Involvement of Interlukin-17A (IL-17A) Gene Polymorphism and Interlukin-23 (IL-23) level in the Development of Peri-Implantitis

doi:10.21203/rs.3.rs-3559562/v1

Download PDF

Research

Involvement of Interlukin-17A (IL-17A) Gene Polymorphism and Interlukin-23 (IL-23) level in the Development of Peri-Implantitis

https://doi.org/10.21203/rs.3.rs-3559562/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background

Dental implantation has been practiced since ancient times and has gone through several stages. Dentists use dental implants to support dental prostheses such as crowns, bridges, dentures, face prostheses, or as an orthodontic anchor. Thus, the purpose of this study to detect the role of the immune-genetic variation of IL-17A and related inflammatory cytokine (IL-23) in the initiation and progress of peri implantitis.

Material and Methods

This cross-sectional study included 80 subjects (15 peri-implantitis patients, 35 successful implants, and 30 healthy controls); their mean age was (43.91 ± 11.33) years. Blood samples were collected from all subjects (patients with peri-implantitis, successful implants, and healthy controls) attending the Department of Oral and Maxillofacial Surgery in the Dental College Teaching Hospital, Baghdad University, Baghdad, Iraq. The blood sample detects gene polymorphisms in interleukin-17A by a polymerase chain reaction. An enzyme-linked immunosorbent assay was carried out to estimate the Peri-implant sulcus fluid levels of interleukin-23.

Result

The current study revealed an obvious significant elevation in the mean level of interleukin-23 in the peri-implantitis patient's group more than its level in the successful implant and control groups (P˂ 0.05). In addition, the result showed that A/A genotype is associated significantly with peri-implantitis OR (95%confidence interval) = 6.9 (1.7121 to 27.4638) folds increase risk of peri-implantitis) (p = 0.0065), while G/A genotype had OR 4.9 (0.9539 to 24.9394) folds increased risk of peri-implantitis, (p = 0.0572). But it was not statistically significant and G/G genotype had a one-fold increase risk of peri-implantitis.

Conclusion

The increased level of inflammatory cytokine (interleukin-23) might add to the systemic inflammatory burden a predisposing factor, which may lead to impaired osseointegration and subsequent bone loss or implant failure. In addition, IL-17A gene polymorphism may play a role in peri-implant disease susceptibility, especially in persons carrying the rs2275913 A allele at a higher risk of developing peri-implantitits as compared with those carrying the G allele.

Health sciences/Diseases/Dental diseases/Pulpitis

Interlukin-17A

Interlukin-23

cytokine

Gene Polymorphism

Peri-Implantitis

allele

Dental implants are one of the most well-established and tried-and-true procedures in contemporary dentistry, and they are used to restore teeth that have been knocked out or lost. To support a dental prosthesis such as a crown, bridge, denture, or face prosthesis, or to operate as an orthodontic anchor, a dental implant is a surgical component that interacts with the bone of the jaw or skull ^1,2. It is also known as an endosseous implant or fixture. Titanium and its alloys are the most often used implant materials because they have a history of being effective in terms of their integration with the tissue around them. Titanium is also the most common implant material. Osseointegration is a biological process that must take place in order for materials such as titanium to successfully develop a close link with the bones ¹.

Osseointegration is "the direct structural and functional connection between ordered living bone and the surface of a load-carrying implant" ². It allows load-bearing implants to merge with living bone. When host tissue fails to osseointegrate, an implant may fail ³. Implant failures may be divided into early and late failures, or infected and noninfectious failures, based on their aetiology. And may Early failures result from surgical trauma, premature loading, or bacterial infection, while late failures result from the implant's inability to maintain osseointegration and may occur after prosthetics ^3–5. However, tooth extraction and implantation cause an inflammatory response that usually leads to a smooth recovery and implant stability ⁶. Localised inflammatory reactions usually contain and prevent harmful microorganisms, bring cells and their products to a lesion, and start the healing process. Inflammation involves several pathogenic pathways and cell types. Despite the discomfort, these reactions localise a disease and prevent it from spreading ⁷. Pathogenic bacteria may inflame the supporting tissues of dental implants, like natural teeth ⁸. The immune inflammatory response to bacterial stimuli, not bacterial biofilm, causes tissue damage in periimplantitis. Titanium implants cause tissue inflammation over time, according to multiple studies. This may produce mediators that cause local and systemic health concerns ⁹. Peri-implant disease, mucositis, and titis are pathologies of dental implants. Immunological susceptibility to TH I and macrophage reactivity may cause titanium implant failure ⁶. Peri-implantitis is known to cause bone loss and soft tissue irritation surrounding the implant ¹⁰. This exceeds normal biological osseous remodelling. Implant survival and success have plummeted since this syndrome developed ^11–13. Interleukins and TNFs may affect osteonecrosis development, according to many studies^14–16. Pro-inflammatory cytokines include IL-1, IL-6, IL-8, TNF, and INF-. Cytokines start acute phase reactions, immune system activity, central nervous system (CNS) responses, and hormone release or repression. Despite fresh discoveries about cytokines, their various functions are now well understood ^{18, 19}. Cytokine-induced responses are frequently beneficial, but excessive production and activity may be harmful. Pro-inflammatory cytokines may cause hypotensive shock, organ failure, and death. To manage cytokine production and activity, the body has a more sophisticated system of checks and balances than endocrine mechanisms ¹⁹. This mechanism regulates individual cytokines. CD4+ cells activate effector populations, which may cause inflammation ²⁰. In periodontal gingival tissues, two effector CD4+ T cell subpopulations, the Th2 responses, trigger the adaptive immune response. Studies suggest Th0 and Th1 responses are more prevalent in periodontitis and periimplantitis gingival issues. TH17's generation of IL-17 with IL-23 shifted this paradigm. IL-23 increases Th17 lineage proliferation and immune-related tissue disorders. IL-23 and periodontitis-related Th17 pathways ^{21, 22}. IL-17 is a unique pro-inflammatory cytokine family with six isoforms and five receptors (L-17RA, IL-17RB, IL-17RC, IL-17RD, and IL-17RSEF). IL-17, generated by CD4+ Th17 subsets, promotes autoimmune and inflammatory disorders. IL-17 receptors may trigger immune-mediated inflammation. IL-17 boosts pro-inflammatory cytokines, neutrophils, and monocytes. IL17 is on 6p12.1 ²³. Understanding that IL-17A may increase the synthesis of RANKL, GMCSF, ICAM1, and prostaglandin E2 is crucial ²⁴.

Patients group

Fifteen total number of patients with peri-implantitis were enrolled in this cross-sectional study, (10 male and 5 female), their age range (28-56) years.

Successful dental implants group

Other 35 subjects with working “successful dental implants” (20 male and 15 female), their age range (21- 66) years.

Study samples were taken from the Department of Oral and Maxillofacial Surgery at the Dental College Teaching Hospital/ Baghdad University. In the period between March 2021 to November 2021.

The clinical dental implants parameters were measured under the supervision of specialized dentists.

All patients were subjected to a questionnaire including name, age, medical history, medication used and smoking or alcohol consumption.

Healthy control group (without dental implants)

Thirty apparently healthy volunteers with natural teeth within the qualifying criteria (19) males and (11) females. All of them didn’t have a history of medical problems or clinical evidence of any chronic or acute diseases; their ages ranged between (24-68) years.

The study protocol was approved by the scientific committee at the Basic Science Department/College of Dentistry/ University of Baghdad, on 20/03/2021, and all patients were given a piece of detailed information relating to the study aims and informed consent was signed to represent the patient's acceptance in order to participate in this study.

Inclusion criteria

Selection of cases based on the followings:

The patient is in good general health and has no history of chronic inflammatory or autoimmune diseases or other conditions that effect the interleukins levels.

1.Should has one or more than one implant unit

2.Patients with peri-implantitis had the following criteria:

a) the presence of peri-implant inflammation,

b) Following early healing, there is radiographic evidence of bone loss.

c)Increasing probing depth in comparison to probing depth data recorded after the prosthetic reconstruction was placed.

d)In the absence of previous radiographs, a radiographic bone level of ≥ 3 mm combined with BOP and probing depths of ≥ 6 mm indicates peri-implantitis ^25,26.

One implant design was used for all patients (Dentium).

Exclusion criteria

Certain measures were avoided including: -

1.History of systemic illness related to periodontal status, diabetes or with a history of cardiovascular and metabolic bone diseases or other conditions that effect the interleukins levels.

2.Smokers were excluded.

3.Bad oral hygiene and plaque

4.Antibiotics, antiviral and/or anti-inflammatory medication administration in the last 3 months ²⁶.

Insilico primer design:

The source of all primers used in this study was Macrogen® (Korea). The name, sequence and product size given is 542 bp with Sequence

F- ATGACACCAGAAGACCTACAT, R- CCTGGATCTCCATAGTCAGAA

Blood collection:

3 ml of venous blood were be drawn from patients under the aseptic technique and was being added to the EDTA tube (1.5 mg/ml) then kept at -70 ° C were used the IL-17A gene detection.

Peri-implant sulcular fluid collection

90 minutes prior to the sample collection, patients were prepared for sample collection between 9:00 and 11:00 a.m. The patients were told to avoid eating and brushing their teeth. The areas that were being targeted were washed down with water, given some space using cotton rollers, and then given a little misting of air. For the purpose of collecting fluid samples from the test groups, "Perio Paper" was utilised. Following the removal of the supragingival plaque with the dry gauze, a normal paper strip was inserted into the sulcus and allowed to remain there for a period of thirty seconds. The part of the sample that was stained with blood was removed. The paper strips were immediately put in sterile Eppendorf tubes containing 0.5 ml of preservative (PBS), centrifuged at 3000 rpm for 10 minutes, and then kept at -80° C until laboratory analysis ²⁶. This was done to maintain the integrity of the material and keep it in its original state. The evaluation and identification of IL-23 in the peri-implant sulcular fluid specimens were carried out with the use of enzyme-linked immunosorbent assay (ELISA) kits.

Molecular Detection of gene IL-17A polymorphism

DNA was extracted from patients with peri-implantitis, patients who had successful implants, and healthy control groups. Amplification of IL-17A was performed using a new set of primers in order to amplify 542 base pairs for usage in the sequencing section. Target SNPs will be involved in this area. In a PCR amplification reaction that was fifty microliters in volume, there was 25 microliters of OneTaq (NEB®) master mix, 8 microliters of DNA sample, 4 microliters of each primer at a concentration of 10 pmol/l, and 9 microliters of free-nuclease water. The reaction carried out using the PCR conditions that are most suitable for this gene.

Gel electrophoresis

After PCR amplification, agarose gel electrophoresis was adopted to confirm the presence of amplification.

A. Agarose gel electrophoresis components

1. Tris-Acetate EDTA Buffer (10X solution)

Tris-Acetate EDTA solution was a “ready-to-use premixed solution that was used to dissolve agarose for gel preparation and as a buffer for electrophoresis after being diluted with DW to 1X strength (Carl ROTH® (Germany)”.

2. Red Safe™ Nucleic acid staining solution:

When attached to DNA or RNA, it exhibits green fluorescence, which is a stain for identifying nucleic acid in agarose gels (20,000x) Intron® (South Korea).

B. Preparation of agarose gel 2%

1. Using a volumetric cylinder, a volume of 1X TAE buffer containing sixty microliters was measured.

2. Transfer 1.2 milligrammes of agarose powder, which corresponds to 2%, to a flask.

3. In order to dissolve the agarose, a 1X concentration of TAE buffer was poured over it.

4. The solution was brought to a boil in a microwave oven, and remained at that temperature until all of the gel particles had melted.

5. After waiting for the solution to reach 70 degrees Celsius in temperature, 4 microliters of the DNA staining dye RedSafe was added to the mixture.

6. The temperature of the solution has been brought all the way down to fifty degrees Celsius.

7. The agarose solution was put into the gel tray that had been prepared. At room temperature (between 20 and 25 degrees Celsius), the solution was allowed to set for a period of thirty minutes.

8. Four hundred and sixty millilitres of 1X TAE were poured into the tank.

Molecular sequencing of IL-17A (rs2275913)

In order to determine the single nucleotide polymorphism, more than 40 µ of PCR product from each sample was sent to macrogen-Korea for sequencing using the Sanger technique. The Geneious Prime programme was used to do an analysis of the sequence FASTA files, and the results were aligned to the RefSeq entry for the IL-17A gene, which has the accession number NG_033021.1.

Statistical analysis

The daily procedure of downloading data from the case sheets of the participants into the software of Microsoft Office Excel 2013 was a component of this project. (SPSS) is an abbreviation for the Statistical Package for Social Science, which was used to do the analysis of the data. The chi-square test is used to determine whether or not there is a significant link between two qualitative factors and whether or not the anticipated cell count has less than five but not more than twenty percent. (Cary, North Carolina, USA.).

The age of all patients with implantitits, successful implants and healthy control groups ranged from (21-68) years and the mean ±SD age was 43.9±11.33 years. Thirty-nine patients and control 31(39%) were female and 49 (61%) of males. As illustrated in (Figure 1) and (Figure 2), respectively.

The level of IL-23 in the peri-implant sulcular fluid of 15 patients diagnosed with peri-implantitis was measured and compared to the level of IL-23 in the peri-implant sulcular fluid of 35 successful implant group and 30 healthy individuals who served as the control group. The PISF level of IL-23 revealed a significant rise (P=0.0001) in the group of patients who had peri-implantitis (609.1±17.1). This was in contrast to the healthy control group and the successful implant group, which had levels of (120.0±13.03) and (143.4±12.3) respectively. In accordance with the findings shown in Table 1.

Table 1: PISF IL-23 levels in healthy and peri-implantitis patients.

One way ANOVA	Peri-implantitis groups	Successful implant groups	Control groups	P. value
Markers
peri-implant sulcular fluid level of IL 23 (pg/ml)	Mean±SE	Mean±SE	Mean±SE	0.0001
	609.1±17.1	143.4±12.3	120.0±13.03

Molecular test:

Sequencing for the genotype of IL-17A Polymorphism (-197 G/A) (rs2275913) in patients with peri-implantitits, successful Implants and healthy control groups

Table (2) show the frequency of the GG, GA, and AA genotypes, of IL-17A gene in patients with peri-implantitis, successful implants and Healthy control groups, which were (50.0%), (17.9%), and (5.6%) respectively in peri-implantitis patients compared to (31.3%), (53.6%), and (41.7%) successful implants, and compared to (18.8%), (28.6%), (52.8%) healthy controls. Significant differences in the frequency of the mutant homozygous genotype (AA) were observed between the two groups (P=0.0001).

The difference was more prominent at the allele level, where the frequency of a mutant A allele in peri-implantitis group was more than in the successful implants and healthy control groups with a highly significant difference. Where the frequency of a mutant A allele in peri-implantitis group was more than in the successful implants and healthy control groups with a highly significant difference. As illustrated in the Table 2, Table 3, Figure 3, Figure 4, respectively.

Table 2: Genotype frequency of IL-17A gene in peri-implantitis patient, successful implant, and healthy control groups.

Genotype	Peri-implantitis (n=15)	successful implant (n=35)	healthy control (n=30)
AA	8 (50.0) %	5 (31.3)%	3 (18.8) %
GA	5 (17.9) %	15 (53.6)%	8 (28.6)%
GG	2 (5.6)%	15 (41.7)%	19 (52.8)%
Chi square test=172, P. value =0.0002.

Table 3: The frequency of different alleles of IL-17A polymorphism in peri-implantitis patients and successful implants and healthy controls group

Allele	Frequency			P. value
Allele	Healthy control	Implant successful	Peri-Implantitis	P. value
G	46 (0.77)%	45 (0.64)%	9 (0.30)%	0.0001
A	14 (0.23)%	25 (0.36)%	21 (0.70)%	0.0001

Table 4, showed that A/A genotype associated significantly with peri-implantitis (6.9 folds increase risk of peri-implantitis), while G/A genotype had 4.9 folds increase risk of peri-implantitis but it was not statistically significant and G/G genotype had one-fold increase risk of peri-implantitis.

Table 4: IL-17A GENE polymorphism (197 G/A) (rs2275913) genotype in patients with peri-implantitis

Genotype	OR (95%CI)	p.value
A/A	6.9 (1.7121 to 27.4638)	0.0065
G/A	4.9 (0.9539 to 24.9394)	0.0572
G/G	1.0	-
OR: odd ratio, CI: confidence interval

Association between IL-17A gene polymorphism (rs2275913) and peri-implant sulcular fluid cytokine levels of IL-23

Table 5, show in the Healthy controls group, it was found that the mean±SD value in these Subjects with the (GG), (GA) and (AA) genotype was (117.57 ±9.32), (128.64 ±13.83), (120.52±11.57) respectively, there was significant differences between genotypes of IL-17A and PISF levels of IL-23. (P=0.010). In the successful implant group, it was found that the mean±SD value in these cases with the (GG), (GA) and (AA) genotype was (135.05 ±15.47), (148.56 ±17.49) and (150.91 ±20.36) respectively, there were no significant differences between genotypes of IL-17A and PISF levels of IL-23 (p=0.0718). In the peri-implantitis group, it was found that the mean±SD value in these cases with the (GG), (GA) and (AA) genotype was (609.02 ±102.14), (609.09±69.18) and (639.78 ±176.51) respectively, there were no significant differences between genotypes of IL-17A and PISF levels of IL-23 (p=0.921).

Table 5: Relationship of IL-17A gene polymorphism with PISF level of IL-23 in the three study groups

Group	IL-17A gene polymorphism	Mean ± SD	P-value
		IL-23
Healthy control	GG	117.57 ±9.32	0.010
	GA	128.64 ±13.83
	AA	120.52±11.57
Implant successful	GG	135.05 ±15.47	0.0718
	GA	148.56 ±17.49
	AA	150.91 ±20.36
Peri-Implantitis	GG	609.02 ±102.14	0.921
	GA	609.09 ±69.18
	AA	639.78 ±176.51

Peri-implantitis: inflammation in the peri-implant connective tissue and bone loss around dental implants Peri-implantitis may develop early in follow-up and progress non-linearly and acceleratingly ²⁶. Regarding age and gender, this study found that there is no significant difference between peri-implantitis patients and successful implanted healthy controls. The mean age of the patients was 39.938.21 years. This study agrees with Renvert et al. ²⁵, Alsaadi et al. ²⁷, who showed that age and gender have nothing to do with the peri-implantitis and suggest that the patient's history, cardiovascular disease, and Smoking are the reasons for the peri-implantitis. In addition, Dreyer et al. ²⁸ showed no association between age or gender in patients with maxillary implants and peri-implantitis. Schoenbaum et al. ²⁹ reported that the patients’ gender, unlike age, did not have any impact on the success of the implant procedure. Age and gender are not factors that alone affect peri-implant disease and dental implant survival. Many Systemic disorders, such as osteoporosis, hypothyroidism, diabetes, hypertension, and heart ailments, a population or individual genetic polymorphism occurs when the DNA sequence differs.

Periimplantitis comes from the gingival plexus, a collection of blood vessels in the gingival corium. It is a physiological fluid and an inflammatory exudate that surround dental implants. The constituents of PISF have the potential to be used in the detection of subclinical changes in connective tissue remodelling, inflammatory cell recruitment, inflammatory mediators and biomarkers, and tissue metabolism ³⁰. Pro-inflammatory IL-23 is well recognised. Its ability to potently promote T-helper type 17 (Th17) proliferation is relevant to numerous inflammatory autoimmune responses and persistent infections. Antigens may also induce IL-23 and other cytokines ^{31, 32}. This study examined IL-23 levels in PISF from healthy individuals, peri-implantitis patients, and successful implant recipients using an ELISA kit. The patient group with peri-implantitis had a PISF IL-23 level that was statistically significantly greater (P = 0.0001) than the healthy control group and the successful implant group.

During peri-implant disease, the IL-23/IL-17 pathway may not work as it should, which could explain why IL-23 levels are high and gingival tissue isn't protected. However, the cause of this dysregulation is unknown, requiring additional research. While the present study were the same as those of Lester et al. ³⁴³, who found a significant increase in IL-23 in GCF and serum from patients with periodontitis and linked it to a faster rate of PPD progression. Unfortunately, no peri-implantitis research exists to compare.

Ohyama et al. ³⁴, Del Buono et al. ³⁵, and Althebeti et al. ³⁶ reported elevated IL-17 and IL-23 in moderate to severe chronic periodontitis, especially around bone loss. According to their results, periodontal inflammatory disorders may activate and stimulate Th17 cells.

Schenkein et al. ³⁷ and Borch et al. ³⁸ studies on periodontal inflammation also confirm our study. Blood and GCF samples show elevated IL-17 and IL-23 levels. Local cytokine production increases systemic inflammation, which promotes periodontal tissue loss, they observed.

The current study agrees with Ju et al. ³⁹, who found that IL-23 caused osteoclasts to form by directly increasing RANK in precursor cells and indirectly increasing RANKL on CD4 T cells, which led to bone resorption. Dutzan et al. ⁴⁰found that periodontal disease-affected tissues overexpressed IL-23 relative to healthy gingival tissues.

Jafarzadeh et al. ⁴¹ hypothesized that increasing IL-23 levels may exacerbate systemic inflammation. This may cause osseointegration failure, bone loss, and cardiovascular difficulties ⁴². Cifcibasi et al. ⁴³ found that periodontal therapy decreased IL-23. Santos et al. ⁴⁴ showed variable results and little IL-23 change following treatment.

IL-23 in gingival crevicular fluid is related to relative attachment loss; hence, it may actively promote periodontal disease. Thus, it is a marker for periodontal inflammation during tissue degradation ⁴⁵.

The amount of IL-23 in gingival crevicular fluid is linked to the loss of tissue around the implant, which shows that this cytokine causes inflammation.

DNA sequence differences cause genetic polymorphisms. SNPs, repeats, insertions, deletions, and recombination are examples. Viruses, radiation, and natural processes may produce genetic polymorphisms. Genetic mutations are DNA changes associated with sickness. Humans have the most SNPs. Understanding SNP functions may help us comprehend human phenotypic variability and the genetics of complex human illnesses ⁴⁶. It decided to analysis human blood samples to discover whether the mystery IL-17A cytokine's genetic variation is linked to peri-implantitis. This is the first Iraqi dentistry study on the IL-17A SNP and peri-implantitis. The peri-implantitis group had a significantly higher mutant A allele frequency than the successful implants and healthy control groups.

Unfortunately, there were no studies concerning the IL-17A gene polymorphism in peri-implantitis to compare with the current study. Furthermore, a considerably higher rate of peri-implantitis was observed among people who had AA or GA genotypes, namely A allele-containing genotypes. So, the frequency of the homozygous (mutant) genotype AA in peri-implantitis was much higher than the frequency of the GG genotype and the G allele. These results agree with those of Saraiva et al. ⁴⁷ and Chaudhari et al. ⁴⁸, who reported the presence of allele A in the IL-17 gene polymorphism (-197A/G) for chronic periodontitis in the Indian and Brazilian populations. Patients who have this A allele could be more susceptible to the development of peri-implantitis or another peri-implant disease.

The current study disagrees with Kadkhodazadeh et al. ⁴⁹. In an Iranian community, patients with chronic periodontitis had a higher frequency of the IL-17A CC genotype than healthy controls. Corrêa et al. ⁵⁰ indicated that periodontal disease was related to the IL17A G allele and GG genotype in the Brazilian population.

The findings of this study demonstrated that polymorphisms in IL-17 play a role in the occurrence of peri-implantitis. To date, many studies have investigated the controversial behaviour of IL-17 subgroups (especially IL-17 A and F). However, an agreement has yet to be established concerning the function of this cytokine as a protective agent during local tissue inflammation or as a destructive factor.

Activated CD41 T cells are the main producers of IL-17. However, it has recently been discovered that neutrophils also release this cytokine ⁵¹. It has been revealed that T lymphocytes are linked to bone deterioration via IL-17 production in rheumatoid arthritis ²⁴. IL-17 has been demonstrated to activate epithelial, endothelial, and fibroblastic cells to produce IL-6, IL-8, and PGE2 ⁵². In addition, IL-17 stimulates RANKL production by osteoblasts ⁵³.

Also, T-cell-derived cytokines, receptor activators of NF-kB ligand (RANKL), and receptor activators of NF-kB (RANK) have all been shown to be directly involved in bone metabolism. As IL-17 shares characteristics with IL-1 and TNF-a, it may regulate osteoclast-mediated bone resorption ⁵⁴. According to Espinoza et al. ⁵⁴, who observed that the IL-17A 197A allele is associated with the production of an effective IL-17 and increased affinity for the nuclear factor of activated T cells (NFAT), which is a crucial regulator of the IL-17 promoter gene ⁵⁴.

These findings of the current study suggest that the IL-17A (197A) allele was substantially linked to the peri-implantitis patient group. Subjects with the A allele is at 6.9 times greater risk of developing peri-implantitis than successful implant recipients and healthy control groups (odds ratio = 6.9, confidence interval = 95%). This result agrees with Chaudhari et al. ⁴⁸, who reported that subjects with the A allele are at 5 times greater risk of developing localized aggressive periodontitis than healthy controls (odds ratio = 5.1, confidence interval = 95%).

Positive genotypes and peri-implant illness may have something to do with how IL-17 is released and controlled at the molecular level. Furthermore, Patients carrying the A (rs2275913 G/A) allele were associated with an increased risk for peri-implantitis or other peri-implant diseases as compared to people carrying heterogeneous type GA alleles or wild-type GG alleles. This may be in association rather than being a cause or having a direct effect. However, some investigations have revealed an elevated expression of IL-17 at the location of mild to severe periodontitis ^{32, 33, 40}. Schenkein et al. ³⁷ observed a higher level of IL-17 in the systemic circulation of individuals with localised and widespread aggressive periodontitis.

The current study supports the idea that the polymorphism of the IL-17A (-197 G/A) (rs2275913) genes may be a useful predictor for the pathogenesis of peri-implantitis. Furthermore, the IL-17A GENE polymorphism (197 G/A) (rs2275913) is associated with peri-implantitis susceptibility and may serve as a predictive and prognostic biomarker. The PISF level of IL-23 was significantly higher in the peri-implantitis patients than in successful implants and in the control group. This provides strong evidence that IL-23 plays a major role in the pathogenesis of peri-implantitis and could be causing devastating bone loss.

Data Availability The data that support the findings of this study are available from the corresponding author upon reasonable request.

Conflict of interest: All the authors declare no commercial or financial conflict of interest.

Funding: The authors report no involvement in the research by the sponsor that could have influenced the outcome of this work.

Kuder M, Gelman A, Zenilman JM. Prevalence of Implanted Medical Devices in Medicine Inpatients. Journal of Patient Safety [Internet]. 2018;14(3):153–6. Available from: http://dx.doi.org/10.1097/pts.0000000000000187
Hoellwarth JS, Tetsworth K, Akhtar MA, Al Muderis M. The Clinical History and Basic Science Origins of Transcutaneous Osseointegration for Amputees. Carl AL, editor. Advances in Orthopedics [Internet]. 2022;2022:1–14. Available from: http://dx.doi.org/10.1155/2022/7960559
Ferreira PW, Nogueira PJ, Nobre MA de A, Guedes CM, Salvado F. Impact of Mechanical Complications on Success of Dental Implant Treatments: A Case–Control Study. European Journal of Dentistry [Internet]. 2021;16(01):179–87. Available from: http://dx.doi.org/10.1055/s-0041-1732802
Staedt H, Rossa M, Lehmann KM, Al-Nawas B, Kämmerer PW, Heimes D. Potential risk factors for early and late dental implant failure: a retrospective clinical study on 9080 implants. International Journal of Implant Dentistry [Internet]. 2020;6(1). Available from: http://dx.doi.org/10.1186/s40729-020-00276-w
Pesce P, Del Fabbro M, Modenese L, Sandron S, Francetti L, Isola G, et al. Influence of implant diameter on implant survival rate and clinical outcomes in the posterior area: a systematic review and meta-analysis. BMC Oral Health [Internet]. 2023;23(1). Available from: http://dx.doi.org/10.1186/s12903-023-02962-8
Lechner J, Noumbissi S, von Baehr V. Titanium implants and silent inflammation in jawbone—a critical interplay of dissolved titanium particles and cytokines TNF-α and RANTES/CCL5 on overall health? EPMA Journal [Internet]. 2018;9(3):331–43. Available from: http://dx.doi.org/10.1007/s13167-018-0138-6
Komi DEA, Khomtchouk K, Santa Maria PL. A Review of the Contribution of Mast Cells in Wound Healing: Involved Molecular and Cellular Mechanisms. Clinical Reviews in Allergy & Immunology [Internet]. 2019;58(3):298–312. Available from: http://dx.doi.org/10.1007/s12016-019-08729-w
Lorusso F, Noumbissi S, Francesco I, Rapone B, Khater AGA, Scarano A. Scientific Trends in Clinical Research on Zirconia Dental Implants: A Bibliometric Review. Materials [Internet]. 2020;13(23):5534. Available from: http://dx.doi.org/10.3390/ma13235534
Pokrowiecki R, Mielczarek A, Zaręba T, Tyski S. Oral microbiome and peri-implant diseases: where are we now? Therapeutics and Clinical Risk Management [Internet]. 2017;Volume 13:1529–42. Available from: http://dx.doi.org/10.2147/tcrm.s139795
Shah DrSM, Shetty DrD, Dharmadhikari DrS. Periimplant diseases and its treatment modalities: A review. International Journal of Applied Dental Sciences [Internet]. 2021;7(1):499–507. Available from: http://dx.doi.org/10.22271/oral.2021.v7.i1g.1176
Chrcanovic BR, Kisch J, Larsson C. Retrospective clinical evaluation of 2- to 6‐unit implant‐supported fixed partial dentures: Mean follow‐up of 9 years. Clinical Implant Dentistry and Related Research [Internet]. 2020;22(2):201–12. Available from: http://dx.doi.org/10.1111/cid.12889
Tavelli L, Barootchi S, Avila-Ortiz G, Urban IA, Giannobile WV, Wang H. Peri‐implant soft tissue phenotype modification and its impact on peri‐implant health: A systematic review and network meta‐analysis. Journal of Periodontology [Internet]. 2020;92(1):21–44. Available from: http://dx.doi.org/10.1002/jper.19-0716
Pimentel SP, Shiota R, Cirano FR, Casarin RCV, Pecorari VGA, Casati MZ, et al. Occurrence of peri-implant diseases and risk indicators at the patient and implant levels: A multilevel cross‐sectional study. Journal of Periodontology [Internet]. 2018;89(9):1091–100. Available from: http://dx.doi.org/10.1002/jper.17-0599
Velkovski V, Shabani I, Kamnar V, Gavrilovski A, Todorova T, Doksevska-Bogojevska M, et al. Analysis of Results After Surgical Application of Bone Marrow Aspirate Stem Cell Concentrate in the Treatment of Avascular Necrosis of the Femoral Head. PRILOZI [Internet]. 2023;44(1):79–87. Available from: http://dx.doi.org/10.2478/prilozi-2023-0009
Lombardi G, Ziemann E, Banfi G. Physical Activity and Bone Health: What Is the Role of Immune System? A Narrative Review of the Third Way. Frontiers in Endocrinology [Internet]. 2019;10. Available from: http://dx.doi.org/10.3389/fendo.2019.00060
Inoue K, Hu X, Zhao B. Regulatory network mediated by RBP-J/NFATc1‐miR182 controls inflammatory bone resorption. The FASEB Journal [Internet]. 2019;34(2):2392–407. Available from: http://dx.doi.org/10.1096/fj.201902227r
Petkovic-Curcin A, Zeljic K, Cikota-Aleksic B, Dakovic D, Tatic Z, Magic Z. Association of Cytokine Gene Polymorphism with Peri-implantitis Risk. The International Journal of Oral & Maxillofacial Implants [Internet]. 2017;32(5):e241–8. Available from:http://dx.doi.org/10.11607/jomi.5814
Theodossiou SK, Schiele NR. Models of tendon development and injury. BMC Biomedical Engineering [Internet]. 2019;1(1). Available from: http://dx.doi.org/10.1186/s42490-019-0029-5
Wu G, Xu G, Chen D-W, Gao W-X, Xiong J-Q, Shen H-Y, et al. Hypoxia Exacerbates Inflammatory Acute Lung Injury via the Toll-Like Receptor 4 Signaling Pathway. Frontiers in Immunology [Internet]. 2018;9. Available from: http://dx.doi.org/10.3389/fimmu.2018.01667
Zhu J. T Helper Cell Differentiation, Heterogeneity, and Plasticity. Cold Spring Harbor Perspectives in Biology [Internet]. 2017;10(10):a030338. Available from: http://dx.doi.org/10.1101/cshperspect.a030338
Shi J-L, Zheng Z-M, Chen M, Shen H-H, Li M-Q, Shao J. IL-17: an important pathogenic factor in endometriosis. International Journal of Medical Sciences [Internet]. 2022;19(4):769–78. Available from: http://dx.doi.org/10.7150/ijms.71972
Wang C, Wang L, Hu J, Li H, Kijlstra A, Yang P. Increased Expression of IL-23 Receptor (IL-23R) in Vogt–Koyanagi–Harada (VKH) Disease. Current Eye Research [Internet]. 2018;43(11):1369–73. Available from: http://dx.doi.org/10.1080/02713683.2018.1485952
Wang Y, Li W, Zhao T, Zou Y, Deng T, Yang Z, et al. Interleukin-17-Producing CD4 + T Cells Promote Inflammatory Response and Foster Disease Progression in Hyperlipidemic Patients and Atherosclerotic Mice. Frontiers in Cardiovascular Medicine [Internet]. 2021;8. Available from: http://dx.doi.org/10.3389/fcvm.2021.667768
Li X, Bechara R, Zhao J, McGeachy MJ, Gaffen SL. IL-17 receptor–based signaling and implications for disease. Nature Immunology [Internet]. 2019;20(12):1594–602. Available from: http://dx.doi.org/10.1038/s41590-019-0514-y
Renvert S, Persson GR, Pirih FQ, Camargo PM. Peri-implant health, peri‐implant mucositis, and peri‐implantitis: Case definitions and diagnostic considerations. Journal of Clinical Periodontology [Internet]. 2018;45(S20). Available from: http://dx.doi.org/10.1111/jcpe.12956
Scortecci GM, Doglioli P, Philip P, Binderman I. Biological Aspects. Basal Implantology [Internet]. 2019;35–52. Available from: http://dx.doi.org/10.1007/978-3-319-44873-2_2
Alsaadi G, Quirynen M, Komárek A, Van Steenberghe D. Impact of local and systemic factors on the incidence of oral implant failures, up to abutment connection. Journal of Clinical Periodontology [Internet]. 2007;34(7):610–7. Available from: http://dx.doi.org/10.1111/j.1600-051x.2007.01077.x
Dreyer H, Grischke J, Tiede C, Eberhard J, Schweitzer A, Toikkanen SE, et al. Epidemiology and risk factors of peri-implantitis: A systematic review. Journal of Periodontal Research [Internet]. 2018;53(5):657–81. Available from: http://dx.doi.org/10.1111/jre.12562
Schoenbaum T, Moy P, Aghaloo T, Elashoff D. Risk Factors for Dental Implant Failure in Private Practice: A Multicenter Survival Analysis. The International Journal of Oral & Maxillofacial Implants [Internet]. 2021;36(2):388–94. Available from: http://dx.doi.org/10.11607/jomi.8983
Ghallab NA. Diagnostic potential and future directions of biomarkers in gingival crevicular fluid and saliva of periodontal diseases: Review of the current evidence. Archives of Oral Biology [Internet]. 2018;87:115–24. Available from: http://dx.doi.org/10.1016/j.archoralbio.2017.12.022
Li H, Tsokos GC. IL-23/IL-17 Axis in Inflammatory Rheumatic Diseases. Clinical Reviews in Allergy & Immunology [Internet]. 2020;60(1):31–45. Available from: http://dx.doi.org/10.1007/s12016-020-08823-4
Gayathri S, Arunima P, Kumar KJ. Effect of Initial Periodontal Therapy on Serum Nitric Oxide Levels in Chronic Periodontitis Patients with or without Type 2 Diabetes Mellitus. The Journal of Contemporary Dental Practice [Internet]. 2019;20(2):197–203. Available from: http://dx.doi.org/10.5005/jp-journals-10024-2497
Lester SR, Bain JL, Johnson RB, Serio FG. Gingival Concentrations of Interleukin-23 and ‐17 at Healthy Sites and at Sites of Clinical Attachment Loss. Journal of Periodontology [Internet]. 2007;78(8):1545–50. Available from: http://dx.doi.org/10.1902/jop.2007.060458
Ohyama H, Kato-Kogoe N, Kuhara A, Nishimura F, Nakasho K, Yamanegi K, et al. The Involvement of IL-23 and the Th17 Pathway in Periodontitis. Journal of Dental Research [Internet]. 2009;88(7):633–8. Available from: http://dx.doi.org/10.1177/0022034509339889
Del Buono W. Effect of non-surgical periodontal therapy on IL-1β, IL-9, PDGF, and VEGF levels in gingival crevicular fluid in patients with severe chronic periodontitis. 2018; Available from: http://dx.doi.org/10.26226/morressier.5ac383202afeeb00097a4424
Mankar K, Bawankar P. Mechanisms Linking Periodontal Disease and Cardiovascular Disease: A Review and Update. Galore International Journal of Health Sciences and Research [Internet]. 2021;6(2):13–24. Available from: http://dx.doi.org/10.52403/gijhsr.20210403
Schenkein HA, Koertge TE, Brooks CN, Sabatini R, Purkall DE, Tew JG. IL-17 in Sera from Patients with Aggressive Periodontitis. Journal of Dental Research [Internet]. 2010;89(9):943–7. Available from: http://dx.doi.org/10.1177/0022034510369297
Borch TS, Løbner M, Bendtzen K, Holmstrup P, Nielsen CH. Decreased Interleukin-2 Responses to Fusobacterium nucleatum and Porphyromonas gingivalis in Generalized Aggressive Periodontitis. Journal of Periodontology [Internet]. 2009;80(5):800–7. Available from: http://dx.doi.org/10.1902/jop.2009.080513
Ju JH, Cho M-L, Moon Y-M, Oh H-J, Park J-S, Jhun J-Y, et al. IL-23 Induces Receptor Activator of NF-κB Ligand Expression on CD4 + T Cells and Promotes Osteoclastogenesis in an Autoimmune Arthritis Model. The Journal of Immunology [Internet]. 2008;181(2):1507–18. Available from: http://dx.doi.org/10.4049/jimmunol.181.2.1507
Dutzan N, Gamonal J, Silva A, Sanz M, Vernal R. Over-expression of forkhead box P3 and its association with receptor activator of nuclear factor‐κ B ligand, interleukin (IL) ‐17, IL‐10 and transforming growth factor‐β during the progression of chronic periodontitis. Journal of Clinical Periodontology [Internet]. 2009;36(5):396–403. Available from: http://dx.doi.org/10.1111/j.1600-051x.2009.01390.x
Jafarzadeh A, Nemati M, Rezayati MT. Serum levels of interleukin (IL)-27 in patients with ischemic heart disease. Cytokine [Internet]. 2011;56(2):153–6. Available from: http://dx.doi.org/10.1016/j.cyto.2011.06.014
Nowzari H, Botero JE, DeGiacomo M, Villacres MC, Rich SK. Microbiology and Cytokine Levels Around Healthy Dental Implants and Teeth. Clinical Implant Dentistry and Related Research [Internet]. 2008;10(3):166–73. Available from: http://dx.doi.org/10.1111/j.1708-8208.2007.00076.x
Cifcibasi E, Koyuncuoglu C, Ciblak M, Badur S, Kasali K, Firatli E, et al. Evaluation of Local and Systemic Levels of Interleukin-17, Interleukin-23, and Myeloperoxidase in Response to Periodontal Therapy in Patients with Generalized Aggressive Periodontitis. Inflammation [Internet]. 2015;38(5):1959–68. Available from: http://dx.doi.org/10.1007/s10753-015-0176-3
Santos VR, Ribeiro FV, Lima JA, Miranda TS, Feres M, Bastos MF, et al. Partial- and full‐mouth scaling and root planing in type 2 diabetic subjects: a 12‐mo follow‐up of clinical parameters and levels of cytokines and osteoclastogenesis‐related factors. Journal of Periodontal Research [Internet]. 2011;47(1):45–54. Available from: http://dx.doi.org/10.1111/j.1600-0765.2011.01403.x
Himani GS, Prabhuji MLV, Karthikeyan BV. Gingival crevicular fluid and interleukin-23 concentration in systemically healthy subjects: their relationship in periodontal health and disease. Journal of Periodontal Research [Internet]. 2013;49(2):237–45. Available from: http://dx.doi.org/10.1111/jre.12100
Ismail S, Essawi M. Genetic polymorphism studies in humans. Middle East Journal of Medical Genetics [Internet]. 2012;1(2):57–63. Available from: http://dx.doi.org/10.1097/01.mxe.0000415225.85003.47
Saraiva AM, Alves e Silva MR, Correia Silva Jde F, et al. Evaluation of IL17A expression and of IL17A, IL17F and IL23R gene polymorphisms in Brazilian individuals with periodontitis. Hum Immunol. 2013;74(2):207–214. http://dx.doi.org/10.1016/j.humimm.2012.10.026
Chaudhari HL, Warad S, Ashok N, Baroudi K, Tarakji B. Association of Interleukin-17 polymorphism (-197G/A) in chronic and localized aggressive periodontitis. Braz Oral Res. 2016;30:S1806-83242016000100219. http://dx.doi.org/10.1590/1807-3107BOR-2016.vol30.0026
Kadkhodazadeh M, Baghani Z, Ebadian AR, Youssefi N, Mehdizadeh AR, Azimi N. IL-17 gene polymorphism is associated with chronic periodontitis and peri-implantitis in Iranian patients: a cross-sectional study. Immunol Invest. 2013;42(2):156–163. http://dx.doi.org/10.3109/08820139.2012.746697
Corrêa JD, Madeira MF, Resende RG, et al. Association between polymorphisms in interleukin-17A and – 17F genes and chronic periodontal disease. Mediators Inflamm. 2012;2012:846052. http://dx.doi.org/10.1155/2012/846052
Witowski J, Książek K, Jörres A. Interleukin-17: a mediator of inflammatory responses. Cell Mol Life Sci. 2004;61(5):567–579. http://dx.doi.org/10.1007/s00018-003-3228-z
Baraut J, Farge D, Ivan-Grigore E, Verrecchia F, Michel L. Cytokines in Systemic Sclerosis: Focus on IL-17. Systemic Sclerosis - An Update on the Aberrant Immune System and Clinical Features [Internet]. 2012; Available from: http://dx.doi.org/10.5772/28595
Kotake S, Yago T, Kawamoto M, Nanke Y. Role of osteoclasts and interleukin-17 in the pathogenesis of rheumatoid arthritis: crucial 'human osteoclastology'. J Bone Miner Metab. 2012;30(2):125–135. http://dx.doi.org/10.1007/s00774-011-0321-5
Espinoza JL, Takami A, Nakata K, et al. A genetic variant in the IL-17 promoter is functionally associated with acute graft-versus-host disease after unrelated bone marrow transplantation. PLoS One. 2011;6(10):e26229. http://dx.doi.org/10.1371/journal.pone.0026229

There is no duality of interest

Download PDF

Version 1

posted

You are reading this latest preprint version

Involvement of Interlukin-17A (IL-17A) Gene Polymorphism and Interlukin-23 (IL-23) level in the Development of Peri-Implantitis

Status:

Version 1

Abstract

Figures

1. Introduction

2. Materials And Methods

3. Results

4. Discussion

5. Conclusion

Declarations

References

Additional Declarations

Status:

Version 1