Ulinastatin Improves Acute Pancreatitis-Associated Intestinal Barrier Dysfunction via Activating the Nrf2/HO-1 Signaling Pathway

doi:10.21203/rs.3.rs-3560319/v1

Download PDF

Research Article

Ulinastatin Improves Acute Pancreatitis-Associated Intestinal Barrier Dysfunction via Activating the Nrf2/HO-1 Signaling Pathway

https://doi.org/10.21203/rs.3.rs-3560319/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background

Severe intestinal barrier dysfunction occurs in the early stages of acute pancreatitis (AP) and plays a significant role in the mechanism of pancreatic necrosis as well as multiple organ failure in AP. Our study aims to explore the therapeutic effects and underlying mechanisms of ulinastatin (UTI) in improving intestinal barrier dysfunction associated with L-arginine-induced AP in rats.

Methods

We randomly assigned experimental rats into three subgroups (n = 10 per group): a control group, an AP group, and an AP + UTI (10000 U/kg) group. We assessed serum levels of amylase, lipase, intestinal fatty acid binding protein (I-FABP), and diamine oxidase (DAO). Additionally, we conducted pathological examinations on pancreatic and terminal ileal tissues. Laser Doppler blood flow meters were used to evaluate blood perfusion in the terminal ileal tissue. We observed the mucosal ultrastructure in the terminal ileal tissue using a transmission electron microscope (TEM). Furthermore, we determined protein and mRNA levels of nuclear factor erythroid 2-related factor 2 (Nrf2) and heme oxygenase-1 (HO-1) in terminal ileal tissue through western blot and quantitative reverse transcription PCR (qRT-PCR) analysis. We also measured the activities of peroxides and antioxidants in terminal ileal tissue.

Results

Compared to the AP group, the AP + UTI group exhibited significant reductions in serum levels of amylase, lipase, I-FABP, and DAO, along with alleviated pathological injuries in both pancreatic and terminal ileal tissues. Furthermore, after UTI treatment, we observed improvements in blood perfusion, mucosal ultrastructure, and permeability in the terminal ileal tissue. Additionally, UTI treatment led to notable increases in protein and mRNA levels of Nrf2 and HO-1 in the terminal ileal tissue. This resulted in a significant decrease in peroxide levels, including MDA and ROS, along with a marked increase in the activities of antioxidants, including glutathione peroxidase (GPx), glutathione reductase (GR), glutathione S-transferase (GST), and total sulfhydryl (T-SH).

Conclusions

This study is the first to prove that UTI alleviates AP and improves AP-associated intestinal barrier dysfunction by promoting antioxidative stress through the activation of the Nrf2/HO-1 pathway.

ulinastatin

acute pancreatitis

intestinal barrier dysfunction

Nrf2/HO-1 signaling pathway

oxidative stress

Acute pancreatitis (AP) is a heterogeneous and complex gastrointestinal disease with a variable acute inflammatory course. Approximately 80% of patients develop mild edematous pancreatitis. In comparison, one-fifth of patients develop severe acute pancreatitis (SAP) characterized by infected pancreatic necrosis (IPN) and multisystem organ failure (MSOF), with a mortality rate of nearly 20%[^1][2]. As shown in Figure 1, AP starts with premature and excessive activation of trypsin within pancreatic acinar cells, which leads to acinar cell injuries and activate immune cells, including neutrophils, to amplify an inflammatory response and increase further trypsinogen activation and oxidative stress by releasing oxidizing substances[^3][4]. Meanwhile, trypsin gain access into intestinal epithelial cells (IECs) directly, inducing damage followed by the formation of cytotoxic mediators[^5]. Intestinal barrier dysfunction during AP plays a significant role in the mechanism of superinfection of the pancreas and peri-pancreatic necrosis, the acute peri-pancreatic fluid collection, the post-necrotic fluid collection, and the walled-of pancreatic necrosis, as well as in the multiple organ failure in SAP[^6]. Given the pathophysiology described above, improving intestinal barrier dysfunction by activating the antioxidant signaling pathway appears crucial. However, research shows that Bicarbonated Ringer's solution can improve AP in rats through the Nrf2 antioxidant pathways [^7]. However, early aggressive fluid resuscitation resulted in a higher incidence of fluid overload without improvement in hypovolemia and intestinal hypoperfusion[^8].

Ulinastatin (UTI) is a glycoprotein belonging to a broad range of serine protease inhibitors used to treat acute inflammatory disorders and circulatory failure caused by sepsis, toxic shock, and hemorrhagic shock[^9]. UTI can inhibit the activity of various proteolytic enzymes, including trypsin and elastase, and has anti-inflammatory and anti-oxidant stress properties by downregulating inflammatory cytokines and removing oxygen-free radicals[^10][11]. UTI has been shown to alleviate systemic inflammatory response syndrome (SIRS) and improve MSOF on AP disease in animal and clinical trials[^12][13]. However, UTI's effect on improving intestinal barrier dysfunction and tissue injury on AP has been poorly studied. A related study recently demonstrated that UTI can significantly improve renal perfusion in the renal microcirculation during septic shock, although the mechanism has not yet been clarified[^14]. Therefore, the primary purpose of this investigation was to verify the therapeutic effectiveness of UTI in alleviating AP and improving AP-associated intestinal barrier dysfunction in the experimental rat model of L-arg-induced AP. Furthermore, the potential mechanism of UTI intervention in AP-associated intestinal barrier dysfunction was also explored in this study.

Animals and diets

All animal experimental procedures were approved and performed by the appropriate guidelines and ethical standards of the Animal Protection and Use Committee of Anhui Medical University. Experimental rats were obtained (Laboratory Animal Center of Anhui Medical University, Hefei, China; age 3–4 months; weight 2.0–2.5kg) and housed in a specific pathogen-free room under a 12/12h light–dark cycle at room temperature and 50% humidity, free access to water and a standard laboratory diet during the experiment^[7].

Establishment of the AP model and experimental design

Experimental rats were randomly divided into three subgroups (n=10 for each group): control group, AP group, and AP + UTI (10000U/kg) group. Using the methods outlined by Yang et al. with minor modifications, the AP model was induced in rats by intraperitoneal injection of 20% L-arginine in phosphate-buffered saline at a dose of 2.5g/kg body weigh twice at hourly intervals[^15]. The control group was intraperitoneally injected with PBS in the same way. In the AP + UTI (10000U/kg) group, rats were intraperitoneally injected with UTI immediately following the final L-arginine injection. They repeated the UTI injection once at an interval of 24h, and rats in the AP group were administered with the same volume of normal saline at the same time point.

Biochemical assays

Experimental rats were pre-anesthetized with carbon dioxide and anesthetized using 10% chloral hydrate (3.5ml/kg BW) by intraperitoneal injection. Blood samples were collected using heparinized syringes from the caudal veins at 0, 24, and 48h after the initial L-arginine injection, and the upper serum was separated by centrifugation at 4000r/min for 10min at 4°C. The serum was placed in an EP tube and cryopreserved in 80°C liquid nitrogen for unified detection. The serum levels of amylase and lipase activity, I-FABP, and DAO were determined with enzyme-linked immunosorbent assay (ELISA) kits. The manufacturer’s manual and standard laboratory procedure did the whole process.

Pathological examination

Experimental rats were sacrificed by intraperitoneal injection of excess 10% chloral hydrate. Then, segmental fresh pancreatic and terminal ileal tissue were harvested under sterile conditions and fixed in 4% paraformaldehyde at 4 °C and embedded in paraffin. The pancreatic and terminal ileal sections were stained with hematoxylin and eosin solution. H&E-stained sections were observed under 100x and 200x optical electron microscopes. The degrees of pancreatic injury were evaluated by scoring the grading system according to Schoenberg’s scoring system[^16] (Table 1), and the degrees of terminal ileal injury were evaluated by scoring the grading system according to Chiu’s scoring system[^17] (Table 2).

Table 1. Histopathologic grades of pancreatic tissue by Schoenberg
Grade	Histopathologic finding
Grade	Edema	Inflammation	Necrosis
0	No	No	No
1	Diffuse expansion of interlobar septa	Periductal	1–4 necrotic cells
2	1 (+) Diffuse expansion of interlobular septa	Parenchymal (<50% lobules)	5–10 necrotic cells
3	2 (+) Diffuse expansion of interacinar septa	Parenchymal (51%–75% lobules)	11–16 necrotic cells
4	3 (+) Diffuse expansion of intercellular septa	Parenchymal (>75% lobules)	>16 necrotic cells

Table 2. Histopathologic grades of intestinal tissue by Chiu
Grade	Histopathologic finding
0	Normal mucosal villi
1	Development of a subepithelial space, usually at the tip of the villus, with capillary congestion
2	Extension of the subepithelial space with the moderate lifting of the epithelial layer
3	Massive epithelial lifting down the sides of villi
4	Denuded villi with lamina propria, dilated capillaries exposed, increased cellularity of the lamina propria
5	Digestion and disintegration of the lamina propria, hemorrhage and ulceration

Laser Doppler blood flow meter

Experimental rats were anesthetized by intraperitoneal injection of 10% chloral hydrate. A laparotomy was performed, and the terminal ileal tissue was exposed. The probe was used to touch the mucosa in the terminal ileal tissue without pressure, and the blood flow was measured using a laser Doppler blood flow meter (MoorFLPI-2, Moor Instruments Ltd, Devon, UK) connected to a computer with the matching software moorVMS-PC v3.1 (Moor) to process data. Perfusion unit (PU) means the blood perfusion within the measured area. The concentration of moving blood cells (CMBC) means the number of associated moving blood cells that cause the Doppler shift. Velocity means the average movement rate of the associated blood cells within the measured area. The relationship between the above three signals is

PU = CMBC × Velocity

Transmission electron microscope

Experimental rats were sacrificed by intraperitoneal injection of excess 10% chloral hydrate.Segmental fresh terminal ileal tissue was harvested on ice, and 2mm sections were fixed for two h with buffered glutaraldehyde and postfixed with 1% OsO₄, dehydrated through graded alcohols, infiltrated through Epon12, and then embedded in resin. Sections were cut at 1-2mm thickness, stained with uranyl acetate and lead citrate, and photographed on a Hitachi HT-7800 (Hitachi, Tokyo, Japan) electron microscope operated at 75kV. The morphological and structural changes of IECs and microvilli and the tight junction structure (TJs) between IECs were observed by TEM.

Western blot analysis

Experimental rats were sacrificed by intraperitoneal injection of excess 10% chloral hydrate. The terminal ileal tissue was homogenized and centrifuged at 4°C for 15 minutes. The supernatants were collected and electrophoretically separated by 10% SDS-PAGE and transferred to nitrocellulose membranes. The membranes were blocked by 5% skim milk and incubated with antibodies against mouse Nrf2, HO-1, and β-actin, followed by incubation with secondary goat anti-rabbit antibody or secondary goat anti-mouse antibody conjugated to horseradish peroxidase for 1h at room temperature. The protein bands were quantified by the mean ratios of integral optical density normalized to the expression of the housekeeping gene β-actin.

Quantitative reverse transcription PCR (qRT–PCR) analysis

Experimental rats were sacrificed by intraperitoneal injection of excess 10% chloral hydrate.The terminal ileal tissue was homogenized with TRIzol. The mixture was transferred to 1.5mL RNase-free tubes and centrifuged at 4°C for 15 minutes in chloroform. The supernatants were collected and centrifuged at 4°C for 10 minutes with an equal volume of isopropyl alcohol. Then, the supernatants were removed, and 75% ethanol was added to the precipitate and centrifuged at 4°C for 5 minutes. Finally, RNA extraction lysis buffer was dissolved in diethylprocarbonate. Total RNA was extracted using an RNA Prep Pure Micro Kit. A spectrophotometer measured RNA concentrations. Equal amounts of samples were reverse-transcribed using a FastQuant RT Kit. SYBR-based qPCR was then performed using Bestar qPCR Mastermix on ABI StepOnePlus. Various mRNAs were quantified, and GAPDH was used as the internal control. The mRNA expression of Nrf2 and HO-1 in terminal ileal tissue was measured using the comparative 2^−(ΔΔCq) method. The primer sequences used to amplify mRNAs are shown in Table 3.

Table 3. Primer sequences for RT-PCR.
Primer		Sequence (5′ to 3′)
Nrf2	Forward	CAGTGCTCCTATGCGTGAA
Nrf2	Reverse	GCGGCTTGAATGTTTGTC
HO-1	Forward	ACAGATGGCGTCACTTCG
HO-1	Reverse	TGAGGACCCACTGGAGGA
GAPDH	Forward	GGAGCGAGATCCCTCCAAAAT
GAPDH	Reverse	GGCTGTTGTCATACTTCTCATGG

Measurement of antioxidant and peroxide activities

Experimental rats were sacrificed by intraperitoneal injection of excess 10% chloral hydrate.The terminal ileal tissue was weighed, homogenized, and centrifuged. The GPx and GR activities were measured by calculating the consumption of NADPH as a cofactor in the reduction of GSSG to GSH. GST activity was measured using 1-chloro-2,4-dinitrobenzene (CDNB) as a substrate. The T-SH activities were determined by Ellman’s reaction using 5050-dithio-bis-2-nitrobenzoic acid. The MDA content was measured using thiobarbituric acid reactive substances. An Oxiselect In Vitro ROS Assay Kit measured the ROS level using a dichlorodihy-drofluorescein DiOxyQ probe[^18].

Statistical analysis

All data were recorded in Excel 2019, and IBM SPSS 21.0 software was used for statistical analysis. The graphs were generated using GraphPad Prism 8 software. The results of the measured values that followed a normal distribution are expressed as the mean ± standard deviation. Statistical significance was determined by one-way ANOVA with Student–Newman–Keuls tests and Mann–Whitney rank sum tests. P < 0.01 was regarded as a statistically significant, and P < 0.05 indicated a statistical difference.

AP and AP-associated terminal ileal injuries were alleviated by UTI treatment

As shown in Figure 2(a), compared with the Control group, pancreatic tissue injuries were mainly characterized by obvious edema, inflammatory cell infiltration, and necrosis in the AP group. The serum levels of amylase and lipase at 24h in the AP group were significantly higher than those in the Control group (Figure 4). The above evidence indicated that the AP model of rats was successfully established in this experiment. Meanwhile, AP-associated terminal ileal injuries were mainly characterized by dilated subepithelial space, denuded microvilli, capillary hemorrhage, and digestion and disintegration of the lamina propria in the AP group (Figure 2(b)). The serum levels of DAO and I-FABP at 24h in the AP group were significantly higher than those in the Control group (Figure 4).

The pancreatic tissue injuries in the AP + UTI group were clearly alleviated, with a significant increase in normal acinar cells compared with the AP group (Figure 2(a)). The pathological scores, including edema, inflammatory cell infiltration, and necrosis of pancreatic tissues in the AP + UTI group, were remarkably lower than those in the AP group (P < 0.01) (Figure 3(a)). Meanwhile, the mucosal injuries in the terminal ileal tissues were obviously improved after UTI treatment (Figure 2(b)). And the pathological scores of terminal ileal tissues in the AP + UTI group were remarkably lower than those in the AP group (P < 0.01) (Figure 3(b)). In addition, the serum levels of amylase, lipase, DAO and I-FABP in the AP + UTI group were significantly reduced compared with those in the AP group (P < 0.01) (Figure 4).

UTI increased mucosal blood perfusion in the terminal ileal tissue

As shown in Figure 5, the blood perfusion of the mucosa in the terminal ileal tissue on experimental rats was observed by a laser Doppler blood flow meter. It was shown that PU and velocity in the AP and the AP + UTI groups were significantly lower than those in the Control group. While after being treated with UTI, PU and velocity were significantly higher than those in the AP group. It is worthy of attention that CMBC in the AP group and the AP + UTI group were obviously increased compared with that in the Control group (P < 0.01).

UTI repaired the intestinal barrier in the terminal ileal tissue

The ultrastructure of the mucosa in the terminal ileal tissue in experimental rats was observed by TEM. As shown in Figure 6(a), it was observed that in the Control group, the IECs within the tissue were intact, where the surface microvilli were long and dense, the arrangement was regular, and TJs of adjacent cells were in close opposition, which represents the stable permeability of the intestinal barrier. However, in the AP group, edema or even shedding of IECs could be observed, which was accompanied by typical TJs dilatations, and atrophy and sparseness of the surface microvilli and enlargement of the intercellular space (Figure 6(b)), manifesting increased permeability of intestinal mucosa. In the AP + UTI groups, although atrophy, sparseness, and irregular arrangement of the microvilli could also be observed, TJs of adjacent cells are recovered into close opposition, and the permeability is improved as compared with that in the AP group (Figure 6(c)).

UTI promoted Nrf2 pathway activation and HO-1 expression in the terminal ileal tissue

The protein and mRNA expression of Nrf2 and HO-1 were measured in this experiment. The protein expression of Nrf2 and HO-1 were shown to be significantly higher in the AP group and the AP + UTI group than in the Control group (P < 0.01), and expression was further increased after UTI treatment compared with the AP group (P < 0.01) (Figure 7(a)). Similar results on the relative mRNA levels of Nrf2 and HO-1 were also observed among the Control, AP, and AP + UTI groups (Figure 7(b)).

UTI upregulated antioxidant activities and suppressed peroxides expression in the terminal ileal tissue

Figure 8 shows that the levels of antioxidant markers, including GPx, GR, GST, and T-SH, in the AP group were remarkably lower than those in the control group (P < 0.01). However, the levels of GPx, GR, GST, and T-SH in the AP + UTI group were upregulated and significantly higher than those in the AP group (P < 0.01). Meanwhile, the levels of MDA and ROS were measured in this experiment, and they were both significantly higher in the AP group than those in the control group. After treatment with UTI, the levels of MDA and ROS were higher than those in the control group, though, while markedly decreased as compared with the AP group (P < 0.01).

AP is a local or systemic inflammatory disease with high morbidity and mortality rates. Genetic, biochemical, and animal model studies revealed that digestive enzymes, especially trypsin, play a central role in the onset and progression of AP[^19]. The imbalance between oxidative and antioxidant action occurs during oxidative stress in AP. Oxidative intermediates such as oxygen radicals and lipid peroxides can be produced by activated immune cells, which is recognized to be momentous in driving distant organ injury, including IEC damage and intestinal barrier dysfunction in the early stages of AP[^20]. It is generally well known that inflammation and oxidative stress are integrative characteristics of AP. They are active contributing factors that boost each other by provoking mutual signal transduction pathways and worsening the damage to pancreatic tissue and distant organs, especially intestinal barrier dysfunction[^21][22], which is characterized by enhanced mucosal layer permeability, disturbed mucosal perfusion and development of tissue edema[^23]. Therefore, It is important to inhibit protease activity in the early stage of AP, which can reduce enlarged inflammatory response and excessive oxidative stress. Recently, UTI, as a trypsin inhibitor, has been fully validated in alleviating AP in the clinic. However, the therapeutic effect of UTI on AP-associated intestinal barrier dysfunction has not been studied. Our research has shown that UTI administration to rats with AP in this experiment could alleviate the pathological damage to pancreatic and terminal ileal tissue and significantly reduce serum amylase, lipase, DAO, and I-FABP levels. Further research found that UTI intervention increased mucosal blood perfusion, repaired mucosal barrier, and improved mucosal layer permeability. Moreover, our study revealed that UTI treatment suppressed oxidative stress markers and upregulated antioxidative stress markers by activating the Nrf2 antioxidant signaling pathway. As described above, we demonstrate for the first time that UTI exerted protective effects against both AP and AP-associated intestinal barrier dysfunction.

UTI, an intrinsic trypsin inhibitor derived from the urine of healthy adults, has been studied in the management of AP. It has been characterized by reversing pancreatic histological damage and reducing amylase levels in the experimental models of SAP[^24]. Our study was consistent with these findings: the serum levels of amylase and lipase activity and the pathological scores, including edema, inflammatory cell infiltration, and pancreatic tissue necrosis, were remarkably reduced after UTI treatment.

In addition, a systematic review and meta-analysis of randomized controlled trials have confirmed that UTI combined with somatostatin analog significantly decreased complication rates in AP, including acute respiratory distress syndrome (ARDS), acute kidney injury (AKI), and multiple organ dysfunction syndrome (MODS) in comparison with somatostatin analog monotherapy[^25]. However, it is worth noting that UTI was also shown to relieve histological damage of intestinal mucosa and decrease the levels of DAO and I-FABP, regarded as signature protein of intestinal function during AP according to our present study, which demonstrates that UTI can also improve AP-associated complication with intestinal injury.

As the most important defense system of the human body, the normal intestinal barrier is based on the intact IECs and the TJ between the epithelial cells[^26]. The homoeostatic status of the intestinal barrier is essentially supported by the maintenance of the intestinal barrier integrity, and the damaged IECs and the disruption of TJs trigger significant alterations of the intestinal barrier homeostasis, which may result in a profound generation and secretion of intestinal proteolytic enzymes, increased intestinal permeability and impaired integrity of intestinal barrier[^27]. There is accumulating evidence supporting the concept that intestinal hypoperfusion and ischemia/reperfusion injury secondary to AP contribute primarily to intestinal barrier dysfunction and increased bacterial translocation, which leads to IPN and eventually develops SAP[^28][29]. Under the stress state caused by SAP, the structure of the intestinal barrier, including massive death of IECs and alterations in TJ, is performed, which results in a pathological increase in intestinal mucosal permeability[^30][31]. Our study is consistent with these findings: damaged IECs, widened TJ, intestinal hypoperfusion, and increased permeability were observed in AP rats during this experiment. However, we also confirmed that administration of UTI could exert protective effects on AP-associated intestinal barrier dysfunction, which is reflected in recovering IECs number and TJ structure, increasing mucosal blood perfusion, and decreasing mucosal layer permeability.

The imbalance of cellular redox reactions in IECs induced by oxidative stress during SAP damages the intestinal mucosa's structure, aggravates the inflammatory response, and further damages the intestinal mucosal barrier[^32]. Current findings demonstrated that Nrf2/HO-1 antioxidant signaling pathway is an important protective factor against AP-induced intestinal barrier dysfunction. Upregulation of Nrf2/HO-1 expression can accelerate intestinal vascular perfusion and the restoration of intestinal barrier dysfunction[^33][34]. MDA and ROS are representative markers of oxidative stress, which can reflect oxidative stress damage to a certain extent and are also useful to appreciate the severity of AP in the very early stage. Additional markers that can be used for assessing antioxidative stress are GPx and GR[^35]. Our research showed that the protein and relative mRNA expression levels of Nrf2 and HO-1 were clearly increased in the terminal ileal tissue after treatment with UTI, which confirmed that the antioxidative stress during AP was promoted through the activation of the Nrf2 signaling pathway and HO-1 expression by UTI treatment. Moreover, driven by the up-regulation of Nrf2 and HO-1 expression, the levels of MDA and ROS were obviously reduced, and the levels of GPx, GR, GST, and TSH in the terminal ileal tissue were markedly increased after being treated by UTI, which, for the first time, proved that UTI has the characteristic of antioxidative stress in AP.

UTI appeared to decrease the levels of amylse, lipase, DAO, and I-FABP, relieve histological damage of pancrea and intestinal mucosa, increase mucosal blood perfusion, repair the mucosal barrier, and improve mucosal layer permeability. Furthermore, UTI treatment upregulated antioxidant activities consisting of GPx, GR, GST, and TSH and suppressed peroxides expression containing MDA and ROS, achieved through up-regulation of Nrf2 and HO-1 expression. All our fruitful work has brought about a discovery that UTI improves AP and AP-associated intestinal barrier dysfunction by promoting antioxidative stress through activating the Nrf2/HO-1 pathway.

AP: acute pancreatitis; UTI: ulinastatin; I-FABP: intestinal fatty acid binding protein; DAO: diamine oxidase; TEM: transmission electron microscope; Nrf2: nuclear factor erythroid 2-related factor 2; HO-1: heme oxygenase-1; qRT-PCR: quantitative reverse transcription; SAP: severe acute pancreatitis; IPN: infected pancreatic necrosis; MSOF: multisystem organ failure; GPx: glutathione peroxidase; GR: glutathione reductase; GST: glutathione S-transferase; T-SH: total sulfhydryl; IECs: intestinal epithelial cells; ELISA: enzyme-linked immunosorbent assay; PU: Perfusion unit; CMBC: concentration of moving blood cells; TJs: tight junction structure; ARDS: acute respiratory distress syndrome; AKI: acute kidney injury; MODS: multiple organ dysfunction syndrome.

Acknowledgements

Thanks for the support of the Research and Experiment Center of The Second Affiliated Hospital of Anhui Medical University.

Funding

This work was supported by the Scientific Research Foundation of Anhui Medical University (Grant No. 2020xkj192).

Availability of data and materials

All data supporting the findings of this study are available. Website: https://data.4tu.nl. DOI: 10.4121/43304558-a8d4-48e8-af4d-ea3896c25d12.

Authors’ contributions

Conceived and designed the experiments: QW, JF, SZ; Performed the experiments: QW, JF，SZ, WX, HL; Acquired and analyzed the data: QW, JF, SZ, YL, CY. Drafted the paper: QW, JF. Revised the paper: MG. All authors read and approved the final manuscript.

Competing interests

The authors declare that they have no competing interests.

Consent for publication

Not applicable.

Ethics approval and consent to participate

The study is reported in accordance with ARRIVE guidelines and all the animal experiments were conducted following ethical standards of Ethics Committee of The Second Affiliated Hospital of Anhui Medical University (No. SL-YX2021-083).

Author details

¹Department of Emergency Surgery, the Second Affiliated Hospital of Anhui Medical University, Hefei, Anhui, China). ²Department of Clinical Pharmacology, the Second Affiliated Hospital of Anhui Medical University, Hefei, Anhui, China)

* Corresponding author: Ming Gao, Department of Emergency Surgery, the Second Affiliated Hospital of Anhui Medical University, NO.678 Furong Road, Shushan Strict, Hefei, 230601, China, Email:[email protected]

Mederos MA, Reber HA, Girgis MD. Acute Pancreatitis: A Review. JAMA. 2021;325(4):382-390. doi:10.1001/jama.2020.20317
Gardner TB. Acute Pancreatitis. Ann Intern Med. 2021;174(2):ITC17-ITC32. doi:10.7326/AITC202102160
Sendler M, van den Brandt C, Glaubitz J, et al. NLRP3 Inflammasome Regulates Development of Systemic Inflammatory Response and Compensatory Anti-Inflammatory Response Syndromes in Mice With Acute Pancreatitis. Gastroenterology. 2020;158(1):253-269.e14. doi:10.1053/j.gastro.2019.09.040
Lee PJ, Papachristou GI. New insights into acute pancreatitis. Nat Rev Gastroenterol Hepatol. 2019;16(8):479-496. doi:10.1038/s41575-019-0158-2
Penn AH, Hugli TE, Schmid-Schönbein GW. Pancreatic enzymes generate cytotoxic mediators in the intestine. Shock. 2007;27(3):296-304. doi:10.1097/01.shk.0000235139.20775.7f
Kotan R, Peto K, Deak A, Szentkereszty Z, Nemeth N. Hemorheological and Microcirculatory Relations of Acute Pancreatitis. Metabolites. 2022;13(1):4. doi:10.3390/metabo13010004
He L, Wang L, Hou H. Bicarbonated Ringer's solution improves L-arg-induced acute pancreatitis in rats via the NF-κB and Nrf2 pathways. Scand J Gastroenterol. 2023;58(3):276-285. doi:10.1080/00365521.2022.2118553
de-Madaria E, Buxbaum JL, Maisonneuve P, et al. Aggressive or Moderate Fluid Resuscitation in Acute Pancreatitis. N Engl J Med. 2022;387(11):989-1000. doi:10.1056/NEJMoa2202884
Wu X, Jiao W, Chen J, Tao Y, Zhang J, Wang Y. Ulinastatin alleviates early brain injury after intracerebral hemorrhage by inhibiting oxidative stress and neuroinflammation via ROS/MAPK/Nrf2 signaling pathway. Acta Cir Bras. 2022;37(6):e370606.
Li J, Li M, Li L, et al. Real-world safety of ulinastatin: a post-marketing surveillance of 11,252 patients in China. BMC Pharmacol Toxicol. 2022;23(1):51. doi:10.1186/s40360-022-00585-3
Lv B, Jiang XM, Wang DW, Chen J, Han DF, Liu XL. Protective Effects and Mechanisms of Action of Ulinastatin against Cerebral Ischemia-Reperfusion Injury. Curr Pharm Des. 2020;26(27):3332-3340. doi:10.2174/1381612826666200303114955
Sun X, Wang B, Chen J. Mechanism of ulinastatin in severe pancreatitis rats and its effect on CD4CD25 regulatory T Cells. Minerva Med. 2023;114(1):103-104. doi:10.23736/S0026-4806.20.07163-3
Hey-Hadavi J, Velisetty P, Mhatre S. Trends and recent developments in pharmacotherapy of acute pancreatitis. Postgrad Med. 2022;1-11. doi:10.1080/00325481.2022.2136390
Hang CC, Guo YH, Li CS, Wang S. Effects of ulinastatin on renal perfusion evaluated by Doppler ultrasonography in a porcine model of septic shock. Exp Ther Med. 2021;22(5):1324. doi:10.3892/etm.2021.10759
Yang J, Han F, Wu G, et al. Dysregulated B7H4/JAK2/STAT3 Pathway Involves in Hypertriglyceridemia Acute Pancreatitis and Is Attenuated by Baicalin. Dig Dis Sci. 2022;10.1007/s10620-022-07606-5. doi:10.1007/s10620-022-07606-5
Özgül H, Tatar C, Özer B, Aydın H, Sarı S, Özer SP. Effects of alpha-tocopherol on acute pancreatitis in rat. Ulus Travma Acil Cerrahi Derg. 2019;25(1):1-6. doi:10.5505/tjtes.2018.30413
Dere Günal Y, Boybeyi Türer Ö, Atasoy P, Kısa Ü, Aslan MK. The effects of ozone on the acute phase of intestinal ischemia-reperfusion injury in rats. Sıçanlarda ozonun bağırsak iskemi-reperfüzyon hasarının akut evresi üzerine etkisi. Ulus Travma Acil Cerrahi Derg. 2020;26(5):651-656. doi:10.14744/tjtes.2020.48672
Li Y, Pan Y, Gao L, et al. Naringenin Protects against Acute Pancreatitis in Two Experimental Models in Mice by NLRP3 and Nrf2/HO-1 Pathways. Mediators Inflamm. 2018;2018:3232491. doi:10.1155/2018/3232491
Pesei ZG, Jancsó Z, Demcsák A, Németh BC, Vajda S, Sahin-Tóth M. Preclinical testing of dabigatran in trypsin-dependent pancreatitis. JCI Insight. 2022;7(21):e161145. doi:10.1172/jci.insight.161145
Liu D, Wen L, Wang Z, et al. The Mechanism of Lung and Intestinal Injury in Acute Pancreatitis: A Review. Front Med (Lausanne). 2022;9:904078. doi:10.3389/fmed.2022.904078
El Morsy EM, Ahmed MAE. Carvedilol attenuates l-arginine induced acute pancreatitis in rats through modulation of oxidative stress and inflammatory mediators. Chem Biol Interact. 2020;327:109181. doi:10.1016/j.cbi.2020.109181
Xia S, Ni Y, Zhou Q, et al. Emodin Attenuates Severe Acute Pancreatitis via Antioxidant and Anti-inflammatory Activity. Inflammation. 2019;42(6):2129-2138. doi:10.1007/s10753-019-01077-z
Pellegrini C, Fornai M, D'Antongiovanni V, Antonioli L, Bernardini N, Derkinderen P. The intestinal barrier in disorders of the central nervous system. Lancet Gastroenterol Hepatol. 2023;8(1):66-80. doi:10.1016/S2468-1253(22)00241-2
Sun X, Wang B, Chen J. Mechanism of ulinastatin in severe pancreatitis rats and its effect on CD4CD25 regulatory T Cells. Minerva Med. 2023;114(1):103-104. doi:10.23736/S0026-4806.20.07163-3
Horváth IL, Bunduc S, Fehérvári P, et al. The combination of ulinastatin and somatostatin reduces complication rates in acute pancreatitis: a systematic review and meta-analysis of randomized controlled trials. Sci Rep. 2022;12(1):17979. doi:10.1038/s41598-022-22341-7
Liang L, Saunders C, Sanossian N. Food, gut barrier dysfunction, and related diseases: A new target for future individualized disease prevention and management. Food Sci Nutr. 2023;11(4):1671-1704. doi:10.1002/fsn3.3229
Haussner F, Chakraborty S, Halbgebauer R, Huber-Lang M. Challenge to the Intestinal Mucosa During Sepsis. Front Immunol. 2019;10:891. doi:10.3389/fimmu.2019.00891
Agarwal S, Goswami P, Poudel S, et al. Acute pancreatitis is characterized by generalized intestinal barrier dysfunction in early stage. Pancreatology. 2023;23(1):9-17. doi:10.1016/j.pan.2022.11.011
Zhang J, Yu WQ, Wei T, et al. Effects of Short-Peptide-Based Enteral Nutrition on the Intestinal Microcirculation and Mucosal Barrier in Mice with Severe Acute Pancreatitis. Mol Nutr Food Res. 2020;64(5):e1901191. doi:10.1002/mnfr.201901191
Wang J, Xu H, Chen T, Xu C, Zhang X, Zhao S. Effect of Monoacylglycerol Lipase Inhibition on Intestinal Permeability of Rats With Severe Acute Pancreatitis. Front Pharmacol. 2022;13:869482. doi:10.3389/fphar.2022.869482
Zhang Y, Jiang Y, Li H, Wang J, Li C, Zhang D. Effect of STING signaling on intestinal barrier damage in severe acute pancreatitis. Exp Cell Res. 2023;428(2):113630. doi:10.1016/j.yexcr.2023.113630
Gao ZY, Jiang YJ, Wang J, Li C, Zhang DL. Inhibition of angiotensin II type 1 receptor reduces oxidative stress damage to the intestinal barrier in severe acute pancreatitis. Kaohsiung J Med Sci. 2023;39(8):824-833. doi:10.1002/kjm2.12692
Fusco R, Cordaro M, Siracusa R, et al. Biochemical Evaluation of the Antioxidant Effects of Hydroxytyrosol on Pancreatitis-Associated Gut Injury. Antioxidants (Basel). 2020;9(9):781. doi:10.3390/antiox9090781
Shi Z, Wang Y, Ye W, et al. The LipoxinA4 receptor agonist BML-111 ameliorates intestinal disruption following acute pancreatitis through the Nrf2-regulated antioxidant pathway. Free Radic Biol Med. 2021;163:379-391. doi:10.1016/j.freeradbiomed.2020.12.232
Pădureanu V, Florescu DN, Pădureanu R, Ghenea AE, Gheonea DI, Oancea CN. Role of antioxidants and oxidative stress in the evolution of acute pancreatitis (Review). Exp Ther Med. 2022;23(3):197. doi:10.3892/etm.2022.11120

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Ulinastatin Improves Acute Pancreatitis-Associated Intestinal Barrier Dysfunction via Activating the Nrf2/HO-1 Signaling Pathway

Status:

Version 1

Abstract

Background

Methods

Results

Conclusions

Figures

Background

Methods

Results

Discussion

Conclusions

Abbreviations

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1