IRGM/Irgm1 Increases Autophagy to Inhibit Activation of NLRP3 Inflammasome in Inflammatory Injury Induced Acute Liver Failure

doi:10.21203/rs.3.rs-3561765/v1

Download PDF

Article

IRGM/Irgm1 Increases Autophagy to Inhibit Activation of NLRP3 Inflammasome in Inflammatory Injury Induced Acute Liver Failure

https://doi.org/10.21203/rs.3.rs-3561765/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 07 Jun, 2024

Read the published version in Cell Death Discovery →

You are reading this latest preprint version

Immune-related GTPase M (IRGM) induces autophagy and suppresses inflammation, but its putative role and signaling mechanism remain undefined in the pathogenesis of liver failure. This study aimed to address how IRGM attenuates inflammatory injury by regulating autophagy in liver failure. In this study, a total of 10 patients with hepatitis B virus-related acute-on-chronic liver failure (HBV-ACLF) and 10 healthy controls were prospectively enrolled. Intrahepatic expression of IRGM/Irgm1, NLRP3 inflammasome (NLRP3, ASC, and caspase-1), autophagy-related proteins (LC3II, P62), and inflammatory cytokines (IL-1β, TNF-α) were measured. Autophagy was activated by rapamycin (4 mg/kg) in an acute liver failure (ALF) mouse model, which was used to further study the expression of Irgm1, NLRP3 inflammasome, autophagy-related proteins, and inflammatory cytokines using both qRT-PCR and Western blot analyses. Irgm1 expression was knocked down using Irgm1 short hairpin RNA (shRNA) in lipopolysaccharide (LPS)-induced AML12 cells to investigate the effects of Irgm1 deletion on autophagy and inflammation. We found that expression of IRGM and autophagy-related proteins was significantly downregulated while the NLRP3 inflammasome was significantly upregulated in the livers of HBV-ACLF patients and the ALF mouse model (all P<0.05). Rapamycin-induced autophagy ameliorated intrahepatic NLRP3 inflammasome activation and decreased inflammation and necrosis in the ALF mice. Irgm1 knockdown decreased autophagy and significantly upregulated NLRP3 inflammasome activation in AML12 cells (all P<0.05). Rapamycin-induced autophagy also protected against hepatocyte injury following LPS stimulation in vitro by inhibiting NLRP3 inflammasome activation. Thus, IRGM/Irgm1 alleviates inflammation-mediated hepatocyte injury by regulating autophagy. This study provides new insight into potential molecular targets to treat liver failure.

Health sciences/Diseases/Infectious diseases/Hepatitis/Viral hepatitis

Health sciences/Pathogenesis/Inflammation

liver injury

acute liver failure

immune-related GTPase M

autophagy

NLRP3 inflammasome

IRGM/Irgm1 downregulates the NLRP3 inflammasome to alleviate inflammation-mediated liver failure.
IRGM/Irgm1 knockdown decreases autophagy and exacerbates activation of the NLRP3 inflammasome.
Rapamycin protects damaged hepatocytes by restoring the effect of IRGM downregulation.

Liver failure is a multisystem disorder characterized by jaundice, coagulation disorders, hepatorenal syndrome, hepatic encephalopathy, and ascites with a 30–70% mortality rate.^1–3 Immune-related inflammatory damage has been proposed as a core pathogenic “driver” of liver failure,⁴ but its detailed molecular mechanism in the development of liver failure requires further investigation. Inflammasome refers to a cytosolic macromolecule consisting of nucleotide-binding oligomerization domain-like receptor 3 (NLRP3), an apoptosis-associated speck-like protein containing C-terminal caspase recruitment domain (ASC), and caspase-1,⁵ which acts as an innate immune system sensor that respond to infection and tissue damage. The NLRP3 inflammasome involved in the pathogenesis of viral hepatitis,^6–8 non-alcoholic steatohepatitis,^8,9 and alcoholic liver disease,¹⁰ can regulate the maturation of interleukin (IL)-1β and IL-18 precursors, triggering liver inflammation. We previously demonstrated that an increase in the NLRP3 inflammasome and its related cytokines (IL-1β, IL-18) in the damaged liver tissue correlates with the severity of hepatic injury caused by hepatitis B virus-related acute-on-chronic liver failure (HBV-ACLF).⁶ Therefore, reducing the inflammatory response by deactivating the NLRP3 inflammasome in liver failure may alleviate tissue damage and improve prognosis.

Autophagy is a cellular process that maintains intracellular homeostasis in response to inflammation and cellular injury.¹¹ Autophagy targets the degradation of the NLRP3 inflammasome, subsequently blocking pro-caspase-1 cleavage and activation of IL-1β and IL-18, which attenuates inflammation during liver injury.¹² In addition, autophagy has been shown to be significantly downregulated in the liver tissue of the D-galactosamine/lipopolysaccharide (GaIN/LPS)-induced acute liver failure (ALF) mouse model. Interestingly, it is reported in our previous study that the protective effect of PPARα relies on autophagy-induced inflammatory suppression in ALF.¹³ Therefore, targeting autophagy could potentially be an effective treatment for liver failure.

Immunity-related GTPase M (IRGM) and its mouse orthologue Irgm1 have been proposed as key negative regulators of inflammation and autoimmunity.^14,15 Although human IRGM and mouse Irgm1 are biochemically different, they are functionally similar in regulating innate immunity and autophagy.^16,17 IRGM/Irgm1 is associated with several inflammatory and autoimmune diseases, including infectious diseases,¹⁶ Crohn’s disease,¹⁸ and non-alcoholic fatty liver disease.¹⁹ The regulatory function of IRGM/Irgm1 in autophagy was first described in immune responses against intracellular microorganisms.²⁰ Further studies demonstrated that IRGM initiated a phosphorylation cascade to activate ULK1 and Beclin-1 to upregulate autophagy,²¹ as well as interact with NLRP3 and ASC to block assembly and activation of the inflammasome, alleviating inflammatory cell death.²² However, it remains unknown whether the knockdown of IRGM/Irgm1 can interfere with autophagy and its downstream signaling pathways in liver failure.

This study aimed to test the hypothesis that IRGM/Irgm1 regulates autophagy to inhibit NLRP3 inflammasome activation and pro-inflammatory cytokine release, subsequently preventing or alleviating the progression of liver failure. Therefore, this study provides insight about a potentially new target in the treatment of liver failure.

Collection and preparation of clinical specimens

Blood samples and liver tissue specimens were separately collected from 10 HBV-ACLF patients and 10 healthy donors during liver transplantations in Hebei Medical University Third Hospital. HBV-ACLF was diagnosed based on the consensus recommendation for ACLF criteria (2014) by the Asian Pacific Association for the Study of the Liver (APASL). The study protocol was approved by the Human Research Ethics Committee of our hospital (No: K2022-004-1). All patients or their close relatives provided written informed consent before participating in the study.

ALF mouse model

Male C57BL/6 mice aged 8–12 weeks were housed in a 12:12 light-dark cycle with a cage temperature of 22 ± 1^oC and fed water and normal diets ad libitum. The study mice received intraperitoneal injection of D-GalN (500 mg/kg; Sigma, USA) and LPS (10 µg/kg; Sigma, USA) to induce ALF. To induce autophagy, rapamycin (4 mg/kg; Sigma, USA) was intraperitoneally injected into the mice 1 h before the administration of D-GalN/LPS. The mice were sacrificed 6 h later, and liver specimens and serum samples were collected for future detection. The animal study was approved by the Laboratory Animal Ethical and Welfare Committee of our hospital.

Histopathological and immunohistochemical analysis

The liver specimens were fixed with 4% paraformaldehyde, embedded in paraffin wax, and sectioned into 3 µm-thick slices. Then, the tissue sections were stained with hematoxylin and eosin (H&E) and visualized using light microscopy to identify hepatic inflammation.

Liver tissue sections were deparaffinized, rehydrated and subjected to antigen retrieval. Afterward, the specimens were incubated with primary polyclonal rabbit-anti-human antibodies (1:200) (Cell Signaling, USA) at 4°C overnight, and then incubated in a goat-anti-rabbit secondary antibody (Proteintech Group, China) for 40 min at 37°C. The staining was developed using a DAB substrate and counter-stained with hematoxylin. Lastly, the samples were dehydrated and sealed with coverslips for microscopic analysis.

Establishment of in vitro hepatocyte injury

AML12 cells, purchased from Guangzhou Saiku Biotechnology Co., Ltd. were cultured in DMEM/F12 medium with 10% fetal bovine serum, 1% penicillin, and 1% streptomycin in an incubator at 37°C, 5% CO₂, and 95% humidity. The cells were harvested at the logarithmic growth stage (the 3rd–10th generations) and then transferred onto cell culture plates. When the cells reached 50–70% confluence, they were treated with LPS (1 µg/mL) for 12 h to establish the in vitro hepatocyte injury model.

Knockdown of Irgm1 using short hairpin RNA (shRNA)

Irgm1 and control shRNA vectors (Shanghai Genechem, China) were separately transfected into the AML12 cells with Lipofectamine 2000 (Invitrogen, USA). In brief, once the cells reached 60–70% confluence, they were transfected with a mixture of 2 µL shRNA (20 mM) and 2 µL Lipo2000. Irgm1 gene silencing was evaluated using Western blot analysis 48 h after transfection to select the most efficient construct for subsequent experiments.

Western blot analysis

Proteins were extracted from liver tissues or AML12 cells in RIPA buffer (Solarbio, China), and separated using SDS-12% polyacrylamide gel electrophoresis. The separated proteins were then transferred to PVDF membranes (Bio-Rad, USA) and blocked with 5% skimmed milk in Tris buffered saline with Tween 20 for 2 h. Afterward, the membranes were incubated with primary antibodies (1:1000) against IRGM, LC3II, P62, NLRP3, ASC, caspase-1, and β-actin/GAPDH (Cell Signaling, USA) at 4°C overnight, then thoroughly washed and incubated with a horseradish peroxidase-conjugated secondary antibody (1:8000) for 1 h at room temperature. The protein bands were detected using an enhanced luminescent developer (Millipore) and imaged using a ChemiDoc MP System (Bio-Rad, USA). The grey values of the bands were quantitatively measured using ImageJ software.

Quantitative real-time PCR analysis (qRT-PCR)

Total RNA was extracted using Trizol reagent (Invitrogen, USA) from liver tissues and AML12 cells. A total of 2 ug of RNA was reverse transcribed into cDNA using the SuperScript III First-Strand Synthesis System (Invitrogen, USA). Quantitative PCR was done in the DNA Engine with Chromo 4 Detector (MJ Research, USA). The reactants were mixed at a final volume of 20 µl as follows: 1× SuperMix from Platinum SYBR Green qPCR Kit (Invitrogen, USA); cDNA (2 µl); and 0.5 µM of each primer for Irgm1, LC3II, NLRP3, caspase-1, ASC, IL-1β, and tumor necrosis factor (TNF)-α. PCR was done using the follow conditions: 95°C for 10 min, followed by 40 cycles of 95°C for 15 s, and 60°C for 1 min. The relative mRNA levels were normalized to β-actin/GAPDH, and data were analyzed using the 2^−ΔΔCt method. The primers used to amplify the respective mouse gene fragments are listed in Table 1.

Table 1

Primers used for real-time PCR
Target gene		Reverse primers
Irgm1	TGGCAATGGCATGTCATCTT	AGTACTCAGTCCGCGTCTTCGT
LC3II	CAAGCCTTCTTCCTCCTGGTGAATG	CCATTGCTGTCCCGAATGTCTCC
NLRP3	ACGACGAGGCCGGTAGCCTT	TTCTGCAGGCCGTGCTTCCG
ASC	CTTGTCAGGGGATGAACTCAAAA	GCCATACGACTCCAGATAGTAGC
caspase-1	ACAAGGCACGGGACCTATG	TCCCAGTCAGTCCTGGAAATG
IL-1β	TTGACGGACCCCAAAAGAT	GATGATCTGAGTGTGAGGGTCTG
TNF-α	GCCTCTTCTCATTCCTGCTTGT	TTGAGATCCATGCCGTTG
β-actin	CTACCTCATGAAGATCCTGACC	CACAGCTTCTCTTTGATGTCAC

ELISA analysis

IL-1β and TNF-α levels in the serum and cell supernatant were measured using ELISA kits according to the manufacturer’s instructions (ExCell Biology Inc., China).

Statistical analysis

SPSS 21.0 software was used for statistical analysis. When the data were normally distributed and the variances were homogeneous, an independent sample t-test was used to compare two groups, one-way ANOVA analysis of variance was used to compare multiple groups, and Fisher's LSD method was used to compare differences between two groups. When the data were not normally distributed or uneven variance existed, the t' test was used to compare differences between two groups, the Kruskal-Wallis H rank sum test was used to compare differences among multiple groups, and the two-sample Mann-Whitney U test was used to compare differences between two groups. Data were subjected to Pearson correlation analysis. P-value < 0.05 was considered statistically significant.

Clinical baseline characteristics of included subjects

A total of 20 subjects, including 10 HBV-ACLF patients and 10 healthy controls (HCs), were recruited in the current study. The HBV-ACLF patients had increased levels of ALT, AST, total bilirubin (TBiL), direct bilirubin (DBiL), international normalized ratio (INR), serum creatinine (SCr), and a higher score of model for end stage liver disease (MELD), but had decreased levels of serum albumin (ALB) and prothrombin time activity (PTA) compared with the HCs (P < 0.05) (Table 2).

Table 2

Clinical characteristics of the patients in the different groups
Characteristic	Healthy controls n = 10	HBV-ACLF patients n = 10	t/t’	P-value
Age	35.70 ± 11.01	49.50 ± 15.8	-	> 0.05
Male/Female	6/4	7/3	-	> 0.05
PLT (×10⁹/L)	213.9 ± 33.11	97.30 ± 33.93	7.38	< 0.05
ALB (g/L)	46.90 ± 3.30	28.37 ± 2.33	13.8	< 0.05
ALT(U/L)	20.53 ± 7.57	117.13 ± 102.03	-3.58	< 0.05
AST(U/L)	22.43 ± 7.79	134.93 ± 130.20	-3.30	< 0.05
TBil (µmol/L)	7.66 ± 1.93	255.35 ± 123.51	-12.4	< 0.05
DBil (µmol/L)	4.11 ± 1.52	179.17 ± 95.67	-8.13	< 0.05
PTA	98.60 ± 5.78	22.50 ± 5.26	29.2	< 0.05
INR	0.97 ± 0.10	3.28 ± 0.73	-9.35	< 0.05
MELD score	4.50 ± 1.63	31.80 ± 7.59	-10.55	< 0.05
Scr (µmol/L)	59.37 ± 8.13	93.02 ± 44.73	-2.22	< 0.05

HBV, hepatitis B virus; ACLF, acute-on-chronic liver failure; PLT, platelet; ALB, albumin; ALT, alanine aminotransferase; AST, aspartate aminotransferase; TBil, total bilirubin; DBil, direct bilirubin; PTA, prothrombin time activity; INR, international normalized ratio; MELD, model for end stage liver disease; SCr, serum creatinine.

Decreased expression of IRGM and autophagy in HBV-ACLF patients

IRGM protein expression was significantly decreased in the HBV-ACLF patients compared to the HCs (P < 0.05, Fig. 1a). There was no significant correlation between IRGM expression and ALT levels, but there were negative correlations between IRGM expression and AST (r=-0.52), TBiL (r=-0.88), and DBiL (r=-0.83) levels (all P < 0.05).

Furthermore, the expression of LC3II and degradation of P62 were significantly decreased in the HBV-ACLF patients compared to the HCs (both P < 0.05) (Fig. 1b). Pearson correlation analysis further identified that IRGM was positively correlated with LC3II but negatively correlated with P62 (r = 0.81, -0.89 respectively, both P < 0.05).

Increased expression of NLRP3 inflammasome and pro-inflammatory cytokines in HBV-ACLF patients

Expression of NLRP3, ASC, caspase-1, and pro-inflammatory cytokines (IL-1β, TNF-α) were all significantly higher in HBV-ACLF patients compared to the HCs (all P < 0.05, Fig. 1c). Furthermore, IRGM expression was negatively correlated with the intrahepatic levels of NLRP3, ASC, caspase-1, IL-1β, and TNF-α (r=-0.77, -0.82, -0.76, -0.57, -0.52 respectively, all P < 0.05), suggesting that increased NLRP3 inflammasome expression was associated with decreased IRGM expression in HBV-ACLF.

Suppression of intrahepatic expression of Irgm1 in the D-GalN/LPS-induced ALF mouse model

Massive hepatic injury identified by pathohistological features in the ALF mouse model was apparent 6 h after D-GalN/LPS injection, which met the diagnostic criteria for liver failure. Next, we found a decrease in both protein expression and mRNA levels of Irgm1, which were in accordance with the extent of liver injury. Immunohistochemical staining further exhibited the same expression trend of Irgm1 in the livers of the ALF mice. Taken together, these data indicate that Irgm1 was inhibited with the gradual progression of ALF induced by D-GalN/LPS (Fig. 2).

Increased expression of intrahepatic NLRP3 inflammasome and pro-inflammatory cytokines in the D-GalN/LPS-induced ALF mouse model

Expression of the NLRP3 inflammasome and pro-inflammatory cytokines was investigated to determine their pathogenic involvement in the progression of ALF. The results showed that the levels of NLRP3, ASC, caspase-1, IL-1β, and TNF-α were significantly higher in the ALF mice compared to the controls (all P < 0.05), suggesting that the NLRP3 inflammasome and pro-inflammatory cytokines were elevated in ALF induced by D-GalN/LPS (Fig. 3).

Enhanced autophagy ameliorates D-GalN/LPS-induced liver injury

Compared with normal mice, expression of LC3II and degradation of P62 were decreased along with the progression of ALF (both P < 0.05). Pretreatment with rapamycin preserved the pathohistological morphology and architecture of the liver and decreased inflammatory cell infiltration and hepatocytes necrosis. At the molecular level, rapamycin not only increased LC3II conversion and P62 protein degradation in the D-GalN/LPS-induced ALF mouse model, but also significantly lowered levels of the NLRP3 inflammasome, IL-1β, TNF-α, ALT, and AST compared to mice that were not pretreated with rapamycin (all P < 0.05) (Fig. 4).

Irgm1 knockdown decreases autophagy and exacerbates inflammation in the LPS-induced in vitro hepatocyte injury model

After 12 h of intervention with LPS, the ALT and AST levels in the supernatant from the LPS-induced AML12 hepatocyte injury cell model were significantly increased compared to the control cells. LPS treatment also increased the levels of the NLRP3 inflammasome, IL-1β, and TNF-α in the cultured hepatocytes. Irgm1 knockdown by shRNA decreased LC3II conversion and P62 protein degradation compared to the control and LPS-treated cells (all P < 0.05). Furthermore, the levels of ALT and AST were significantly elevated in the supernatant of the cells treated with Irgm1 shRNA and LPS compared to the other groups (all P < 0.05). In addition, the levels of NLRP3, ASC, caspase-1, IL-1β, and TNF-α were significantly higher in the Irgm1 shRNA + LPS group than those in the control and LPS treated groups (all P < 0.05) (Fig. 5).

Enhanced autophagy ameliorates hepatocyte injury induced by LPS

To confirm whether the protective effect of Irgm1 was involved in attenuating inflammation by regulating autophagy, we pretreated the Irgm1 shRNA + LPS cells with rapamycin. Pretreatment with rapamycin enhanced LC3II conversion and P62 protein degradation in the LPS-induced hepatocytes but normalized the levels of ALT and AST in the supernatant compared to the cells that were not pretreated with rapamycin (all P < 0.05). Moreover, levels of NLRP3, ASC, caspase-1, IL-1β, and TNF-α were significantly decreased in the rapamycin treatment group compared the group that was not treated with rapamycin (all P < 0.05) (Fig. 5).

Liver failure induced by various factors results in severe loss of liver function,^1,2 which is often accompanied by life-threatening complications such as hemorrhage and hepatic encephalopathy. This study showed elevations in ALT and AST serum levels in both HBV-ACLF patients and ALF mice induced by D-GalN/LPS, along with extensive hepatocyte edema and necrosis in large patches, infiltration of inflammatory cells, diffuse biliary stasis, and collapsed fibrous meshwork scaffolds, suggesting inflammatory necrosis of hepatocytes is important in the pathogenesis of liver failure.

Previous studies found that activation of the NLRP3 inflammasome may participate in the pathogenesis of ALF. Li et al.²³ reported that expression of NLRP3, ASC, IL-1β, IL-18, and sCD40L was increased in patients with HBV-ACLF. Moreover, pro-caspase-1 and pro-IL-1β, components of the NLRP3 inflammasome machinery, were also upregulated. Our study observed similar changes in the NLRP3 inflammasome in the livers of HBV-ACLF patients and in the D-GaIN/LPS-induced ALF mouse model. Therefore, inflammation mediated by excessive activation of the NLRP3 inflammasome can be a putative factor that induces hepatocyte injury in ALF. Wang et al.²⁴ used Isoliquiritigenin to inhibit the NLRP3 inflammasome, consequently preventing the development of D-GalN/LPS-induced ALF. Verapamil has also been shown to alleviate ALF by inhibiting the thioredoxin interacting protein (TXNIP)/NLRP3 pathway.²⁵ Taken together, targeting NLRP3 may be a potential strategy in the treatment of ALF.

Inflammatory responses are associated with pathogenetic mechanisms of liver failure and can be regulated by many factors, among which autophagy functions to digest misfolded proteins and damaged organelles to maintain internal environment homeostasis. Even though a few studies have suggested that autophagy may be involved in the pathogenesis of liver failure, the exact mechanism remains undefined. A growing body of evidence found that autophagic enhancement alleviated immune inflammatory damage in ALF. Lin et al.²⁶ demonstrated that Eva1a-mediated autophagy attenuated inflammatory responses and apoptosis to ameliorate liver injury in ALF mice. Jiao et al.¹³ reported that PPARα-mediated autophagic induction could lessen inflammation conducive to liver injury. In addition, it has been reported that there are changes in autophagic flux during the progression of liver failure.²⁷ The reasons for why changes in autophagy vary in liver failure, or even why there are opposing findings in the literature, may be due to the different pathologic phases of liver failure. The present study showed that autophagy was suppressed in the HBV-ACLF patients and the ALF mice, which was congruent with NLRP3 inflammasome activation and the increase in IL-1β and TNF-α synthesis and release. This finding suggests that autophagy is protective and determines inhibition of NLRP3 inflammasome activation and subsequent pro-inflammatory cytokine synthesis and release, which is based on the pathophysiological activation of autophagy that was shown to prevent mice from developing ALF after D-GalN/LPS induction. This correlation was further confirmed in cells pretreated with rapamycin to enhance autophagy, deactivate the NLRP3 inflammasome, and downregulate release of pro-inflammatory cytokines. Interestingly, in our in vitro studies, the degree of autophagy was increased in the LPS-induced hepatocyte injury model, and there was an increase in NLRP3 inflammasome activation and IL-1β and TNF-α synthesis and release. These findings contrast the in vivo results in the ALF mice. This contradiction may be due to the different stages of liver failure between the injured liver cell model and the ALF mouse model. These results further suggest that the autophagic flow may exist and is important in the occurrence and development of liver failure. Altogether, autophagy may protect against the development and progression of ALF through attenuating excessive NLRP3 inflammasome activation, although the autophagic flow may exist and the protective effect may be inhibited and even lost in advanced liver failure. Thus, targeting autophagy may be a potential strategy for treating early-stage liver failure. The specific signaling pathway and molecular mechanism by which autophagy regulates NLRP3 inflammasome activation as well as the temporal variations in autophagy and autophagic flux in the pathogenesis of liver failure need to be further explored.

Previous studies identified an association of IRGM/Irgm1 with autophagy. Jean et al.²⁸ and Nath et al.²⁹ claimed that IRGM/Irgm1 interacted with nucleic acid sensor proteins, cGAS and RIG-I, to regulate P62-dependent autophagic degradation to suppress interferon signaling. Lin et al.³⁰ found that IRGM knockdown inhibited autophagic flux along with increased lipid droplet content in HepG2 and PLC/PRF/5 cells, which were corrected by the administration of rapamycin. The present study further showed that IRGM/Irgm1 expression was not only inhibited in patients with HBV-ACLF and in the ALF mouse model, but it also correlated with the severity of hepatic injury. Thus, it has been hypothesized that IRGM/Irgm1, as an important upstream regulatory molecule, is involved in regulating autophagy in the pathogenesis of liver failure. We further utilized the LPS-induced AML12 hepatocyte injury cell model to confirm that IRGM/Irgm1 expression was downregulated and autophagy was changed accordingly in in vitro models of liver injury. To confirm the molecular mechanism of IRGM/Irgm1 regulation of liver failure, we knocked down Irgm1 expression in vitro to measure gene regulation following LPS-induced hepatocyte injury. Irgm1 knockdown by shRNA decreased autophagic activities but upregulated inflammation in the LPS-induced AML12 cell injury model. However, rapamycin was able to partly restore the effect of Irgm1 knockdown, enhance autophagy activation and protect hepatocytes against LPS-induced injury. Collectively, these findings suggest that IRGM/Irgm1 can regulate autophagy to inhibit the activation of the NLRP3 inflammasome, as well as the production and release of pro-inflammatory cytokines, which protect against pathogenesis of liver failure.

In summary, this study confirmed that IRGM/Irgm1 functions as a part of the machinery that protects against liver failure by upregulating autophagy and reducing liver inflammation. This study provides new experimental evidence for exploring autophagy and inflammatory regulation in liver failure. As an important regulator of autophagy and inhibitor of inflammation in liver failure, IRGM/Irgm1 could be considered a potential molecular target for treating liver failure. Developing molecular therapeutics that target IRGM/Irgm1 may become an important strategy in the treatment and prevention of liver failure. Future experiments in animal models are needed to confirm these findings.

ACLF, acute-on-chronic liver failure; ALB, albumin; ALF, acute liver failure; ALT, alanine aminotransferase; APASL, Asian Pacific Association for the Study of the Liver; ASC, apoptosis-associated speck-like protein containing C-terminal caspase recruitment domain; AST, aspartate aminotransferase; DBiL, direct bilirubin; GaIN, D-galactosamine; H&E, hematoxylin and eosin; HBV, hepatitis B virus; HC, healthy controls; IL, interleukin; INR, international normalized ratio; IRGM, immune-related GTPase M; LPS, lipopolysaccharide; MELD, model for end stage liver disease; NLRP3, nucleotide-binding oligomerization domain-like receptor 3; PBS, phosphate buffered saline; PTA, prothrombin time activity; SCr, serum creatinine; shRNA, short hairpin RNA; TBiL, total bilirubin; TNF, tumor necrosis factor, TXNIP, thioredoxin interacting protein.

Financial support

This study was supported by the Natural Science Foundation of Hebei Province (grant number H2020206036), Hebei Province Key Research and Development Program (21377756D), and the Excellent Talent Program for Clinical Medicine (ZF2023082).

Ethics statement

The studies involving human participants were reviewed and approved by the Human Medical Research Ethics Committee of the Hebei Medical University Third Hospital (No: K2022-004-1). All patients or their immediate families provided written informed consent to participate in this study. The animal study was reviewed and approved by the Laboratory Animal Ethical and Welfare Committee of the Hebei Medical University Third Hospital.

Conflict of Interest

The authors declare that they have no conflict of interest in this study.

Availability of Data and Materials

The datasets generated and analyzed during the current study are available from the corresponding author upon reasonable request.

Acknowledgments

We thank all patients recruited in this study for their participation. We thank Medjaden Inc. for its assistance in the preparation of this manuscript.

Grek A, Arasi L. Acute Liver Failure. AACN Adv Crit Care 2016,27:420-429.
Br VK, Sarin SK. Acute-on-chronic liver failure: Terminology, mechanisms and management. Clin Mol Hepatol 2023,29:670-689.
Zhang J, Luo H, Han Y, Zhou X. Sequential versus mono double plasma molecular adsorption system in acute-on-chronic liver failures: A propensity-score matched study. Int J Artif Organs 2022,45:5-13.
Zhang S, Jiang L, Hu H, Wang H, Wang X, Jiang J, et al. Pretreatment of exosomes derived from hUCMSCs with TNF-α ameliorates acute liver failure by inhibiting the activation of NLRP3 in macrophage. Life Sci 2020,246:117401.
Broz P, Dixit VM. Inflammasomes: mechanism of assembly, regulation and signalling. Nat Rev Immunol 2016,16:407-420.
Jia Y, Ma L, Wang Y, Wang W, Shen C, Wang X, et al. NLRP3 inflammasome and related cytokines reflect the immune status of patients with HBV-ACLF. Mol Immunol 2020,120:179-186.
Chen F, Liu Y, Li Q, Wang F. Inhibition of hepatic NLRP3 inflammasome ameliorates non-alcoholic steatohepatitis/hepatitis B-induced hepatic injury. Clin Res Hepatol Gastroenterol 2023,47:102056.
Aggan HE, Mahmoud S, Deeb NE, Eleishi I, El-Shendidi A. Significance of elevated serum and hepatic NOD-like receptor pyrin domain containing 3 (NLRP3) in hepatitis C virus-related liver disease. Sci Rep 2022,12:19528.
Saha S, Ray S, Mandal A, Das U, Bhattacharya T, Shireen Z, et al. Enhanced inflammasome-mediated inflammation and impaired autophagy in peripheral blood mononuclear cells is associated with non-alcoholic fatty liver disease severity. Life Sci 2023,329:121911.
Brahadeeswaran S, Dasgupta T, Manickam V, Saraswathi V, Tamizhselvi R. NLRP3: a new therapeutic target in alcoholic liver disease. Front Immunol 2023,14:1215333.
Levine B, Kroemer G. Biological functions of autophagy genes: a disease perspective. Cell 2019,176:11-42.
Zhao J, He B, Zhang S, Huang W, Li X. Ginsenoside Rg1 alleviates acute liver injury through the induction of autophagy and suppressing NF-κB/NLRP3 inflammasome signaling pathway. Int J Med Sci 2021,18:1382-1389.
Jiao M, Ren F, Zhou L, Zhang X, Zhang L, Wen T, et al. Peroxisome proliferator-activated receptor α activation attenuates the inflammatory response to protect the liver from acute failure by promoting the autophagy pathway. Cell Death Dis 2014,5:e1397.
Rai P, Janardhan KS, Meacham J, Madenspacher JH, Lin WC, Karmaus PWF, et al. IRGM1 links mitochondrial quality control to autoimmunity. Nat Immunol 2021,22:312-321.
Bekpen C, Xavier RJ, Eichler EE. Human IRGM gene "to be or not to be". Semin Immunopathol 2010,32:437-444.
Goswami AB, Karadarević D, Castaño-Rodríguez N. Immunity-related GTPase IRGM at the intersection of autophagy, inflammation, and tumorigenesis. Inflamm Res 2022,71:785-795.
Kumar S, Jain A, Choi SW, da Silva GPD, Allers L, Mudd MH, et al. Mammalian Atg8 proteins and the autophagy factor IRGM control mTOR and TFEB at a regulatory node critical for responses to pathogens. Nat Cell Biol 2020,22:973-985.
Kim S, Eun HS, Jo EK. Roles of Autophagy-Related Genes in the Pathogenesis of Inflammatory Bowel Disease. Cells 2019,8:77.
Schwerbel K, Kamitz A, Krahmer N, Hallahan N, Jähnert M, Gottmann P, et al. Immunity-related GTPase induces lipophagy to prevent excess hepatic lipid accumulation. J Hepatol 2020,73:771-782.
Singh SB, Davis AS, Taylor GA, Deretic V. Human IRGM induces autophagy to eliminate intracellular mycobacteria. Science 2006,313:1438-1441.
Chauhan S, Mandell MA, Deretic V. IRGM governs the core autophagy machinery to conduct antimicrobial defense. Mol Cell 2015,58:507-521.
Mehto S, Jena KK, Nath P, Chauhan S, Kolapalli SP, Das SK, et al. The Crohn's Disease Risk Factor IRGM Limits NLRP3 Inflammasome Activation by Impeding Its Assembly and by Mediating Its Selective Autophagy. Mol Cell 2019,73:429-445.e427.
Li Z, Jiang J. The NLRP3 inflammasome mediates liver failure by activating procaspase-1 and pro-IL-1 β and regulating downstream CD40-CD40L signaling. J Int Med Res 2021,49:3000605211036845.
Wang L, Wang X, Kong L, Wang S, Huang K, Wu J, et al. Isoliquiritigenin alleviates LPS/ D-GalN-induced acute liver failure by activating the PGC-1α/ Nrf2 pathway to reduce oxidative stress and inflammatory response. Int Immunopharmacol 2021,100:108159.
Han M, Li S, Li L. Verapamil inhibits early acute liver failure through suppressing the NLRP3 inflammasome pathway. J Cell Mol Med 2021,25:5963-5975.
Lin X, Cui M, Xu D, Hong D, Xia Y, Xu C, et al. Liver-specific deletion of Eva1a/Tmem166 aggravates acute liver injury by impairing autophagy. Cell Death Dis 2018,9:768.
Lin D, Chen H, Xiong J, Zhang J, Hu Z, Gao J, et al. Mesenchymal stem cells exosomal let-7a-5p improve autophagic flux and alleviate liver injury in acute-on-chronic liver failure by promoting nuclear expression of TFEB. Cell Death Dis 2022,13:865.
Jena KK, Mehto S, Nath P, Chauhan NR, Sahu R, Dhar K, et al. Autoimmunity gene IRGM suppresses cGAS-STING and RIG-I-MAVS signaling to control interferon response. EMBO Rep 2020,21:e50051.
Nath P, Jena KK, Mehto S, Chauhan NR, Sahu R, Dhar K, et al. IRGM links autoimmunity to autophagy. Autophagy 2021,17:578-580.
Lin YC, Chang PF, Lin HF, Liu K, Chang MH, Ni YH. Variants in the autophagy-related gene IRGM confer susceptibility to non-alcoholic fatty liver disease by modulating lipophagy. J Hepatol 2016,65:1209-1216.

(Not answered)

SupplementaryMaterial.zip
supplemental material
Graphicalabstract.png
Graphical abstract

Download PDF

Journal Publication

published 07 Jun, 2024

Read the published version in Cell Death Discovery →

Unknown event
09 Jan, 2024
Editorial decision: Reject after peer review
27 Dec, 2023
Review #1 received at journal
13 Dec, 2023
Review #2 received at journal
01 Dec, 2023
Reviewer #2 agreed at journal
21 Nov, 2023
Reviewer #1 agreed at journal
21 Nov, 2023
Reviewers invited by journal
21 Nov, 2023
Submission checks completed at journal
09 Nov, 2023
First submitted to journal
07 Nov, 2023
Unknown event
06 Nov, 2023
Editor assigned by journal
05 Nov, 2023

You are reading this latest preprint version

IRGM/Irgm1 Increases Autophagy to Inhibit Activation of NLRP3 Inflammasome in Inflammatory Injury Induced Acute Liver Failure

Status:

Journal Publication

Version 1

Abstract

Figures

Highlights

Introduction

Material and Methods

Collection and preparation of clinical specimens

ALF mouse model

Histopathological and immunohistochemical analysis

Western blot analysis

Quantitative real-time PCR analysis (qRT-PCR)

ELISA analysis

Statistical analysis

Results

Clinical baseline characteristics of included subjects

Decreased expression of IRGM and autophagy in HBV-ACLF patients

Increased expression of NLRP3 inflammasome and pro-inflammatory cytokines in HBV-ACLF patients

Suppression of intrahepatic expression of Irgm1 in the D-GalN/LPS-induced ALF mouse model

Increased expression of intrahepatic NLRP3 inflammasome and pro-inflammatory cytokines in the D-GalN/LPS-induced ALF mouse model

Enhanced autophagy ameliorates D-GalN/LPS-induced liver injury

Enhanced autophagy ameliorates hepatocyte injury induced by LPS

Discussion

Abbreviations

Declarations

References

Additional Declarations

Supplementary Files

Status:

Journal Publication

Version 1