Friedelin and epifriedelanol are pentacyclic triterpenoids that preferentially accumulate in the roots of hemp (Cannabis sativa L.) and are valued for their antidiabetic, hypolipidemic, antioxidant, liver protective, anti-ulcer, anti-inflammatory, antimicrobial, anticancer, and antisenescence properties. The aim of the present study was to investigate the influence of media, carbon sources, and elicitation on the production of C. sativa hairy root biomass and these metabolites. The MS liquid medium promoted the highest fresh weight (9.45 ± 0.00 g/100 mL flask) biomass production in hairy root cultures after 28 days. The highest levels of epifriedelanol (3.79-fold) and friedelin (3.25-fold) were found at the end of the exponential phase. The presence of 3% sucrose provided the highest accumulation of epifriedelanol (0.930 ± 0.013 mg/g DW) and friedelin (0.574 ± 0.024 mg/g DW) in the roots. The effects of methyl jasmonate (MJ) and salicylic acid (SA) on the enhancement of friedelin and epifriedelanol in C. sativa hairy root cultures were investigated. Between the two elicitors, SA showed the highest production of epifriedelanol (up to 5.018 ± 0.35 mg/g DW) and friedelin up to 1.56 ± 0.34 mg/g DW in 28-day-old stationary phase hairy roots. These represented 5.22- and 2.88-fold increase over the control (0.96 ± 0.01 mg/g DW and 0.54 ± 0.03 mg/g DW) after 96 h of treatment, respectively. The maximum accumulations of epifriedelanol (3.59 ± 0.12 mg/g DW) and friedelin (1.31 ± 0.01 mg/g DW) were observed in the treatment with MJ (100 µM) after 24 h of exposure and were 3.73- and 2.44-fold higher than the control, respectively. These findings suggest that elicitation is an effective technique for enhancing the yields of these valuable bioactive pentacyclic triterpenoids in C. sativa hairy root cultures in a relatively short period of time.
Research Article
Methyl jasmonate and salicylic acid enhance the production of epifriedelanol and friedelin in Cannabis sativa
L. hairy roots
https://doi.org/10.21203/rs.3.rs-3556730/v1
This work is licensed under a CC BY 4.0 License
Journal Publication
published 22 Jan, 2024
Read the published version in Plant Cell, Tissue and Organ Culture (PCTOC) →
You are reading this latest preprint version
Cannabis sativa
hairy root cultures
elicitation
friedelin
epifriedelanol
methyl jasmonate
salicylic acid
Industrial hemp (Cannabis sativa L.) is an important annual dioecious, herbaceous plant in the family Cannabaceae (Barcaccia et al. 2020; Ghosh et al. 2023). Native to Central and Southern Asia, it has been used traditionally for centuries to treat asthma, epilepsy, pain, and rheumatism (Chandra et al. 2020). It is an economically important crop cultivated worldwide for industrial, cosmetic, food, and therapeutic uses (Murovec et al. 2022; De Prato et al. 2023). The global sales market for Cannabis is expected to reach US$102 billion by 2026, and the global market demand for cannabinoids is expected to reach $9.69 billion by 2025 (Noppawan et al. 2022; Robertson et al. 2023). According to the University of Thai Chamber of Commerce report, the Thai Cannabis market is anticipated to reach $1.2 billion by 2025 (Suttinee 2022).
The phytotherapeutic potential and health effects of C. sativa have been widely investigated, particularly for anti-inflammatory, pain management, anticancer, antioxidant, neuroprotective, gastrointestinal disorders, epilepsy, Parkinson's disease, and lowering blood pressure activities (Kumar et al. 2021). These therapeutic properties of C. sativa depend substantially on the respective different chemical compositions of the plant parts, such as cannabinoids, alkaloids, terpenes, flavonoids, lignans, and steroids (Kumar et al. 2021; Almeida Neto et al. 2023; Huang et al. 2023). More than 545 metabolites have been isolated or characterized from this plant, with more than 104 different cannabinoids identified (Almeida Neto et al. 2023). The main bioactive metabolites occurring in C. sativa are Δ9-tetrahydrocannabinol (THC), cannabidiol (CBD), and cannabinolic acid (CBNA), followed by cannabigerolic acid (CBGA), cannabichromenic acid (CBCA), and cannabinodiolic acid (CBNDA). The predominant phytochemicals of C. sativa are found in the aerial parts. However, several bioactive metabolites have been identified in the roots, especially triterpenoids (friedelin and epifriedelanol), prenylated flavonoids (canflavins A and B), and alkaloids (cannabisativine, anhydrocannabisativine, and cannabisin B) (Almeida Neto et al. 2023).
In recent years, there has been increasing interest in examining the pharmacological activities of C. sativa root extracts and their metabolites (Ferrini et al. 2022),, including for possible anti-inflammatory, anti-asthmatic, antinociceptive, antipyretic, anti-asthmatic, spasmolytic, and antioxidant properties (Ryz et al. 2017; Lima, et al. 2021; Menezes et al. 2021; Kornpointner et al. 2021; Ferrini et al. 2022; Almeida Neto et al. 2023). Recent studies showed that friedelin displayed potent antidiabetic (Sunil et al. 2021), hypolipidemic (Duraipandiyan et al. 2016), antioxidant and liver protective effects (Sunil et al. 2013), anti-ulcer (Queiroga et al. 2000; Antonisamy et al. 2015), anti-inflammatory (Antonisamy et al. 2011; Ferrini et al. 2022), whereas epifriedelanol has been studied for its antimicrobial (Msengwa et al. 2023), anticancer (Kundu et al. 2000; Dae et al. 2005; Yan et al. 2017), anti-inflammatory (Dae et al. 2005; Ferrini et al. 2022), and antisenescence properties (Yang et al. 2011).
Friedelin is considered a potential resource for dietary supplements (Gao et al. 2022) and also displayed natural anti-insecticidal activity for agricultural pests (Baskar et al. 2014). Chemical synthesis of these bioactive secondary metabolites is impractical (Guo et al. 2020; 2022). Therefore, from a sustainability perspective, it is necessary to increase metabolite production, especially of friedelin, which is considered responsible for the pharmacological effects of C. sativa root extracts. Hairy root culture and elicitation strategies offer a promising biotechnological approach for increasing the biomass and provide an alternative platform for enhancing metabolite production for compounds that are either scarce in nature or difficult to synthesize chemically (Mahendran et al. 2022ab; Alcalde et al. 2022). Hairy roots are characterized by being genetically and biochemically stable, phytohormone-free, have a fast growth rate, and have the ability to produce similar or higher levels of metabolites than the mother plant roots. They also have the potential to be easily scalable at the industrial level and have lower production costs (Gutierrez-Valdes et al. 2020; Boobalan and Kamalanathan, 2020; Zhang, et al. 2020; Miao et al. 2021; Mahendran et al. 2022ab; Alcalde et al. 2022; Ji et al. 2023). In addition, hairy root cultures offer a sustainable and controllable approach for metabolite accessibility (Shi et al. 2021).
Rhizobium rhizogenes is a natural plant genetic engineer that transfers its root-inducing plasmid into the host cell during infection, causing the formation of hairy roots. Recently, different strains of R. rhizogenes have been extensively used for genetic manipulation, metabolic pathway investigation, and the production of recombinant proteins and metabolites. Previous research has suggested that distinct oncogenes (expression of rol genes) may be associated with the various hairy root lines/Ri phenotypes (Nemoto et al. 2009; Desmet et al. 2020; Sathasivam et al. 2022). Moreover, the rol genes (Ri plasmid) in the root lines are responsible for the variations in virulence, morphological changes, root growth, and metabolite production (Mahendran et al. 2022a; Sathasivam et al. 2022; Ji et al. 2023). Hairy root cultures of C. sativa have been investigated previously for the production of choline, atropine, muscarine, triterpenoids (Wahby et al. 2006; 2017; Kobtrakul et al. 2023), and cannabinoids (Farag and Kayser, 2015), and a hairy root induction protocol has been established (Wahby et al. 2013; Berahmand et al. 2016). However, there are no reports describing the influence of media, carbon sources, optimum times for biomass accumulation and friedelin and epifriedelanol production in C. sativa hairy root cultures.
Hairy root cultures
The hairy root culture of C. sativa was developed from petiole explants by R. rhizogenes ATCC 43057 transformation, as reported by this group (Kobtrakul et al. 2023). Hairy roots were kept under continuous darkness at 25 ± 1℃ on a solid B5 medium with 20 g/L sucrose and switched to a new B5 medium every 14 days for further experiments.
Molecular characterization of transformed roots
Genomic DNA from hairy roots and non-transformed roots was isolated using the DNeasy Plant Mini Kit protocol (Qiagen, USA). Each DNA sample was used as a polymerase chain reaction (PCR) template to analyze the presence of specific genes rolB (forward: GATATCCCGAGG-GCATTTTT, reverse: GAATGCTTCATCGCCATTTT) and rolC (forward: CTCCTGACATCAAACTCGTC, reverse: TGCTTCGAGTTATGGGTACA) in the roots. The PCR reaction mix contained 100 ng template DNA, 4 µL of 5x Phusion HF buffer, 1 µL of each primer, 0.4 µL 10 mM dNTPs, 0.2 µL Phusion DNA polymerase (Thermo Fisher Scientific, Waltham, MA, USA) and was brought to 25 µL with MQ water (autoclaved). PCR amplification was performed using an initial denaturation at 98°C for 1 minute, followed by 36 cycles of 20-second denaturation at 98°C, 30-second annealing at 55°C for rolC and 58°C for rol B, a 70 s extension at 72°C and a final extension at 72°C for 5 min performed in a thermal cycler (Eppendorf, Hamburg, Germany). The amplified products were subjected to electrophoris in an ethidium bromide agarose gel [1% (w/v)] and visualized using a UV transilluminator.
Effect of different basal media for biomass production
For optimal biomass production, 0.5 g of C. sativa hairy roots were transferred to 100 mL of MS and B5, and FW was measured after 28 days incubation.
Growth kinetics of hairy roots
To determine the growth kinetics of C. sativa hairy roots, 0.5 g of fresh C. sativa hairy roots were transferred to 100 mL of MS medium (liquid) and maintained with shaking at 100 rpm under dark (25°C) conditions. The growth rate and biomass of C. sativa hairy roots were calculated based on the FW and DW at intervals of 7 days up to 42 days. For estimation of the FW, hairy roots were dried on filter paper to remove excess water and weighed. For analysis of the DW, C. sativa hairy roots were oven-dried at 50°C for 24 h.
Effect of culture time on accumulation of friedelin and epifriedelanol
To determine the influence of growth time of the C. sativa hairy roots culture and changes in the accumulation of friedelin and epifriedelanol production, 0.5 g hairy roots were shifted to 250 mL Erlenmeyer flasks containing 100 mL of liquid MS medium with 3% sucrose. The roots were collected every 7 days during a 35-day growth cycle, and the friedelin and epifriedelanol levels were calculated.
Influence of carbon source on the hairy root biomass and friedelin and epifriedelanol production
To investigate the influence of sucrose and glucose on hairy root biomass, growth, and the production of friedelin and epifriedelanol, the C. sativa hairy roots were cultured in liquid MS medium supplemented with different concentrations of sucrose or glucose (1, 2, 3, 4, and 5%). After 28 days the treated C. sativa hairy roots were harvested and analyzed for their FW, DW, and quantified for the friedelin and epifriedelanol contents.
Effect of elicitors in C. sativa hairy root cultures
To study the efficacy of elicitors on the enhancement of friedelin and epifriedelanol in hairy root cultures of C. sativa, methyl jasmonate (MJ) (25, 50, 100, and 200 µM) and salicylic acid (SA) (25, 50, 100, and 200 µM) were added individually to 28-day-old (stationary phase) hairy root cultures in MS liquid medium, and incubated for 24, 48, and 96 h after which the friedelin and epifriedelanol contents were investigated.
HPTLC profile and quantification of cannabinoids
HPLC and HPTLC were used to analyze the cannabinoid profile of C. sativa hairy roots according to the methods described by Citti et al. (2018) and Muhammad Zen et al. (2022).
Extraction and GC-FID quantification of friedelin and epifriedelanol
For extraction, a sample (0.1 g) of the powdered hairy roots was extracted with chloroform (1 mL) and kept in an ultrasonic bath at 40°C for 35 min, followed by centrifugation at 10,000 rpm for 10 min. The supernatant was removed, and the same procedure was repeated twice. The combined extracts were passed through a PTFE syringe filter (0.45 mm, Toyo Roshi Kaisha, Ltd., Tokyo, Japan), and the filtrate was dried and redissolved in chloroform (1.0 mL) for further experiments. The friedelin and epifriedelanol profiles were determined using HPTLC and the friedelin and epifriedelanol levels were measured according to the method established by this group (Kobtrakul et al. 2023) using GC-FID. The friedelin and epifriedelanol contents were quantified using the following equation:
Statistical analysis
All hairy root culture experimental data were analyzed three times and the results presented as the mean of five replicates. The quantification of friedelin and epifriedelanol was carried out three times with three replicates. In all experiments, the results were expressed as mean ± standard error by one-way analysis of variance (ANOVA) in IBM SPSS (Version 26; SPSS Inc., Chicago, IL, USA) using Tukey's honestly significant difference (HSD).
Confirmation of transformation
In this investigation, the integration of rol genes in the C. sativa hairy root line was identified by PCR using rolB and rolC gene-specific primers (Fig. 1A). The probable PCR amplicon sizes of 204 bp for rolB and 582 bp for rolC were seen in the hairy root line, whereas non-transformed roots did not show any amplification.
Effect of different MS and B5 media
To determine the optimum liquid medium to achieve the highest growth and biomass, the hairy roots were cultivated in MS and B5 media for 28 days. C. sativa hairy roots showed the maximum growth and biomass of 9.44 ± 0.01 g/100 mL flask FW and 0.85 ± 0.01 g/100 mL flask DW observed in the MS (Fig. 1B) medium after the 28th day of culture, whereas growth and biomass were 6.15 ± 0.05 g/100 mL flask FW and 0.55 ± 0.05 g/100 mL flask DW in the B5 medium (Fig. 1C).
Time course of C. sativa hairy roots and accumulation of friedelin and epifriedelanol
After optimizing the medium for the greatest biomass production, petiole-produced hairy root growth was observed in terms of FW and DW, and the results are shown in Fig. 2. The time passage of C. sativa petiole-derived hairy roots displayed a slow biomass production during the lag phase (0–14 days, Fig. 1D). Rapid growth was observed during the exponential phase (between 14 and 28 days, Fig. 1E), followed by the stationary phase (28 to 42 days, Fig. 1F) during which there was a decline in growth. The maximum accumulation of biomass was 9.44 ± 0.01 g/100 mL flask FW and 0.85 ± 0.01 g/100 mL flask DW after day 28 in the MS basal medium (Fig. 2).
Differences in friedelin and epifriedelanol accumulation were observed among the different harvested times during the time course of C. sativa hairy root growth (Fig. 3). The accumulation of friedelin and epifriedelanol increased continuously up to the stationary phase (Fig. 3). The highest levels of epifriedelanol (0.972 ± 0.068 mg/g DW) and friedelin (0.531 ± 0.048 mg/g) were evident at the end of the exponential phase and increased up to 3.79- and 3.25-fold from the lag phase (after the 7th day), respectively. A sharp decline in the content of epifriedelanol and friedelin was seen after 35 days.
Influence of sucrose and glucose on biomass and production of friedelin and epifriedelanol
The influence of sucrose concentration (1–5%) on the biomass accumulation of C. sativa roots was examined after 28 days of culture; sucrose/glucose was required for growth. The lowest biomass (3.718 ± 0.031g/flask FW and 0.255 ± 0.031g/flask DW) was found when the roots were grown in the medium with 1% sucrose (Fig. 4A). The highest FW of the roots (9.462 ± 0.021g/ flask FW and 0.871 ± 0.022 g/flask DW) was observed in the presence of 3% sucrose. Increasing the sucrose concentration to 4% and 5% inhibited the growth of the roots and the FW yielding 4.253 ± 0.082 g and 3.395 ± 0.058 g/flask FW, respectively (Fig. 4a). The maximum root biomass (10.899 ± 0.048 g/flask FW and 1.022 ± 0.118g/flask DW) was obtained with 4% glucose at 28 days (Fig. 4B) increasing the glucose concentration to 5% inhibited the hairy root growth.
The friedelin and epifriedelanol levels in C. sativa hairy root cultures increased up to 3% sucrose concentration and achieved the highest accumulation of epifriedelanol (0.930 ± 0.013 mg/g) and friedelin (0.574 ± 0.024 mg/g) (Fig. 5A). Higher or lower concentrations of sucrose significantly reduced the friedelin and epifriedelanol levels in C. sativa hairy root cultures. For glucose addition, the highest epifriedelanol (0. 0.655 ± 0.044 mg/g) and friedelin (0.319 ± 0.043 mg/g) contents were achieved using 4% glucose (Fig. 5B) with 15.61 and 4.38-fold enhanced yields compared with 1% glucose, respectively.
HPTLC fingerprint of friedelin and epifriedelanol and cannabinoids
HPTLC analysis of the C. sativa hairy root chloroform extract revealed the presence of friedelin and epifriedelanol with various unknown phytochemicals, as illustrated in Fig. 6A. In the hairy root and in the normal root extracts, a small yellowish band for friedelin at Rf 0.54 was visible, and epifriedelanol was detected in the extract as a purple zone at Rf 0.40 under white light. The HPTLC profile of the methanolic hairy root extract did not show the presence of metabolites corresponding to cannabinoids (Fig. 6B) and in the HPLC analysis, no cannabinoid peaks were observed in the chromatograms of the hairy root and the normal roots extracts (Fig. 7).
Effect of MJ and SA on the accumulation of friedelin and epifriedelanol
Petiole-derived C. sativa hairy root cultures were elicited by different concentrations of MJ and SA at 25, 50, 100, and 200 µM, to investigate their effects on enhancing the friedelin and epifriedelanol contents, which were observed after 24, 48, and 96 hours. Between the two elicitors evaluated, SA100 µM showed the highest production of epifriedelanol up to 5.018 ± 0.35 mg/g DW and friedelin up to 1.56 ± 0.34 mg/g DW in 28-day-old stationary phase hairy roots, which represented a 5.22- and a 2.88-fold increase over the control (0.96 ± 0.01mg/g DW and 0.54 ± 0.03) culture after 96 h of treatment (Fig. 8A & B). The levels of epifriedelanol and friedelin increased as the exposure to SA increased up to 200 µM, whereupon the epifriedelanol (1.95 ± 0.08 mg/g DW; Fig. 8A) and friedelin (0.60 ± 0.04 mg/g DW; Fig. 8B) content declined, being only 2.03- and 1.1-fold higher than control. An increase in the accumulation of friedelin and epifriedelanol was seen with an increase in concentration of SA from 25 µM to 100 µM and treatment time from 24 h up to 96 h in 28-day-old hairy root cultures (Fig. 8A&B).
The efficacy of MJ at different concentrations (25, 50, 100, and 200 µM) on the production of friedelin and epifriedelanol in 28-day-old C. sativa hairy root cultures revealed the maximum accumulation of epifriedelanol (3.59 ± 0.12 mg/g DW) and friedelin (1.31 ± 0.01 mg/g DW) from the treatment with MJ (100 µM) after 24 h of exposure, which was 3.73- and 2.44-fold higher than the control (Fig. 9A&B). A dose dependent accumulation of epifriedelanol and friedelin was observed when the hairy roots were treated with MJ from 25 to 100 µM) for 24 h (Fig. 9A&B). A sharp decline in friedelin and epifriedelanol accumulation was observed with MJ administration from 25 to 200 µM for 48 and 96 h. An increase in treatment time (96 h), reduced the accumulation of friedelin and epifriedelanol to 2.66 ± 0.20 mg/g DW and 0.83 ± 0.07 mg/g DW, although they were still 2.77- and 1.5-fold higher than control. The production of friedelin and epifriedelanol by SA (100 µM) is therefore significantly dependent on the treatment time.
Higher efficiency root induction and transformation and the production of different root lines are influenced by a number of factors, particularly, the choice of explant, R. rhizogenes strain specificity, bacterial cell density, bacterial growth phase, infection process, co-cultivation time, and the chemical inducers (Geier and Sangwan, 1996; Chen et al. 2008; Ooi et al. 2013; Shilpha et al. 2015; Sarkar et al. 2020; Mahendran et al. 2022; Ji et al. 2023). The integration and expression of root-inducing T-DNA regions into transformed C. sativa hairy roots were confirmed by PCR amplification of the rolB (204 bp) and rolC (582 bp) genes. Similarly, the T-DNA fragment for the presence or integration of rolB and rolC in hairy root lines has been observed in Przewalskia tangutica Maxim. (Lan and Quan, 2010), Stevia rebaudiana (Bertoni) Bertoni (Fu et al. 2015), Aerva lanata (L.) Juss, ex. Schult. (Boobalan and Kamalanathan, 2020), Artemisia tilesii Ledeb. (Matvieieva et al. 2020), Rubia yunnanensis Diels (Miao et al. 2021), and Polygala tenuifolia Willd. (Ji et al. 2023). Expression of the rol genes plays a key role in root induction and development, the variation in hairy root lines, and the activation of secondary metabolism (Piątczak et al. 2019; Tusevski et al. 2019; Wojciechowska et al. 2020; Matvieieva et al. 2020; Yousefian et al. 2021; Ji et al. 2023). Earlier, the rolB and rol C gene expression and integration enhanced the antioxidant potential in Artemisia tilesii and Polygala tenuifolia (Matvieieva et al. 2020; Ji et al. 2023), chlorogenic acid production in S. rebaudiana (Fu et al. 2015), aervine accumulation in A. lanata (Boobalan and Kamalanathan, 2020); rubiaceae-type cyclopeptides and anthraquinones in R. yunnanensis (Miao et al. 2021), and scopolamine in P. tangutica (Lan and Quan, 2010).
The strength and composition of the medium can also influence the growth, biomass, and secondary metabolite accumulation profoundly in hairy root cultures (Yao et al. 2016; Skała et al. 2022). The growth and biomass in C. sativa hairy roots were influenced by the MS and B5 culture media. The maximum growth and biomass accumulation were achieved after 28 d (9.44 ± 0.01 g/100 mL flask FW) using the MS-basal medium when compared with B5 (6.15 ± 0.05 g/flask FW), i.e., the MS medium produced 1.52-fold higher biomass than B5. In agreement with our study, the MS medium was also effective for enhanced biomass accumulation in hairy root cultures of Aster scaber Thunb. (Ghimire et al. 2019), Turbinicarpus lophophoroides (Solis-Castañedaet al. 2020) and R. yunnanensis (Miao et al. 2020). However, contrary to these findings, the B5 medium (19.81 g flask− 1) was more suitable for maximum fresh biomass acumination than the MS (1.12 g flask− 1) medium for Codonopsis pilosula (Makowczynska et al. 2021). Kim et al (2012) reported that the B5 and SH media enhanced the biomass 3-fold more than the MS medium in Scutellaria baicalensis hairy root culture. To achieve the highest reproducible production of hairy root biomass and metabolites, the growth of the hairy root line must be optimized in terms of the growth phase or pattern for harvesting the desired metabolite accumulation (Sharan et al. 2019; Gharari et al. 2020; Mahendran et al. 2022; Sandhya and Gir, 2022; Ji et al. 2023). Currently, there are no reports on the growth and biomass accumulation, or the friedelin and epifriedelanol production in the hairy root cultures of C. sativa on MS basal liquid medium. The results revealed that the FW and DW biomasses showed notable variations during different growth times and phases. The trends for increasing growth and biomass were most evident during the 14–28-day period, and the highest biomass production was 9.45 g/flask FW and 0.975 g/flask DW observed in the MS medium after 28 days. The time course of root growth and the growth curve and variations in biomass production during the different growth phases in hairy root culture were previously observed in cultures of Dracocephalum forrestii (Weremczuk-Jezyna et al. 2016), Ocimum tenuiflorum (Sharan et al. 2019), Scutellaria bornmuelleri (Gharari et al. 2020), C. pilosula (Makowczynska et al. 2021), and Swertia chirayita (Mahendran et al. 2022).
Furthermore, it was observed that the C. sativa hairy root culture system could continuously increase the biomass up to 18.9-fold higher than the initial inoculum, which lasted until the culture entered the stationary phase. These results are consistent with those of Kundu et al (2018), who reported that the highest biomass (5.77 ± 0.06 g per 50 mL FW) was encountered during the log phase (day 28) in Sphagneticola calendulacea. Likewise, Ghimire et al. (2019) reported that maximum hairy root growth and biomass were observed during 7–27 days in A. scaber cultures
In C. sativa, the biosynthesis of the cannabinoids occurs in glandular trichomes, which are located on the aerial parts, and especially in the female flowers (Flores-Sanchez and Verpoorte, 2008; Happyana et al. 2013). These results agree with those of Elhendawy et al (2018), who reported that glandular trichomes are not found on the surface of the roots, which therefore do not produce cannabinoids.
In this investigation, friedelin and epifriedelanol production were studied in hairy root cultures of C. sativa treated with various concentrations of sucrose and glucose in a liquid MS culture system for 28 days. The presence of 3% sucrose was more efficient than other levels in enhancing FW, DW, and friedelin and epifriedelanol accumulation. Similar effects of 3% sucrose were reported to provide the highest hairy root growth and biomass production in cultures of Momordica charantia (Thiruvengadam et al. 2014), Picrorhiza kurrooa (Verma et al. 2015), Pelargonium sidoides (Yousefan et al. 2021), and Rhaponticum carthamoides (Skala et al. 2022).
Elicitors are bioactive stimulants of either biotic (bacterial, yeast, and fungal) or abiotic (chemical, physical, and hormonal) origin (Wang et al. 2015; Guru et al. 2022). Previous studies concluded that methyl jasmonate (MJ) and salicylic acid (SA) are simple, powerful, and reliable elicitors for enhancing specialized bioactive metabolite production in hairy root cultures (Sharan et al. 2019; Gharari et al. 2020; Reis et al. 2019; Alsoufi et al. 2019; Sharifzadeh Naeini et al. 2021; Sandhya and Giri, 2022; Ru et al. 2022; Attaran Dowom et al. 2022 Mahendran et al. 2022; Jeyasri et al. 2023; Adabavazeh et al. 2023; Halder and Ghosh, 2023; Silva-Santos et al. 2023). In this study, it was demonstrated that MJ and SA increased the accumulation of friedelin and epifriedelanol contents when applied at 25–200 µM.
Elicitation is effective in growth and biomass accumulation, and in specialized bioactive metabolite enhancement by triggering or expressing stress signal transduction and regulating gene expression, which leads to the enhanced biosynthesis of targeted bioactive metabolites in the hairy roots (Halder et al. 2019; Guru et al. 2022; Jeyasri et al. 2023). According to a recent study, intracellular signaling molecules, such as jasmonic acid, nitric oxide (NO), salicylic acid, reactive oxygen species (ROS), and polyamines (PAs) are involved in signal pathway regulation, and form a complex signaling network that activates mitogen-activated protein kinases (MAPKs), ion channels, and G-proteins, which results in increased ROS production, and triggers secondary metabolite synthesis (Ma et al. 2013; Hao et al. 2020; Guru et al. 2022).
Recent investigations have concluded that the successful elicitation and production of targeted bioactive metabolites depends on several factors, including the growth stage, time of exposure, incubation period, type of elicitor, and the concentration, which influence metabolite production in hairy root cultures (Sharan et al. 2019; Gharari et al. 2020; Ru et al. 2022; Mahendran et al. 2022; Jeyasri et al. 2023; Kobtrakul et al. 2023). The appropriate age or maturity of the hairy roots in the growth phase for elicitation varied in specific plants (Kang et al. 2009). In most cases, the end of the log/exposure growth phase or the stationary phase is an ideal stage for elicitation (Sharan et al. 2019; Gharari et al. 2020; Mahendran et al. 2022; Halder and Ghosh, 2023). Cells respond strongly to elicitors when they are exposed towards the end of the log/exposure growth phase or at the beginning of the stationary phase (Khosroushahi et al. 2006). In the previous study, Kobtrakul et al (2023) elicited the C. sativa hairy root during the linear growth phase and found that terpenoids were increased compared to the untreated roots. However, when C. sativa hairy root cultures were examined the similar elicitation parameters at the stationary phase in this study, it was found that the accumulation of triterpenoids was increased much more than at the linear growth phase. The findings in this study are consistent with those of Mahendran et al. (2022), who established that the production of swerchirin and 1,2,5,6-tetrahydroxyxanthone was enhanced when hairy roots were exposed to an elicitor at the beginning of the stationary phase in Swertia chirayita.
The stress signaling molecule salicylic acid (SA) participates in plant defense responses against pathogens and promotes the biosynthesis of protective metabolites (Rai et al. 2021; Kim and Lim 2023). Here, a dose-dependent increase in the contents of epifriedelanol and friedelin was observed when C. sativa hairy roots were treated with SA (25, 50, 100 and 200 µM). It was determined that the highest levels of epifriedelanol (5.01 ± 0.35 mg/g DW) and friedelin (1.56 ± 0.35 mg/g DW) were found at 100 and 50 µM SA respectively, and were 5.22- and 2.88-fold above the control. Previously, Mahendran et al. (2022) reported that SA treatment at 50 µM increased 1,2,5,6-tetrahydroxyxanthone (4.411 ± 0.31 mg/g) and swerchirin (0.616 mg/g) production at the 6th day after elicitation, and were a 1.56- and 4.8-fold increase over the control, respectively. A study by Sharan et al. (2019) revealed that SA at 30 mg/L promoted ursolic acid production up to 3.13-fold in Ocimum tenuiflorum hairy root culture.
Here a continuous enhancement in friedelin and epifriedelanol production was detected when C. sativa hairy root cultures were treated with MJ or SA (25, 50, and 100 µM), whereas 200 µM of MJ or SA diminished the accumulation of these triterpenoids. MJ at 100 µM stimulated the highest yield of epifriedelanol (3.59 ± 0.12 mg/g DW) and friedelin (1.31 ± 0.01 mg/g DW) after 24 h treatment, which was 3.73- and 2.44-fold higher than the control. These results are in agreement with those of Zhao and Tang (2020), who noted a 3.63-fold higher production of valtrate in Valeriana jatamansi cultures after 7 days of treatment with MJ (100 mg/L) compared with control. Similarly, Ru et al. (2020) also showed that 100 µM of MJ enhanced rosmarinic acid (97 mg/g DW) production, which was 2.9-fold greater than in the control in Prunella vulgaris hairy root cultures. Attaran Dowom et al (2022) reported that the maximum yield of rosmarinic acid (18.45 ± 0.8 mg/g DW) and salvianolic acid A (2.11 ± 0.04 mg/g DW) was increased with 22.4 ppm of MJ treatment in Salvia virgata hairy roots for 72 hrs. For O. tenuiflorum hairy root cultures, 60 mg/L of MJ enhanced the ursolic acid (5.0-fold) and eugenol (1.55-fold) contents after the 8th day of elicitation (Sharan et al. 2019). The level of rosmarinic acid (55.44 µg/g) production was increased 11.84-fold in the hairy roots of Mentha spicata after MJ (100 µM) treatment (Yousefan et al. 2020). In contrast, a higher concentration (200 µM) of MJ induced maximum curcuminoid (1214.83 ± 7.99 µg/g DW) production, which was 2.5-fold higher than the control hairy roots of Curcuma longa after 48 h (Sandhya and Giri 2022).
An effective and reproducible hairy root culture platform was established for the enhancement of two bioactive compounds, epifriedelanol and friedelin, in C. sativa hairy root cultures Explorations with two media (MS and B5), and two sugars (glucose and sucrose) and two elicitors (MJ and SA) at various concentrations revealed that the optimum biomass was producedin MS medium (9.44 ± 0.01 g/100 mL flask FW and 0.85 ± 0.01 g/100 mL flask DW) after day 28. Treatment with MJ (100 µM) enhanced the maximum production of epifriedelanol (3.73-fold) and friedelin (2.44-fold) after 24 hours of treatment. Interestingly, elicitation by SA was dose-dependent, with the highest epifriedelanol level (5.22-fold) found at 100 µM, whereas 50 µM of SA increased the friedelin level (2.88-fold) compared with control. These results suggest that C. sativa hairy root cultures treated with MJ can enhance the production of epifriedelanol and friedelin, which could make more of these metabolites available for in vivo assessment and might be exploited in the future for large-scale industrial production.
Acknowledgments
GM would like to thank the Director, CSIR-Central Institute of Medicinal & Aromatic Plants, Lucknow, India for constant encouragement and support and also the C2F, Chulalongkorn University, Thailand for a C2F Postdoctoral Fellowship. The authors thank Prof. Emer. Geoffrey A. Cordell, Natural Products Inc. for reviewing the manuscript prior to submission.
Author contributions
GM designed, performed all the experiments, conducted the data analysis, drafted the article, and edited and revised the manuscript. SV supervised the project, acquired funding, and edited and revised the manuscript. The author(s) read and approved the final manuscript.
Funding
This work was supported by Thailand Science Research and Innovation Fund Chulalongkorn University (No.6626/2566).
Data availability statement
The original contributions presented in the study are included in the article/Supplementary Material. Further inquiries can be directed to the corresponding author.
Conflict of interest
The authors declare that they have no conflict of interest.
- Adabavazeh F, Pourseyedi S, Nadernejad N et al (2023) Hairy root induction in Calotropis procera and optimization of its phytochemical characteristics by elicitors. Plant Cell Tiss Organ Cult. https://doi.org/10.1007/s11240-023-02481-y.
- Alcalde MA, Cusido RM, Moyano E et al (2022) Metabolic gene expression and centelloside production in elicited Centella asiatica hairy root cultures. Ind Crops Prod 184:114988. https://doi.org/10.1016/j.indcrop.2022.114988
- Almeida Neto J, Amando Nery D, Simoni Bezerra Lima K et al (2023) Phytochemical characterization of Cannabis sativa L. roots from Northeastern Brazil. Chemistry & Biodiversity 20(3): e202201039. https://doi.org/10.1002/cbdv.202201039.
- Alsoufi ASM, Pączkowski C, Szakiel A et al (2019) Effect of jasmonic acid and chitosan on triterpenoid production in Calendula officinalis hairy root cultures. Phytochem Lett 31: 5-11. https://doi.org/10.1016/j.phytol.2019.02.030
- Andre CM, Hausman JF, Guerriero G (2016) Cannabis sativa: the plant of the thousand and one molecules. Front Plant Sci 7:19. https://doi.org/10.3389/fpls.2016.00019
- Antonisamy P, Duraipandiyan V, Aravinthan A et al (2015) Protective effects of friedelin isolated from Azima tetracantha Lam. against ethanol-induced gastric ulcer in rats and possible underlying mechanisms. Eur J Pharmacol 750:167–175. https://doi.org/10.1016/j.ejphar.2015.01.015
- Antonisamy P, Duraipandiyan V, Ignacimuthu S (2011) Anti-inflammatory, analgesic and antipyretic effects of friedelin isolated from Azima tetracantha Lam. in mouse and rat models. J Pharm Pharmacol 63:1070–1077. https://doi.org/10.1111/j.2042-7158.2011.01300.x.
- Attaran Dowom S, Abrishamchi P, Radjabian T, Salami SA (2022) Elicitor-induced phenolic acids accumulation in Salvia virgata Jacq. hairy root cultures. Plant Cell Tiss Organ Cult 148:107–117. https://doi.org/10.1007/s11240-021-02170-8.
- Barcaccia G, Palumbo F, Scariolo F et al (2020) Potentials and challenges of genomics for breeding cannabis cultivars. Front Plant Sci 11: 573299. https://doi.org/10.3389/fpls.2020.573299
- Baskar K, Duraipandiyan V, Ignacimuthu S (2014) Bioefficacy of the triterpenoid friedelin against Helicoverpa armigera (Hub.) and Spodoptera litura (Fab.) (Lepidoptera: Noctuidae). Pest Manag Sci 70:1877–1883.
- Bensaddek L, Villarreal ML, Fliniaux MA (2008) Induction and growth of hairy roots for the production of medicinal compounds. Electronic Journal of Integrative Biosciences 3:2-9.
- Ben-Zeev B (2020) Medical cannabis for intractable epilepsy in childhood: a review. Rambam Maimonides Med J 11(1): e0004. https://doi.org/10.5041/RMMJ.10387.
- Berahmand F, Beizaee N, Dehghan Nayyeri M et al (2016). Cannabis sativa L. genetically transformed root-based culture via Agrobacterium rhizogenes. Pharm Biomed Res 2(3):13-18.
- Boobalan S, Kamalanathan D (2020) Tailoring enhanced production of aervine in Aerva lanata (L.) Juss. ex Schult. by Agrobacterium rhizogenes-mediated hairy root cultures. Ind Crops Prod 155:112814. https://doi.org/10.1016/j.indcrop.2020.112814.
- Burstein S (2015) Cannabidiol (CBD) and its analogs: a review of their effects on inflammation. Bioorg Med Chem 23(7):1377-1385. https://doi.org/10.1016/j.bmc.2015.01.059.
- Chandra S, Lata H, ElSohly MA (2020) Propagation of Cannabis for clinical research: An approach towards a modern herbal medicinal products development. Front Plant Sci 11: 958. https://doi.org/10.3389/fpls.2020.00958.
- Connor JP, Stjepanovic D, Le Foll B et al (2021) Cannabis use and Cannabis use disorder. Nat Rev Dis Prim 7(1):16. https://doi.org/10.1038/s41572-021-00247-4.
- Dae KK, Jong PL, Jin WK et al (2005) Antitumor and anti-inflammatory constituents from Celtis sinensis. Arch Pharmacal Res 28:39–43. https://doi.org/10.1007/BF02975133.
- De Petrocellis L, Ligresti A, Moriello AS et al (2011) Effects of cannabinoids and cannabinoid-enriched Cannabis extracts on TRP channels and endocannabinoid metabolic enzymes. Br J Pharmacol 163(7):1479-1494. https://doi.org/10.1111/j.1476-5381.2010.01166.x.
- De Prato L, Ansari O, Hardy GESJ, et al (2023) Physiological and cannabinoid responses of hemp (Cannabis sativa) to rock phosphate dust under tropical conditions. Funct Plant Biol 50(5):378-389. https://doi.org/10.1071/FP22264.
- Desmet S, Dhooghe E, De Keyser E (2020) Segregation of rol genes in two generations of Sinningia speciosa engineered through wild type Rhizobium rhizogenes. Front Plant Sci 11:859. https://doi.org/10.3389/fpls.2020.00859.
- Duraipandiyan V, Al-Dhabi NA, Stephen Irudayaraj S, Sunil C (2016) Hypolipidemic activity of friedelin isolated from Azima tetracantha in hyperlipidemic rats. Rev Bras Farmacogn 26: 89–93. https://doi.org/10.1016/j.bjp.2015.07.025.
- Elhendawy MA, Wanas AS, Radwan MM (2019) Chemical and biological studies of Cannabis sativa roots. Med. Cannabis Cannabinoids 1(2):104–111. https://doi.org/10.1159/000495582.
- Farag S, Kayser O (2015) Cannabinoids production by hairy root cultures of Cannabis sativa L. Am J Plant Sci 6:1874-1884. https://doi.org/10.4236/ajps.2015.611188.
- Ferrini F, Donati Zeppa S, Fraternale D (2022) Characterization of the biological activity of the ethanolic extract from the roots of Cannabis sativa L. grown in aeroponics. Antioxidants 11(5):860. https://doi.org/10.3390/antiox11050860.
- Flores-Sanchez IJ, Verpoorte R (2008) Secondary metabolism in Cannabis. Phytochem Rev 7: 615–639.
- Fu X, Yin ZP, Chen JG et al (2015) Production of chlorogenic acid and its derivatives in hairy root cultures of Stevia rebaudiana. J Agric Food Chem 63(1):262-268. https://doi.org/10.1021/jf504176r.
- Gao HY, Zhao H, Hu TY et al (2022) Metabolic engineering of Saccharomyces cerevisiae for high-level friedelin via genetic manipulation. Front Bioeng Biotechnol 10: 805429. https://doi.org/10.3389/fbioe.2022.805429.
- Gharari Z, Bagheri K, Danafar H, Sharafi A (2020) Enhanced flavonoid production in hairy root cultures of Scutellaria bornmuelleri by elicitor induced over-expression of MYB7 and FNSП2 genes. Plant Physiol Biochem 148: 35-44. https://doi.org/10.1016/j.plaphy.2020.01.002.
- Ghosh D, Chaudhary N, Shanker K et al (2023) Monoecious Cannabis sativa L. discloses the organ-specific variation in glandular trichomes, cannabinoids content and antioxidant potential. J Appl Res Med Aromat Plants 35:100476. https://doi.org/10.1016/j.jarmap.2023.100476.
- Guo H, Wang H, Huo YX (2020) Engineering critical enzymes and pathways for improved triterpenoid biosynthesis in yeast. ACS Synth Biol 9: 2214–2227. https://doi.org/10.1021/acssynbio.0c00124.
- Guru A, Dwivedi P, Kaur P, Pandey DK (2022) Exploring the role of elicitors in enhancing medicinal values of plants under in vitro condition. S Afr J Bot 149:1029-1043. https://doi.org/10.1016/j.sajb.2021.10.014.
- Gutierrez-Valdes N, Häkkinen ST, Lemasson C et al (2020) Hairy root cultures - a versatile tool with multiple applications. Front Plant Sci 11: 33. https://doi.org/10.3389/fpls.2020.00033.
- Halder M, Sarkar S, Jha S (2019) Elicitation: A biotechnological tool for enhanced production of secondary metabolites in hairy root cultures. Eng Life Sci 19(12):880-895. https://doi.org/10.1002/elsc.201900058.
- Halder T, Ghosh B (2023) Hairy root cultures of Physalis minima L. - an alternative source of withaferin A production. Plant Cell Tiss Organ Cult 152:31–44. https://doi.org/10.1007/s11240-022-02386-2
- Happyana N, Agnolet S, Muntendam R et al (2013) Analysis of cannabinoids in laser-microdissected trichomes of medicinal Cannabis sativa using LCMS and cryogenic NMR. Phytochemistry 87:51–59. https://doi.org/10.1016/j.phytochem.2012.11.001.
- Huang S, Li H, Xu J et al (2023) Chemical constituents of industrial hemp roots and their anti-inflammatory activities. J Cannabis Res 5(1):1. https://doi.org/10.1186/s42238-022-00168-3.
- Huntsman RJ, Tang-Wai R, Shackelford AE (2020) Cannabis for pediatric epilepsy. J Clin Neurophysiol 37(1):2-8. https://doi.org/10.1097/WNP.0000000000000641.
- Izzo AA, Capasso R, Aviello G et al (2012) Inhibitory effect of cannabichromene, a major non-psychotropic cannabinoid extracted from Cannabis sativa, on inflammation-induced hypermotility in mice. Br J Pharmacol 166(4): 1444-1460. https://doi.org/10.1111/j.1476-5381.2012.01879.x
- Jeyasri R, Muthuramalingam P, Karthick K et al (2023) Methyl jasmonate and salicylic acid as powerful elicitors for enhancing the production of secondary metabolites in medicinal plants: an updated review. Plant Cell Tiss Organ Cult 153(3):447-458. https://doi.org/10.1007/s11240-023-02485-8
- Ji H, Yang B, Jing Y (2023) Trehalose and brassinolide enhance the signature ingredient accumulation and anti-oxidant activity in the hairy root cultures of Polygala tenuifolia Willd. Ind Crops Prod 196:116521. https://doi.org/10.1016/j.indcrop.2023.116521
- Jin D, Dai K, Xie Z et al (2020) Secondary metabolites profiled in Cannabis inflorescences, leaves, stem barks, and roots for medicinal purposes. Sci Rep 10(1):3309. https://doi.org/10.1038/s41598-020-60172-6.
- Kim OT, Bang KH, Shin YS et al (2007) Enhanced production of asiaticoside from hairy root cultures of Centella asiatica (L.) Urban elicited by methyl jasmonate. Plant Cell Rep 26(11):1941-1949. https://doi.org/10.1007/s00299-007-0400-1
- Kim TJ, Lim GH (2023) Salicylic acid and mobile regulators of systemic immunity in plants: transport and metabolism. Plants 12(5):1013. https://doi.org/10.3390/plants12051013.
- Kim YS, Li X, Park WT (2012) Influence of media and auxins on growth and flavone production in hairy root cultures of baikal skullcap, Scutellaria baicalensis. Plant Omics 5(1): 24-27.
- Kobtrakul K, Rani D, Binalee A et al (2023). Elicitation enhances the production of friedelin and epifriedelanol in hairy root cultures of Cannabis sativa L. Front Plant Sci 14:1242584. https://doi.org/10.3389/fpls.2023.1242584
- Kornpointner C, Martinez AS, Marinovic S et al (2021) Chemical composition and antioxidant potential of Cannabis sativa L. roots. Ind Crops Prod 165:113422. https://doi.org/10.1016/j.indcrop.2021.113422.
- Kumar P, Mahato DK, Kamle M, Borah R et al (2021) Pharmacological properties, therapeutic potential, and legal status of Cannabis sativa L.: An overview. Phytother Res 35(11): 6010–6029.
- Kundu JK, Rouf ASS, Hossain MN et al (2000) Antitumor activity of epifriedelanol from Vitis trifolia. Fitoterapia 71: 577–579. https://doi.org/10.1016/s0367-326x(00)00191-x.
- Kundu S, Salma U, Ali MN et al (2018) Development of transgenic hairy roots and augmentation of secondary metabolites by precursor feeding in Sphagneticola calendulacea (L.) Pruski. Ind Crops Prod 121: 206–215. https://doi.org/10.1016/j.indcrop.2018.05.009.
- Lan X, Quan H (2010) Hairy root culture of Przewalskia tangutica for enhanced production of pharmaceutical tropane alkaloids. J Med Plants Res 4(14):1477-1481.
- Ligresti A, Moriello AS, Starowicz K et al (2006) Antitumor activity of plant cannabinoids with emphasis on the effect of cannabidiol on human breast carcinoma. J Pharmacol Exp Ther 318:1375–1387.
- Lima KSB, Silva MEGDC, Araújo TCL et al (2021) Cannabis roots: Pharmacological and toxicological studies in mice. J Ethnopharmacol 271: 113868. https://doi.org/10.1016/j.jep.2021.113868
- Mahendran G, Verma N, Singh M (2022b) Elicitation enhances swerchirin and 1,2,5,6-tetrahydroxyxanthone production in hairy root cultures of Swertia chirayita (Roxb.) H. Karst. Ind Crops and Prod 177, 114488. https://doi.org/10.1016/j.indcrop.2021.114488.
- Mahendran G, Verma N, Singh S et al (2022a) Isolation and characterization of a novel xanthone from the hairy root cultures of Swertia chirayita (Roxb.) H. Karst. and its biological activity. Ind Crops Prod 176:114369. https://doi.org/10.1016/j.indcrop.2021.114369.
- Makowczyńska J, Kalemba D, Skała E (2021) Establishment of Codonopsis pilosula (Franch.) Nannf. transformed roots, influence of the culture conditions on root growth and production of essential oil. Ind Crops Prod 165: 113446. https://doi.org/10.1016/j.indcrop.2021.113446.
- Matvieieva NA, Morgun BV, Lakhneko OR (2020) Agrobacterium rhizogenes-mediated transformation enhances the antioxidant potential of Artemisia tilesii Ledeb. Plant Physiol Biochem 152:177-183. https://doi.org/10.1016/j.plaphy.2020.04.020.
- McAllister SD, Christian RT, Horowitz MP (2007) Cannabidiol as a novel inhibitor of Id-1 gene expression in aggressive breast cancer cells. Mol Cancer Ther 6:2921–2927.
- Menezes PMN, de Lima Araújo TC, Pereira ECV et al (2021) Investigation of antinociceptive, antipyretic, antiasthmatic, and spasmolytic activities of Brazilian Cannabis sativa L. roots in rodents. J Ethnopharmacol 278:114259. https://doi.org/10.1016/j.jep.2021.114259
- Miao Y, Hu Y, Yi S, Zhang X, Tan N (2021) Establishment of hairy root culture of Rubia yunnanensis Diels: production of Rubiaceae-type cyclopeptides and quinones. J Biotechnol 341:21-29. doi: 10.1016/j.jbiotec.2021.09.004.
- Msengwa ZS, Rwegoshora F, Credo D (2023) Epifriedelanol is the key compound to antibacterial effects of extracts of Synadenium glaucescens (Pax) against medically important bacteria. Front Trop Dis 3:1104543. https://doi.org/10.3389/fitd.2022.1104543.
- Muhammad Zen NA, Kobtrakul K, Khositanon P et al (2023) Vegetable oil-based Cannabis: Its cannabinoid profiling and photoprotective effect on UVA-Irradiated human skin keratinocytes. Thai J Pharm Sci 46(6):720-733.
- Murovec J, Eržen JJ, Flajšman M, Vodnik D (2022) Analysis of morphological traits, cannabinoid profiles, THCAS gene sequences, and photosynthesis in wide and narrow leaflet high-cannabidiol breeding populations of medical Cannabis. Front Plant Sci 13: 786161. https://doi.org/10.3389/fpls.2022.786161.
- Nemoto K, Hara M, Suzuki M et al (2009) Function of the aux and rol genes of the Ri plasmid in plant cell division in vitro. Plant Signal Behav 4(12):1145-1147. https://doi.org/10.4161/psb.4.12.9904.
- Noppawan P, Bainier C, Lanot A (2022) Effect of harvest time on the compositional changes in essential oils, cannabinoids, and waxes of hemp (Cannabis sativa L). R. Soc Open Sci 9(6), 211699. https://doi.org/10.1098/rsos.211699.
- Piątczak E, Jeleń A, Makowczyńska J et al (2019) Establishment of hairy root cultures of Rehmannia elata NE Brown ex Prain and production of iridoid and phenylethanoid glycosides. Ind Crops Prod 137:308-314. https://doi.org/10.1016/j.indcrop.2019.05.022.
- Queiroga CL, Silva GF, Dias PC et al (2000) Evaluation of the antiulcerogenic activity of friedelan-3β-ol and friedelin isolated from Maytenus ilicifolia (Celastraceae). J Ethnopharmacol 72(3): 465-468. https://doi.org/10.1016/s0378-8741(00)00237-3.
- Rai KK, Pandey N, Rai N et al (2021) Salicylic acid and nitric oxide: insight into the transcriptional regulation of their metabolism and regulatory functions in plants. Front Agron 3:781027. https://doi.org/10.3389/fagro.2021.781027.
- Reis, A, Boutet-Mercey S, Massot S et al (2019). Isoflavone production in hairy root cultures and plantlets of Trifolium pratense. Biotechnol Lett 41(3):427-442. https://doi.org/10.1007/s10529-018-02640-8.
- Robertson KJ, Brar R, Randhawa P et al (2023) Opportunities and challenges in waste management within the medicinal cannabis sector. Ind Crops Prod 197:116639. https://doi.org/10.1016/j.indcrop.2023.116639.
- Ru M, Li Y, Guo M, Chen L (2022) Increase in rosmarinic acid accumulation and transcriptional responses of synthetic genes in hairy root cultures of Prunella vulgaris induced by methyl jasmonate. Plant Cell Tiss Organ Cult 149:371–379. https://doi.org/10.1007/s11240-022-02273-w.
- Ryz NR, Remillard DJ, Russo EB (2017) Cannabis roots: a traditional therapy with future potential for treating inflammation and pain. Cannabis Cannabinoid Res 2(1):210-216. https://doi.org/10.1089/can.2017.0028.
- Saravanakumar A, Aslam A, Shajahan A (2012) Development and optimization of hairy root culture systems in Withania somnifera (L.) Dunal for withaferin-A production. Afr J Biotechnol 11 (98): 16412-16420. https://doi.org/10.5897/AJB11.3867.
- Sarkar J, Misra A, Banerjee N (2020) Genetic transfection, hairy root induction and solasodine accumulation in elicited hairy root clone of Solanum erianthum D. Don. J Biotechnol 323:238-245. https://doi.org/10.1016/j.jbiotec.2020.09.002
- Sathasivam R, Choi M, Radhakrishnan R et al (2022) Effects of various Agrobacterium rhizogenes strains on hairy root induction and analyses of primary and secondary metabolites in Ocimum basilicum. Front. Plant Sci 13: 983776. https://doi.org/10.3389/fpls.2022.983776.
- Sharifzadeh Naeini M, Naghavi MR, Bihamta MR (2021) Production of some benzylisoquinoline alkaloids in Papaver armeniacum L. hairy root cultures elicited with salicylic acid and methyl jasmonate. In Vitro Cell Dev Biol-Plant 57:261–271 https://doi.org/10.1007/s11627-020-10123-7.
- Shi M, Liao P, Nile SH, Georgiev MI, Kai G (2021) Biotechnological exploration of transformed root culture for value-added products. Trends in Biotechnology 39(2):137-149. https://doi.org/10.1016/j.tibtech.2020.06.012.
- Silva-Santos, L, Neto LP, Corte-Real N (2023) Elicitation with methyl jasmonate and salicylic acid increase essential oil production and modulate physiological parameters in Lippia alba (Mill) NE Brown (Verbenaceae). J Plant Growth Regul (2023). https://doi.org/10.1007/s00344-023-10976-3.
- Skała E, Olszewska MA, Makowczyńska J, Kicel A (2022) Effect of sucrose concentration on Rhaponticum carthamoides (Willd.) Iljin transformed root biomass, caffeoylquinic acid derivative, and flavonoid production. Int J Mol Sci 23:13848. https://doi.org/10.3390/ijms232213848.
- Solis-Castañeda GJ, Zamilpa A, Cabañas-García E (2020) Identification and quantitative determination of feruloyl-glucoside from hairy root cultures of Turbinicarpus lophophoroides (Werderm.) Buxb. & Backeb. (Cactaceae). In Vitro Cell Dev Biol-Plant 56: 8–17. https://doi.org/10.1007/s11627-019-10029-z
- Sorokin A, Yadav NS, Gaudet D, Kovalchuk I (2020) Transient expression of the β-glucuronidase gene in Cannabis sativa varieties. Plant Signal Behav 15(8):1780037. https://doi.org/10.1080/15592324.2020.1780037.
- Sunil C, Duraipandiyan V, Ignacimuthu S, Al-Dhabi NA (2013) Antioxidant, free radical scavenging and liver protective effects of friedelin isolated from Azima tetracantha Lam. leaves. Food Chem 139(1-4):860-865. https://doi.org/10.1016/j.foodchem.2012.12.041.
- Sunil C, Irudayaraj SS, Duraipandiyan V et al (2021) Friedelin exhibits antidiabetic effect in diabetic rats via modulation of glucose metabolism in liver and muscle. J Ethnopharmacol 268:113659. https://doi.org/10.1016/j.jep.2020.113659.
- Suttinee Y (2022) Cannabis market in Thailand seen growing to $1.2 billion by 2025. https://www.bloomberg.com/news/articles/2022-07-21/cannabis-market-in-thailand-seen-growing-to-1-2-billion-by-2025
- Thiruvengadam M, Praveen N, John KM et al (2014) Establishment of Momordica charantia hairy root cultures for the production of phenolic compounds and determination of their biological activities. Plant Cell Tiss Organ Cult 118:545–557.
- Tusevski O, Petreska Stanoeva J, Stefova M et al (2019) State of antioxidant systems and phenolic compounds production in Hypericum perforatum L. hairy roots. Acta Physiol Plant 41:132. https://doi.org/10.1007/s11738-019-2919-5
- Wahby I, Arráez‐Román D, Segura‐Carretero A et al (2006) Analysis of choline and atropine in hairy root cultures of Cannabis sativa L. by capillary electrophoresis‐electrospray mass spectrometry. Electrophoresis 27(11):2208-2215. https://doi.org/10.1002/elps.200500792.
- Wahby I, Caba JM, Ligero F (2013) Agrobacterium infection of hemp (Cannabis sativa L.): establishment of hairy root cultures. J Plant Interact 8(4): 312-320. https://doi.org/10.1080/17429145.2012.746399.
- Wahby I, Caba JM, Ligero F (2017) Hairy root culture as a biotechnological tool in C. sativa. In: Chandr S, Lata H, ElSohly M (eds) Cannabis sativa L. - Botany and Biotechnology. Springer, Cham. https://doi.org/10.1007/978-3-319-54564-6_14
- Yang, H.H.; Son, J.K.; Jung, B.; Zheng, M.; Kim, J.R. (2011). Epifriedelanol from the root bark of Ulmus davidiana inhibits cellular senescence in human primary cells. Planta Med. 77(5), 441-449. https://doi.org/10.1055/s-0030-1250458.
- Yang, J., Fa, J., and Li, B. (2017) Apoptosis induction of epifriedelinol on human cervical cancer cell line. Afr J Tradit Complement Alter Med 14(4):80-86. https://doi.org/10.21010/ajtcam.v14i4.10.
- Yousefian Z, Golkar P, Mirjalili MH (2021) Production enhancement of medicinally active coumarin and phenolic compounds in hairy root cultures of Pelargonium sidoides: the effect of elicitation and sucrose. J Plant Growth Regul 40:628-641.
- Zhang B, Chen M, Pu S et al (2020) Identification of secondary metabolites in Tripterygium wilfordii hairy roots and culture optimization for enhancing wilforgine and wilforine production. Ind Crops Prod 148: 112276. https://doi.org/10.1016/j.indcrop.2020.112276.
- Zhao S, Tang H (2020) Enhanced production of valtrate in hairy root cultures of Valeriana jatamansi Jones by methyl jasmonate, jasmonic acid and salicylic acid elicitors. Not Bot Horti Agrobot Cluj Napoca 48: 839–848. https://doi.org/10.15835/nbha48211891.