Abstract

Figures

Introduction

Results

Discussion

Methods

Wild mice

Laboratory mice

Home office licencing

Alcian blue and PAS (AB + PAS) staining

High-Iron diamine (HID) staining

Determining Estrus cycle stage of mice

RNA-sequencing analysis

General statistical analyses

General linear modelling

Redundancy analysis

Declarations

Data availability:

References

Tables

Additional Declarations

Supplementary Files

Status:

Journal Publication

Version 1