Copula lucentia sp. nov., a new box jellyfish (Cnidaria: Cubozoa: Carybdeida) from Western Mediterranean Sea

doi:10.21203/rs.3.rs-3556367/v1

Download PDF

Research Article

Copula lucentia sp. nov., a new box jellyfish (Cnidaria: Cubozoa: Carybdeida) from Western Mediterranean Sea

https://doi.org/10.21203/rs.3.rs-3556367/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 20 Aug, 2024

Read the published version in Marine Biodiversity →

You are reading this latest preprint version

A new species of box jellyfish, Copula lucentia sp. nov., is described from El Campello, Alicante, Spain and compared to the holotype of Copula sivickisi that was successfully recovered after being lost for almost 60 years. So far, the only cubozoan species recorded in the Western Mediterranean was Carybdea marsupialis. The genus Copula just included the type species (Copula sivickisi) reported from different temperate, tropical and subtropical localities in the Pacific, Atlantic and Indian Oceans. Morphologically, this new species possesses the typical characteristics of the genus Copula (four adhesive pads on the apex and a vertical keyhole-shaped rhopalial niche ostium) but it can be differentiated from the C. sivickisi holotype by the velarial canal pattern. In C. lucentia the velarial canal roots taper towards the velarial rim and each root bears 1–2 narrow triangular canals with sharp tips, resembling a bird-beak. In contrast, the velarial canal roots of C. sivickisi bear 2 short, broad canals that increase breadth towards the velerial rim and split up into 3 to 6 lobed, finger-like canals with rounded tips, giving the canal pattern a paw-like appearance. Molecular analyses of mitochondrial cytochrome c oxidase subunit I (COI) and nuclear 16S ribosomal DNA genes show that there are even more Copula species than expected, but which will not be focused on here. This study highlights not only that there are species yet to be discovered in the Mediterranean Sea, one of the most studied seas worldwide, but that a revision of the genus Copula is necessary.

Tripedaliidae

taxonomy

morphology

new species

ecology.

Cubozoa, also known as Cubomedusae or box jellyfish, is the smallest cnidarian class with approximately 50 currently accepted species, half of them described in the past two decades (Collins & Jarms, 2022). Distinctive by their cube-shaped bell, they possess unique attributes such as complex lens eyes (Coates 2003, Nilsson et al. 2005, O’Connor et al. 2009), ability to swim actively and horizontally against currents that defines them as nekton and not as plankton which drifts passively (Haeckel 1890, Gordon & Seymour 2009, Garm et al. 2007, Colin et al. 2013, Schlaefer et al. 2020, Bordehore et al. 2022), complex mating behavior (Lewis & Long 2005, Lewis et al. 2008), associative learning (Bielecki et al. 2023), and powerful venoms (Kintner et al. 2005, Yanagihara et al. 2012, Jouiaei et al. 2015) that can even result in fatalities (Fenner & Hadok 2002, Tibballs 2006, Carrete & Seymour, 2013, Sucharitakul et al. 2017). Because of these fascinating traits, box jellyfishes garner a great deal of attention from both the scientific community and the general public.

Among this class, the genus Copula was recently introduced by Bentlage and others after a comprehensive phylogenetic analysis (Bentlage et al. 2010) and included hitherto a single valid species, Copula sivickisi (Stiasny, 1926). So far, it has been reported from Thailand (Stiasny 1922), Philippines (Stiasny 1926), Vietnam (Kramp, 1962), New Zealand (Hoverd, 1985), Japan mainland and Okinawa (Uchida 1929, 1970, Lewis & Long 2005, Garm et al. 2012, Morandini et al. 2014, Straehler-Pohl et al. 2014, Toshino et al. 2014), Hawaii (Matsumoto 2002, Crow 2006), Guam (Gershwin 2003), Bahamas (Bennett et al. 2011), and Australia and Tasmania (Hartwick 1991, Gerswhin 2005, Kingsford et al. 2012, Schlaefer et al. 2020, 2021).

Although Stiasny described one specimen from Thailand in 1922 that morphologically resembles C. sivickisi (with little differences according to him), it was not until 4 years later that he named the species based on a jellyfish he found in Mindoro, Philippines. Therefore, although found later, the official holotype of C. sivickisi is the specimen from the Philippines, which was deposited in the Natural History Museum of London. But the holotype had been on loan since 1964 and was never returned. The only hint for the search of the holotype was the name “Dr. Ralph” noted on a slip in the empty sample vessel. With the help of Miranda Lowe (Principal Curator for Crustacea and Cnidaria at the London Natural History Museum) and Alan Hoverd (former Technical Team Leader at the School of Biological Sciences of Victoria University, Wellington, New Zealand), the missing holotype was recovered after almost sixty years in a collection of Wellington University, New Zealand and returned to London in 2020. A detailed description of this curious search will be given in the review of the genus Copula underway in our laboratories.

In this study, after a morphological comparison with the recovered holotype (full description will be given in the review of the genus) and a genetic analysis along with specimens sampled from all over the world, we present the description of a new species of cubozoan, Copula lucentia sp. nov., based on specimens collected in El Campello, Alicante, Spain (Western Mediterranean Sea).

Medusae and environmental variables sampling

Copula lucentia medusae were located and sampled by using waterproof LED lights (CE RoHS IP65, 50W) at both sides of Illeta dels Banyets, El Campello (NE Spain, 38º25’56.01’’N 0º22’57.75’’W) (Fig. 1), within the SCI ESZZ16008 Espacio Marino del Cabo de les Hortes. On sampling days, two lights were mounted at dusk, 15 meters from the shoreline and 1 meter deep. When conditions were appropriate (sea surface very calm and transparent waters), first cubozoans appeared after about one hour of light exposure and during the following two hours they were gathered using plastic beakers, put into a large can with filtered seawater and transported to the Marine Laboratory UA-Dénia for initial identification.

For three consecutive years (2016-2018), from August to November, we carried out 21 nocturnal samplings. For genetic analyses we used specimens collected on 22 September 2016 and for taxonomy, on 17 October 2018. Genetic and morphological samples were preserved in 90% ethanol and 4% formalin buffered with sodium tetraborate, respectively. Holotype and paratypes are deposited in the National Museum of Natural Sciences (Museo Nacional de Ciencias Naturales). DNA samples and additional studied material are deposited in LEDALab DNA collection (UNESP-Bauru).

Environmental variables (temperature and salinity) were measured using a data logger Infinity-CT JFE Advantech. Coordinates of the sampling locations were recorded with a GPS device (Garmin 72H).

Morphological analysis

Morphology of Copula lucentia specimens was studied under a stereomicroscope (Leica S8APO). Taxonomic observations and measurements were made on preserved specimens unless otherwise indicated. Standard measurements were used (Gershwin 2005, Straehler-Pohl 2014, 2017, 2019, Acevedo 2019): bell height (BH) = measured from the apex of the bell to velarial turnover; diagonal bell width (DBW) = distance between opposite pedalia at level of pedalia joining bell; interpedial diameter (IPD) = distance between opposite pedalia (outer pedalial wing edges) at the level of the bell turn-over; pedalial length (PL) = distance from attachment to the bell to the tentacle insertion, as proportion in relation to bell height; pedalial width (PW) at the widest diagonal level, as proportion in relation to pedalial length. Photographs were taken with a digital camera Nikon D300S. Morphology of Copula sivickisi holotype was studied under a stereomicroscope (Bresser 5804000), photos were taken with digital cameras Canon EOS 550D and Bresser MikrOkular Full HD.

For nematocysts analysis, pieces of different preserved tissues (tentacles, gastric phacellae, umbrella and pedalia) were placed onto glass slides and covered with cover slips, pressing firmly. Nematocysts were examined and measured with a Leica ICC50 camera connected to a Leica DM500 microscope using LAS EZ software v. 3.4.0. Observations were made through a 40x objective (i.e. 400x magnification). Nematocyst were identified following Östman 2000 and Gershwin 2006.

Molecular analysis

Three specimens collected in September 2016 were used to obtain molecular markers (16S and COI) for comparison with specimens from other regions, especially Asiatic Pacific. The DNA was extracted with DNAdvance (magnetic beads), PCR reactions and conditions followed under predefined conditions, see Acevedo et al. (2019) for 16S and LCO1490 (GGTCAACAAATCATAAAGATATTGG) and HCO2198 (TAAACTTCAGGGTGACCAAAAAATCA) and Folmer et al. (1994) to amplify part of the COI gene (expected fragment of 670 to 804 bp) (mitochondrial markers, ribosomal and protein coding genes respectively). Amplicons were purified using AMPureH kit following manufacturer’s instructions, and made ready for sequencing using the BigDyeH Terminator v3.1 kit same primers and Tm temperature conditions as in PCR reactions). Sequencing was carried out on an ABI BRISMIH3100 genetic analyzer (Hitachi), and resulting sequences were assembled and edited using Geneious 9 (removing ambiguous base calls and primer sequences). New sequences were submitted to NCBI’s GenBank (COI - OQ857826 - OQ857828; 16S - OQ869612 - OQ869614). Evolutionary distances of mitochondrial (16S rDNA and COI) genes from Spanish Cubozoan were analyzed within other tiny Cubozoan from different areas in MEGA X (p-distance) and ML reconstruction were performed in Geneious 9 (PhyML) with bootstrap test with 100x replicates.

Systematics

Phylum Cnidaria Verrill, 1865

Subphylum Medusozoa Petersen, 1979

Class Cubozoa Werner, 1973

Order Carybdeida Gegenbaur, 1856

Family Tripedaliidae Conant, 1897

Genus Copula Bentlage, Cartwright , Yanagihara, Lewis, Richards & Collins 2010

Copula lucentia, sp. nov

Zoobank: urn:lsid:zoobank.org:act:B314438E-D3B1-484C-93BE-FA1517190B81

Tables 1-2; Fig. 2,4.

Copula lucentia Fonfría, Straehler-Pohl, Stampar & Bordehore

Type material

Holotype: Spain: National Museum of Natural Sciences (Museo Nacional de Ciencias Naturales): 1 specimen, female, (MNCN 2.02/1) (in-live: 6.1 mm BH, 6.3 mm DBW), Illeta dels Banyets, El Campello, Spain (38º25’56.01’’N 0º22’57.75’’O), coll. by E. S. Fonfria, 17 October 2018.

Paratypes: Spain: National Museum of Natural Sciences (Museo Nacional de Ciencias Naturales): 1 specimen, female, (MNCN 2.02/2)(in live: 5.0 mm BH, 5.4 mm DBW), Illeta dels Banyets, El Campello, Spain, 38º25’56.01’’N 0º22’57.75’’O coll. by ES. Fonfria, 17 October 2018; 1 specimen, female (MNCN 2.02/3)(in live: 5.5 mm BH, 5.9 mm DB), Illeta dels Banyets, El Campello, Spain, 38º25’56.01’’N 0º22’57.75’’O coll. by ES. Fonfria, 17 October 2018; 1 specimen, female (MNCN 2.02/4)(in live: 4.9 mm BH, 5.2 mm DBW), Illeta dels Banyets, El Campello, Spain, 38º25’56.01’’N 0º22’57.75’’O coll. by ES. Fonfria, 17 October 2018.

Type locality: Illeta dels Banyets, El Campello, Spain (38º25’56.01’’N, 0º22’57.75’’O) (Western Mediterranean Sea).

Etymology: The species is based on “Lucentum”, Latin name of Alicante, Spanish province where the type locality of El Campello is located.

Synonyms: none.

Diagnosis

Copula species with 4 velarial canal roots per quadrant which taper towards the velarial rim. Each root bears 1-2 unbranched, narrow and triangular velarial canals with sharp tips.

Description (from holotype and paratypes)

Bell blunt pyramidal, slightly wider than high, slightly flattened apex, rigid, highly transparent, colourless, with minute to small (0.1 mm) round white nematocyst warts scattered from apex to bell turnover (Fig. 2a-b), no size differences in small nematocyst warts on apex and rest of umbrella (Fig. 2o). Apex markedly sculptured with 4 rounded triangular to hexagonal adhesive pads (practically unnoticeable in live specimens, but clearly visible –opaque- in preserved ones) located above the four gastric phacellae (Fig. 2c-d). Bell height up to 6.3 mm and bell width up to 6.9 mm (IPD), up to 6.1 mm (DBW) in live specimens.

Pedalium, single, unbranched, flattened, blade-shaped, intermediate in length (PL:<30% BH, PW:<40 PL), located at the four interradial corners of the bell margin, with 4-6 horizontal rectangular white, round nematocysts warts to longish oval, horizontal, nematocyst bands on outer pedalial keel (Fig. 2f-g). Pedalium carrying single tentacle, round in cross-section, flaring at base, showing a striped pattern of broad whitish to yellow and very narrow orange to brown bands in live specimens (Fig. 2e). Pedalial canal with rounded knee bend without any hook or thorn appended to outer knee bend (Fig. 2f-g).

Rhopalium located inside a spherical to upside-down egg-shaped rhopalial niche cavity with a vertical key-hole shaped ostium which is closed at the base without any covering scales, ca. 5-8% BH up from bell margin. Rhopalium with 6 eyes (2 median lens eyes + 2 lateral slit eyes + 2 lateral pit eyes) and a sausage-shaped statolith. Rhopalial horns narrow and long (ca. 1/2 of niche cavity height)(Fig. 2k,m).

Velarium, narrow (<33% BH) without nematocysts warts, containing 2 velarial canal roots per octant which taper towards the velarial rim, each root bears 1 - (mostly) 2 unbranched, narrow triangular velarial canals with sharp tips. If two canals, beak-like shape: both triangular canals are separated by a narrow gap, outer canals (facing frenulum or pedalium) slightly shorter than inner canals, no additional secondary canals or branches. Absence of perradial, adradial or interradial lappets. No velarial spots observed as specimens were not mature (Fig. 2i-j). Frenulae, 4, one in each perradius, comprising a single sheet extending from the lower half of the rhopalial niche to the velarial margin (Fig. 2n).

Manubrium, four-lobed, cruciform, free of nematocysts warts. Gastric phacellae, 4, concave-shaped horizontal rows of vertically stacked, simple, short, unbranched, multiple rooted whitish to yellow gastric filaments (ca. 50 filaments per phacellum). Subgastral sacs, 8, rounded, two flanking each gastric phacellum, orange-yellow in colour (Fig. 2d-h).

Gonads, 4 pairs, hemigonads, butterfly-shaped. All specimens collected were female: single wing oblong leaf-shaped, located in the uppermost part of interradial septa, not fully developed yet (Fig. 2l).

Nematocysts: (after to Östman 2000, Gershwin 2006)

Four different nematocyst types were identified and measured in the paratype MNCN 2.02/4 (table 1); spherical holotrichous isorhizas (tentacle, exumbrellar warts and pedalium), oval beehive isorhiza (tentacle), medium-sized lemon-shaped microbasic euryteles (tentacle), tiny microbasic euryteles (gastric cirri and subgastral sacs). Manubrium lacking nematocysts.

Sexual dimorphism: No data are available yet; males have yet to sampled to assess dimorphism. However, sexual dimorphism is expected, as in other Tripedaliidae (Hartwick 1991, Lewis et al. 2008, Bentlage et al. 2010, Straehler-Pohl et al. 2014).

Mating behaviour, fertilization, polyps and asexual reproduction: No data are available yet. Only immature specimens were sampled to date.

Habitat and ecology: Copula lucentia were found in shallow waters (< 1.5 m in depth). Illeta dels Banyets is a rocky peninsula of 10000 square meters surrounded by sandy bottoms with patchy Posidonia oceanica meadows and areas covered by the green alga Caulerpa prolifera. At south it limits with the harbor of El Campello and at north it is open to a small bay. Individuals of C. lucentia have been collected at both sides of the peninsula (Fig. 1).

During the three years of nocturnal samplings between August and November, Copula lucentia individuals were collected mainly in September (154 specimens, 6 samplings) and October (368 specimens, 9 samplings), with anecdotal catches in November (2 specimens, 5 samplings) and none in August (0 specimens, 1 sampling; Fig. 3). From them, 239 jellyfish were measured. Maximum and minimum DBW and BH obtained were 6.3 and 1.2 mm, and 5.8 and 0.9 mm, respectively. Mean size was 2.5 ± 1.0 mm in DBW and 2.2 ± 0.9 mm in BH (mean ± standard deviation).

In the 3 samplings carried out in September 2016, we also found a total of 30 specimens of Carybdea marsupialis. In the following 18 samplings, however, their presence was not detected.

All the specimens were found at warmer seawater temperatures (from 22.3 ºC to 28.0 ºC), with only two individuals collected below this range; one at 21.6 ºC and other at 17.8 ºC (both in October 2017, on day 3 and 21). Salinity range was from 36.9 to 37.6.

A publication on their diet (based on the analysis of stomach contents) is under way in our laboratories.

Distribution: This species is currently known only from the type locality (Spain, Western Mediterranean Sea; Fig. 1).

Hazardousness: No stinging activity was noted during sampling and handling of C. lucentia, although envenomation cannot be completely discarded until specific studies are performed. No stinging events in the area have been attributable to this species to date.

Molecular data

Results indicate that the specimens from Mediterranean Spain belong to the genus Copula, although present differences of approximately 20% (p-distance) in relation to specimens from Japan and Australia based on COI. The sequences recovered from the 16S amplified sector are exactly the same among the samples from Spain, however, they present significant divergence in relation to the material from Australia, for example. The specimen USNM1124561 (GQ849113) from Double Island, Cairns, Australia has 57 transitions and 20 transversions in relation to the Spanish material in a 397 bp alignment.

The ML reconstruction shows a “stand-alone” pattern to the specimens of Copula from Spanish coast (Fig. 4) in both mitochondrial markers. Based on this, it can be concluded that the Mediterranean specimens found are not C. sivickisi and consequently a new species to the genus.

The genus Copula included hitherto a single valid species, C. sivikisi (Stiasny, 1926), reported across the Pacific and in the Indian and Atlantic Oceans. The species described here, therefore, is not only the first report of the genus in the Mediterranean Sea (being the second box-jellyfish species truly detected in this area after Carybdea marsupialis according to Acevedo et al. 2019) but also the northernmost distributional place for the genus Copula reported so far (Morandini et al. 2014).

Differential Diagnosis: Copula sivickisi from the Philippines vs. Copula specimens from the Spanish coast of the Mediterranean Sea (Table 2)

The genus Copula, designated by Bentlage et al. (2010), can be differentiated from all other cubozoan genera by their possession of keyhole-shaped rhopalial niche openings and adhesive pads on the exumbrellar apex with which they attach themselves to different substrates when resting (Hartwick 1991). The specimens found in NW Mediterranean Sea meet these requirements and resemble C. sivickisi in many morphological characteristics, but differ significantly in several key structures (Table 2) defined e.g. by Gershwin (2005), Straehler-Pohl et al. (2017) and Acevedo et al. (2019):

The bell shape of the Mediterranean specimens and of C. sivickisi is quite equal in shape but the Mediterranean specimens are much smaller (6.1 mm BH), about half the size of the Philippine specimens (10-13 mm BH; Stiasny 1926, present study).

The umbrellar nematocyst warts of C. sivickisi are very large, roundish, oval to biscuit-shaped while the bell nematocyst warts of the European Copula specimens are small and round.

Differences are also found in the length and shape of the rhopaliar horns originating from the top of the rhopalial niche cavity, growing vertically upwards. The ones found in C. sivickisi are outwardly curved, as long as the rhopalial niche cavity and equally wide throughout its length until its distal end (present study) while the ones in the Mediterranean specimens are curved towards each other, only half as long as the rhopalial niche cavity and are slightly flared at their distal ends.

Most obvious are the differences in the velarial canal pattern: While the canals in C. sivickisi are quite complex (canals are split into 3-6 parallel aligned secondary canals) and show a paw-like pattern (Stiasny 1926, Gershwin 2005, present study: Fig. 5i), the velarial canals in the European Copula specimens are more simple (triangular) and resemble, when 2 canals of one root are combined, a bird-beak (Fig. 5j). For more details on additional minor, morphological differences see Table 2 and Figure 5.

Based on above listed differences in morphological characters, it can be concluded that the Spanish specimens are members of the genus Copula, but they do not belong to the Philippine species Copula sivickisi, instead representing a new species, for which we provide the name Copula lucentia, sp. nov.

Molecular analysis

Molecular analysis is not possible for the type material of C. sivickisi, as the holotype and its paratype were preserved in formol. Our molecular phylogenetic analyses on Pacific specimens and C. lucentia (Fig. 4) show that there are more than two Copula species united under the name Copula sivickisi as other populations from other oceans differ from C. lucentia. Also, we can state that the divergence between the Pacific materials and the specimens reported in this study is too great to be an introduced species with accumulated mutations over isolation during the Anthropocene. Some studies (eg. Morandini et al., 2017) reported some evidence of non-recent invasions, but still during the Anthropocene. However, the molecular divergence of this kind of invasive species in relation to the putative original population is not very high, as is the case with our samples of Copula.

Biology and ecological data

Copula lucentia was found actively swimming in El Campello in autumn with temperatures between 17.8 and 28.0 ºC. These results are similar to those from Lewis & Long (2005) and Toshino et al. (2014), who collected Copula sp. specimens around Okinawa (SW Japan) when water temperature was 23-28ºC and Schlaefer et al. (2020) who sampled Copula sp. specimens in Townsville (NE Australia) with an average water temperature of 26. ºC. In the lower end of the range it also coincides with the data recorded by Hoverd (1985) in New Zealand, where Copula sp. specimens, although present all year around, were mainly observed in February when temperatures were 17-19ºC.

During three consecutive years (2016-2018) we found hundreds of C. lucentia individuals in El Campello, with a DBW and BH average size of 2.5 ± 1.0 mm and 2.2 ± 0.9 mm (mean ± SD, n=239), respectively. According to Toshino et al. (2014), polyps of supposed Japanese C. sivickisi transformed into a single medusa without leaving any regenerative remnants, and newly detached medusae were about 1.2 mm in umbrella height, growing up to 3.4 mm when they were 13 days old. If both Copula species develop similarly, and considering the small size of the specimens and the high abundance recorded, we can assume that the population is well-established in the area. However, few mature specimens were gathered during samplings, for unknown reasons. Juveniles and adults of the cubozoan C. marsupialis are also usually found in different areas some kilometers apart (Bordehore et al. 2020). In that case, the main hypothesis is that it could be related to the swimming capacity of the different medusae stages, with adults able to swim against currents and select the most favorable habitats (Bordehore et al. 2020). Schlaefer et al. 2020 demonstrated strong swimming abilities for C. sivickisi specimens with IPD (inter pedalial diameter, defined as distance between opposite pedalia –outer pedalial wing edges- at the level of the bell turn over according to Straehler-Pohl 2014) greater than 4 mm, but did not assess the swimming capability of newly metamorphosed medusae. Several authors reported that swimming performance increases with size (Shorten et al. 2005, Garm et al. 2007, Colin et al. 2013, Bordehore et al. 2020), so the smallest ones may not have the ability to swim countercurrent and would be affected by current advection. Nevertheless, a broader spatial and temporal grid sampling should be implemented to verify if this hypothesis is applicable to C. lucentia and to know its distribution throughout the year.

In the first three samplings of 2016, several specimens of C. marsupialis were found together with C. lucentia, but this did not happen again in the 18 subsequent samplings. Although it is not unusual to find different species of cubozoa co-inhabiting in the same area (e.g. C. sivickisi and Carybdea cuboides, formerly named Carybdea arborifera, according to Straehler-Phol 2020, and Alatina morandinii and Tripedalia binata, Toshino et al. 2019), the ecological implications of this presence-prolonged absence need to be studied.

No stinging activity was noted during sampling and handling of C. lucentia, although it would not be completely discarded until specific studies are performed. In Australia, C. sivickisi was reported to cause painful stings to the exposed skin of divers, with erythema and blisters persisting for hours but without systemic effects (Hartwick 1991) but, on the contrary, an accidental encounter of a small Japanese boy with dozens of specimens in Akajima, Okinawa Prefecture, Japan turned out to be harmless (Straehler-Pohl 2019, personal experience).

The record of this jellyfish is a clear indication that the Mediterranean Sea still requires studies on planktonic organisms. Taking into account that they live within a Site of Community Importance (ESZZZ16008, Espacio marino del Cabo de les Hortes) located in a sun and beach tourist municipality, further ecological and toxicological studies would be necessary to determine its role within the ecosystem and its public health implications.

Moreover, considering that many marine species consist of cryptic species, that several morphological differences between specimens of C. sivickisi from different locations have already been mentioned (Stiasny 1926, Straehler-Pohl et al. 2014) and that a recent behavioral study suggest a poor dispersal potential for this species (Schlaefer et al. 2020), a comprehensive revision for the genus Copula is required as a deeper molecular study (Fig. 4) hints to the fact that several undescribed new species are united under the name of Copula sivickisi.

Acknowledgements

We would like to thank all the students and volunteers from the UA and the Marine Laboratory UA-Dénia that collaborated on nocturnal samplings in El Campello: Lucía Portilla, Carlos De Juan, Sara Manchado, Paula Pérez, Manolo Montes, Adrián Castro, Jorge Asensi, Irene González, Raúl González, Rubén Olivares, Celina Jordá, Mónica Sais, Ana Mª Valera, Laura Piqueras, Luis Alcaraz, Mar Martínez, María Palou, Laia Ribes, Irene López, Salva Irmbernón, Inma Jiménez, Emmanuela Elena, Llum Penedes, María Nicolau, Natalia Sánchez, Jorge Martínez, Alba Fuster, Alba Benito, Esther Ivars, Javi Latorre and Miguel Escolano (who also provided assistance in pictures edition as well as Jose Carlos Galens). We are also truly indebted to Laura Pavesi (Collection Manager, Natural History Museum of Denmark), Miranda Lowe (Principal Curator, The Natural History Museum, London), Andreas Schmidt-Rhaesa (Curator, Zoological Museum and Institute, University of Hamburg), Simon Davy (Dean of Science, School of Biological Sciences - Te Kura Matauranga Koiora, Victoria University of Wellington - Te Herenga Waka of Wellington) and Mary Murray (School Administrator, School of Biological Sciences - Te Kura Matauranga Koiora, Victoria University of Wellington - Te Herenga Waka of Wellington) for their invaluable help to recover the lost holotype in the collection of Victoria University of Wellington -Te Herenga Waka of Wellington, New Zealand and return it to the collection of the Natural History Museum in London, UK. Finally, we would like to thank Dr. Verónica Fuentes (co-IP of the LIFE CUBOMED project), recently deceased, for her passion, commitment and guidance in the field of jellyfish studies. Rest In Peace, Verónica.

Funding. This study has received funding through European Commission’s LIFE programme [LIFE08 NAT ES64 CUBOMED to CB from the Alicante University, Spain], and from the D.G Sostenibilidad de la Costa y el Mar from the Spanish Ministry of Agriculture, Food and the Environment, the Fundación Biodiversidad, and the Generalitat Valenciana. It has also received support from Parques Nacionales and Ajuntament de Dénia through the Marine Laboratory UA-Dénia agreement https://web.ua.es/en/marlabdenia/ [to C.B]. We are also grateful for the collaboration of Fundació Baleària, Marina El Portet de Dénia and Marina de Dénia. Sérgio N. Stampar was supported by São Paulo Research Foundation (FAPESP) grant numbers 2019/03552-0 and 2022/16193-1 and National Council of Scientific and Technological Development (CNPq -Research Productivity Scholarship) grant number 301293/2019-8 and 304267/2022-8.

Conflict of interest. The authors declare that they have no conflict of interest.

Ethical approval. All applicable international, national and/or institutional guidelines for the care and use of animals were followed by the authors.

Sampling and field studies. All necessary permits for sampling and observational field studies have been obtained by the authors from the competent authorities and are mentioned in the acknowledgements, if applicable. The study is compliant with CBD and Nagoya protocols.

Data availability. The sequence data generated for the new species are available in GenBank repository, https://www.ncbi.nlm.nih.gov/nucleotide. Genbank accession numbers are provided in the text.

Authors’ contribution. ESF and CB carried out samplings. ESF carried out the morphometric study of the new species. ISP reviewed morphometric studies and redescribed the holotype. SNS did phylogenetic analyses. AC provided genetic sequences for molecular analysis. AH moved heaven and earth to find the missing holotype. CB obtained the funding for the research. ESF, ISP and SNS wrote the original draft. All authors reviewed and approved the manuscript.

Acevedo MJ, Straehler-Pohl I, Morandini AC, et al (2019) Revision of the genus Carybdea (Cnidaria: Cubozoa: Carybdeidae): Clarifying the identity of its type species Carybdea marsupialis. Zootaxa 4543:515–548. https://doi.org/10.11646/zootaxa.4543.4.3
Bennett C, Nicholson M, Erdman R (2011) First record of Copula sivickisi (Cnidaria: cubozoa) in the tropical Western Atlantic Ocean: an enigmatic ocurrence from San Salvador Island, Bahamas. In: The 14th Symposium on the Natural History of the Bahamas. pp 33–37
Bentlage B, Cartwright P, Yanagihara AA, et al (2010) Evolution of box jellyfish (Cnidaria: Cubozoa), a group of highly toxic invertebrates. Proc R Soc B Biol Sci 277:493–501. https://doi.org/10.1098/rspb.2009.1707
Bielecki J, Nielsen SKD, Nachman G, Garm A (2023) Associative learning in the box jellyfish Tripedalia Cystophora. Curr Biol 33 (19): 4150-4159.e5. https://doi.org/10.1016/j.cub.2023.08.056
Bordehore C, Fonfría ES, Alonso C, et al (2020) Effects of environmental variables on the distribution of juvenile cubomedusae Carybdea marsupialis in the coastal Western Mediterranean. PLoS One 15:. https://doi.org/10.1371/journal.pone.0230768
Coates MM (2003) Visual ecology and functional morphology of Cubozoa (Cnidaria). In: Integrative and Comparative Biology. pp 542–548
Colin SP, Costello JH, Katija K, et al (2013) Propulsion in Cubomedusae: Mechanisms and Utility. PLoS One 8:. https://doi.org/10.1371/journal.pone.0056393
Collins AG, Jarms G (2022) World list of Cubozoa. Accessed through: World Register of Marine Species at: https://www.marinespecies.org/aphia.php?p=taxdetails&id=135219 on 2022-02-11
Crow GL, Miroz A, Chan N, Lam K (2006) Documentation of box jellyfish Carybdea sivickisi and Carybdea rastoni (Cubozoa: Carybdeidae) at Ma’alaea Harbor, Maui. Bish Museum Occas Pap 88:55–56
Fenner PJ, Hadok JC (2002) Fatal envenomation by jellyfish causing Irukandji syndrome. Med J Aust 177:362–363. https://doi.org/10.5694/j.1326-5377.2002.tb04838.x
Folmer O, Black M, Hoeh W, et al (1994) DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Mol Mar Biol Biotechnol 3:294–299
Garm A, Bielecki J, Petie R, Nilsson DE (2012) Opposite patterns of diurnal activity in the box jellyfish Tripedalia cystophora and Copula sivickisi. Biol Bull 222:35–45. https://doi.org/10.1086/BBLv222n1p35
Garm A, O’Connor M, Parkefelt L, Nilsson D-E (2007) Visually guided obstacle avoidance in the box jellyfish Tripedalia cystophora and Chiropsella bronzie. J Exp Biol 210:3616–23. https://doi.org/10.1242/jeb.004044
Gershwin L-A (2003) Scyphozoa and cubozoa of Guam. Micronesica 35–36:156–158
Gershwin LA (2005) Taxonomy and phylogeny of Australian Cubozoa. PdD Thesis, James Cook University, Australia
Gershwin LA (2006) Nematocysts of the Cubozoa. Zootaxa 1–57
Gordon MR, Seymour JE (2009) Quantifying movement of the tropical Australian cubozoan Chironex fleckeri using acoustic telemetry. In: Hydrobiologia. pp 87–97
Haeckel E (1890) Plankton-Studien: Vergleichende Untersuchungen über die Bedeutung und Zusammensetzung der pelagischen Fauna und Flora. Jena, Gustav Fischer.
Hartwick RF (1991) Observations on the anatomy, behaviour, reproduction and life cycle of the cubozoan Carybdea sivickisi. Hydrobiologia 216–217:171–179. https://doi.org/10.1007/BF00026459
Hoverd WA (1985) Occurrence of the order cubomedusae (Cnidaria: Scyphozoa) in New Zealand: Collection and laboratory observations of carybdea sivickisi. New Zeal J Zool 12:107–110. https://doi.org/10.1080/03014223.1985.10428267
Jouiaei M, Yanagihara AA, Madio B, et al (2015) Ancient venom systems: A review on cnidaria toxins. Toxins (Basel). 7:2251–2271
Kintner AH, Seymour JE, Edwards SL (2005) Variation in lethality and effects of two Australian chirodropid jellyfish venoms in fish. Toxicon 46:699–708. https://doi.org/10.1016/j.toxicon.2005.07.015
Kramp PL (1962) Medusae of Vietnam. Vidensk Meddelelser fra Dansk naturhistorisk Foren i Kobenhavn 124:305–366
Lewis C, Kubota S, Migott AE, Collins AG (2008) Sexually Dimorphic Cubomedusa Carybdea sivickisi (Cnidaria: Cubozoa) in Seto, Wakayama, Japan. Publ Seto Mar Biol Lab 40:1–8. https://doi.org/10.5134/72820
Lewis C, Long TAF (2005) Courtship and reproduction in Carybdea sivickisi (Cnidaria: Cubozoa). Mar Biol 147:477–483. https://doi.org/10.1007/s00227-005-1602-0
Matsumoto GI, Crow GL, Cornelius PFS, Carlson BA (2002) Discovery of the cubomedusae Carybdea sivickisi (Cubozoa: Carybdeidae) in the Hawaiian waters. Bish Museum Occas Pap 69:44–46
Morandini AC, Stampar SN, Kubota S (2014) Mass occurrence of the cubomedusa Copula sivickisi (Cnidaria: Cubozoa) at Seto Harbor, Shirahama, Wakayama, Japan, in summer of 2013; a possible recent example of global warming. Publ Seto Mar Biol Lab 42:108–111. https://doi.org/10.5134/185694
Nilsson DE, Gislén L, Coates MM, et al (2005) Advanced optics in a jellyfish eye. Nature 435:201–205. https://doi.org/10.1038/nature03484
O’Connor M, Garm A, Nilsson DE (2009) Structure and optics of the eyes of the box jellyfish Chiropsella bronzie. J Comp Physiol A Neuroethol Sensory, Neural, Behav Physiol 195:557–569. https://doi.org/10.1007/s00359-009-0431-x
Östman C (2000) A guideline to nematocyst nomenclature and classification, and some notes on the systematic value of nematocysts. Sci Mar 64:31–46. https://doi.org/10.3989/scimar.2000.64s131
Schlaefer JA, Wolanski E, Yadav S, Kingsford MJ (2020) Behavioural maintenance of highly localised jellyfish (Copula sivickisi, class Cubozoa) populations. Mar Biol 167:. https://doi.org/10.1007/s00227-020-3646-6
Shorten M, Davenport J, Seymour JE, et al (2005) Kinematic analysis of swimming in Australian box jellyfish, Chiropsalmus sp. and Chironex fleckeri (Cubozoa, Cnidaria: Chirodropidae). J Zool 267:371–380. https://doi.org/10.1017/S0952836905007600
Stiasny G (1926) Über einige Scyphomedusen von Puerto Galera, Mindoro (Philippinen). Zool. Meded. 9:239–248
Stiasny G (1922) Die Scyphomedusen-Sammlung von Dr. Th. Mortensen nebst anderen Medusen aus dem zoologischen Museum der Universitat in Kopenhagen. Vidensk Meddelelser fra Dansk naturhistorisk Foren i Kobenhavn 73:33–558
Straehler-Pohl I (2019) A new species detected in the collection of the natural history museum of denmark of the dana expedition from 1928–30: Carybdea irregularis sp. nov. (cnidaria, scyphozoa, cubomedusae, carybdeida, carybdeidae) from french polynesian waters. Plankt Benthos Res 14:261–270. https://doi.org/10.3800/pbr.14.261
Straehler-Pohl I, Garm A, Morandini AC (2014) Sexual dimorphism in tripedaliidae (Conant 1897) (Cnidaria, Cubozoa, Carybdeida). Zootaxa 3785:533–549. https://doi.org/10.11646/zootaxa.3785.4.3
Straehler-Pohl I, Matsumoto GI, Acevedo MJ (2017) Recognition of the Californian cubozoan population as a new species carybdea confusa n. Sp. (Cnidaria, Cubozoa, Carybdeida). Plankt Benthos Res 12:129–138. https://doi.org/10.3800/pbr.12.129
Straehler-Pohl I, Jarms G (2022) Back to the roots, Part 2 —Rhopaliophora (Scyphozoa, Cubozoa and Staurozoa) reborn based on early life cycle data. Plankt Benthos Res 17 (2): 105–126. https://doi.org/10.3800/pbr.17.105
Sucharitakul P, Chomdej S, Achalawitkum T, Arsiranat I (2017) Description of Chironex indrasaksajiae Sucharitakul sp. nov. (Cnidaria, Cubozoa, Chirodropida): A new species of box jellyfish from the Gulf of Thailand. Phuket Mar. Biol. Cent. Res. Bull. 74: 33–44.
Tibballs J (2006) Australian venomous jellyfish, envenomation syndromes, toxins and therapy. Toxicon 48:830–859. https://doi.org/10.1016/j.toxicon.2006.07.020
Toshino S, Miyake H, Iwanaga S (2014) Development of Copula sivickisi (Stiasny, 1926) (Cnidaria: Cubozoa: Carybdeidae: Tripedaliidae) collected from the Ryukyu Archipelago, southern Japan. Plankt Benthos Res 9:32–41. https://doi.org/10.3800/pbr.9.32
Toshino S, Nishikawa J, Srinui K, et al (2019) New records of two species of Cubozoa from Thailand. Plankt Benthos Res 14:143–149. https://doi.org/10.3800/pbr.14.143
Uchida T (1970) Revision of Japanese Cubomedusae. Publ Seto Mar Biol Lab 17:289–297. https://doi.org/10.5134/175610
Yanagihara AA, Shohet R V. (2012) Cubozoan Venom-Induced Cardiovascular Collapse Is Caused by Hyperkalemia and Prevented by Zinc Gluconate in Mice. PLoS One 7:. https://doi.org/10.1371/journal.pone.0051368

Table 1. Cnidome of Copula lucentia sp. nov. L= length of undischarged capsule in µm, W= width of undischarged capsule at widest point in µm, SD = standard deviation, N= number of nematocysts measured.

Part	Nematocyst type	Measure	Min	Max	Mean	SD	N
Tentacles	Spherical holotrichous isorhizas	W	11.4	14.4	12.7	0.8	50
	Spherical holotrichous isorhizas	L	11.7	14.9	13.2	0.9	50
	Oval beehive isorhiza	W	10.0	12.4	10.9	0.6	50
	Oval beehive isorhiza	L	14.0	18.0	15.9	1.0	50
	Lemon-shaped microbasic eurytele	W	9.9	11.9	10.8	0.5	50
	Lemon-shaped microbasic eurytele	L	13.0	18.6	16.5	1.3	50
Exumbrella warts	Spherical holotrichous isorhizas	W	11.0	15.0	13.0	1.0	50
Exumbrella warts	Spherical holotrichous isorhizas	L	11.2	15.3	13.6	1.1	50
Pedalia	Spherical holotrichous isorhizas	W	12.0	16.2	13.6	1.1	50
Pedalia	Spherical holotrichous isorhizas	L	12.3	16.3	14.2	1.0	50
Gastric cirri - Subgastral sacs	Tiny microbasic eurytele	W	6.6	9.3	8.1	0.5	50
Gastric cirri - Subgastral sacs	Tiny microbasic eurytele	L	7.3	9.7	8.6	0.5	50

Table 2. Comparison of morphological characters of Copula sivickisi and Copula lucentia. BH = Bell height, IPD = Interpedial diameter, PL = Pedalial lentgh, StL = Stalk length, PW = pedalial width.

Character	*Copula sivickisi*	*Copula lucentia*
Bell shape	- blunt pyramidal	- blunt pyramidal
size (BH, IPD, IPD/BH)	- 10-13 mm, 12-16 mm, 1:1.23	- 6.1 mm, 6.9 mm, 1:1.10 mm
nematocyst warts	- very large, whitish, roundish, oval to biscuit-shaped, covering bell from below apex to bell-turnover	- minute to small, whitish, round, covering bell from apex to bell turnover
Rhopalial niches	- 14% BH up from margin, cavity: spherical	- 5-8% BH up from bell margin, cavity: spherical to upside-down egg-shaped
niche opening	- keyhole-shaped	- keyhole-shaped
rhopalial horns	- long (≥ height of rhopalial niche), very narrow, vertical, slightly curved apart from each other, antenna-shaped without knob at distal end	- intermediate in length (≤50% of rhopalial niche height), very narrow, vertical, curved towards each other, antenna-shaped slightly flared at distal end
Pedalia	- unbranched, long (PL:PL: ≤50% BH, StL: none; PW: ≤50% PL), slender knife-blade-shaped	- unbranched, intermediate in length (PL: ≤30% BH; StL: none; PW: ≤40% PL), slender knife-blade-shaped
canals	- oval in cross-section, straight, equal breadth from proximal to distal end	- oval in cross-section, straight, nearly equal breadth from proximal to distal end
knee bend	- rounded, no appendage	- rounded, no appendage
tentacles	- simple, filiform, homogeneously banded with nematocyst battery rings	- simple, filiform, homogeneously banded with nematocyst battery rings
nematocyst warts	- outer wing with 3–7 broad, rectangular nematocyst bands on outer keel of pedalium, inner wing free of nematocyst warts	- outer wing with 4-6 broad, round warts to horizontal longish oval nematocyst bands on outer keel of pedalium, inner wing free of nematocyst warts
Velarium	- narrow, <33% BW	- narrow, <33% BW
roots	- 2 / octant	- 2 / octant
canals	- 2 / root, 2/3 split into 3-6 simple, finger-like, straight to curved secondary canals	- 1-(mostly)2 / root, both triangular canals of one root are separated by a narrow gap, showing a broad base, tapering into sharp tips, outer canals (facing frenulum or pedalium) slightly shorter than inner canals, no additional secondary canals or branches
pattern	- paw-shaped	- triangular if 1 canal, beak-like if 2 canals
Gastric phacellae	- horizontal, slightly concave/crescent-shaped rows, lining four stomach corners	- horizontal, slightly concave/crescent-shaped rows, lining four stomach corners
gastric filaments	- multiple rooted, ca. 40, simple, unbranched, vertically stacked	- multiple rooted, ca. 50, simple, unbranched, vertically stacked,
stomach	- flat, shallow	- flat, shallow
manubrium	- short (30% BH), fourlobed, short moutharms	- short (30% BH), fourlobed, short moutharms
Lateral gonads	- (holotype, female) 4 butterfly-shaped pairs, hemigonads, single wings biscuit-shaped, brown (fertilized); sexes supposed dimorph	- (female) 4 butterfly-shaped pairs, hemigonads, single wings leaf-shaped, transparent to whitish (immature); sexes supposed dimorph

Download PDF

Journal Publication

published 20 Aug, 2024

Read the published version in Marine Biodiversity →

Editorial decision: Major Revisions Needed
18 Jan, 2024
Reviewers agreed at journal
03 Dec, 2023
Reviewers invited by journal
03 Dec, 2023
Editor invited by journal
09 Nov, 2023
Editor assigned by journal
03 Nov, 2023
First submitted to journal
01 Nov, 2023

You are reading this latest preprint version

Copula lucentia sp. nov., a new box jellyfish (Cnidaria: Cubozoa: Carybdeida) from Western Mediterranean Sea

Status:

Journal Publication

Version 1

Abstract

Figures

INTRODUCTION

MATERIAL AND METHODS

RESULTS

DISCUSSION

Declarations

References

Tables

Status:

Journal Publication

Version 1