Mapping the immunopeptidome of seven SARS-CoV-2 antigens across common HLA haplotypes

doi:10.21203/rs.3.rs-3564516/v1

Download PDF

Article

Mapping the immunopeptidome of seven SARS-CoV-2 antigens across common HLA haplotypes

https://doi.org/10.21203/rs.3.rs-3564516/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 30 Aug, 2024

Read the published version in Nature Communications →

Version 1

posted

You are reading this latest preprint version

Most COVID-19 vaccines have been designed to elicit immunity against the SARS-CoV-2 Spike protein. However, the repeated occurrence of new strains harbouring Spike protein mutations demonstrates ready immune evasion by the SARS-CoV-2 virus and the pressing need to develop more broadly targeting COVID-19 vaccines. To facilitate this, we used mass spectrometry to identify immunopeptides that are derived from seven structural and non-structural SARS-CoV-2 proteins that are relatively conserved across viral strains (N, E, Nsp1, Nsp4, Nsp5, Nsp8, Nsp9) and presented by prevalent Human Leukocyte Antigen (HLA) class I and class II molecules. Two different B-lymphoblastoid cell lines were chosen to map immunopeptidomes covering some of the major HLA types across the global human population. We used DNA plasmid transfection and direct antigen delivery approaches to sample different antigens. We found 248 unique HLA class I and HLA class II bound peptides with 71 derived from N, 12 from E, 28 from Nsp1, 19 from Nsp4, 73 from Nsp8 and 45 peptides derived from Nsp9. Over half of the viral peptides are reported for the first time. T cell responses were tested for 56 of the detected peptides and we show robust CD8⁺ and CD4⁺ T cell responses against several peptides from the N, E and Nsp9 proteins. Results from this study will aid the development of next-generation COVID vaccines targeting epitopes from across a number of SARS-CoV-2 proteins.

Biological sciences/Immunology/Antigen processing and presentation/Cellular immunity

Biological sciences/Immunology/Vaccines/Peptide vaccines

Biological sciences/Biochemistry/Proteomics

The initial vaccines designed to combat COVID-19 were predominantly focussed on eliciting strong antibody-mediated immune responses against the original Wuhan strain Spike protein. Whilst this focussed approach led to the generation of several highly effective, safe vaccines within an astonishingly brief timeframe, it also comes with some limitations. For one, the SARS-CoV-2 virus has acquired various mutations, some of which result in an altered Spike protein which impacts vaccine efficacy^{1, 2}. Additionally, it is becoming increasingly clear that apart from eliciting strong antibody responses, successful recruitment of T cells, especially those recognising conserved viral epitopes, as part of the anti-SARS-CoV-2 immune response is highly beneficial due to their strain cross-reactivity^3–5.

The first step of generating adaptive immune responses against pathogens, is the processing of foreign proteins into short fragments (peptide antigens), which are presented to immune cells by Human Leukocyte Antigen (HLA) class I and class II molecules. Strong antibody responses are the prime target of vaccines and rely on antigen-specific HLA class II-mediated presentation to CD4⁺ T cells, which subsequently activate B cells thus leading to antibody generation. Whilst antibody levels against SARS-CoV-2 diminish within the first few months post-vaccination, T cell immunity remains functional for over six months following infection^6–8. It is now also understood that new SARS-CoV-2 variants are, to a degree, able to escape humoral immunity, but can still be recognised by the T cell arm of the immune system⁹. Whilst antibody-mediated immune responses rely on HLA class II antigen presentation to CD4⁺ T cells, cytotoxic CD8⁺ T cell responses are primed via the HLA class I antigen presentation pathway and can provide potent protection against infection by eradicating infected cells and preventing viral spreading^10–13. The identification and study of HLA-bound peptides (immunopeptidomics) is possible using specialised, mass spectrometry centred protocols¹⁴. Yet, immunopeptidomic data of SARS-CoV-2 epitopes is still relatively scarce. Currently, the field mostly relies on prediction of HLA class I and II SARS-CoV-2 peptide epitopes and directed peptide mapping of T cell reactive epitopes to instruct vaccine design^{15, 16}. We have previously developed the RAVEN™ AI model to design T cell epitope-based viral vaccines and shown that a RAVEN™ designed vaccine protects against severe symptoms of SARS-CoV-2 infection in mice¹¹. However, the prediction of natural processing and presentation of viral peptides by RAVEN™ and other tools requires functional or immunopeptidomic based training and validation with few ground truth datasets available to refine algorithms for SARS-CoV-2¹⁷. Immunopeptidomics is a mass spectrometry-based approach which can uncover experimentally derived peptide antigens presented by HLA molecules that have successfully undergone various stages of antigen processing such as proteasome and aminopeptidase cleavage, endoplasmic reticulum trafficking and HLA binding¹⁴.

Overall, there are only few SARS-CoV-2 immunopeptidomic studies, two of which focus solely on the Spike protein and its presentation by HLA class II molecules^{18, 19}. The Sabeti group investigated the HLA class I immunopeptidome of SARS-CoV-2 infected HEK293T and A549 cell lines, with a total of 25 unique SARS-CoV-2 peptides reported²⁰. The Samuels group reported 26 HLA class I- and 36 HLA class II-restricted SARS-CoV-2 peptides using infected cells (IHW01070, HEK293T and Calu-3) and overexpression of SARS-CoV-2 genes in 721.221 B-lymphoblastoid cells with monoallelic HLA expression²¹. A further report from the Yee group identified five epitopes from the non-structural protein (Nsp) 13 and membrane protein²². Overall, the collective immunopeptidomic work has so far reported a total of 79 SARS-CoV-2 unique native peptide antigens.

Here we present 200 SARS-CoV-2 derived unique native peptides and post-translational modifications thereof. Notably, these peptides are presented by HLA molecules widely represented in the global population, including class I HLA-A*01:01 (4.8%) and A*02:01 (15.3%) and class II HLA-DQB1*02:01 (15.0%) and DPB1*04:01 (23.3%)²³. Our work characterises peptides from the nucleocapsid, envelope protein, Nsp1 (host translation inhibitor), Nsp4 (transmembrane protein, part of the viral replication-transcription complex), Nsp5 (main protease), Nsp8 (co-factor of the RNA dependent RNA polymerase) and Nsp9 (part of the viral replication-transcription complex). Overall, our findings uncover a significant number of naturally processed SARS-CoV-2 immunopeptides which can inform the design of second-generation vaccines targeting humoral as well as cellular immunity against a mix of SARS-CoV-2 antigens.

Applying complementary approaches to identify novel SARS-CoV-2 epitopes

To explore the SARS-CoV-2 derived immunopeptidome presented by endogenous HLA molecules in human cells we chose B lymphoblastoid cell lines (BLCL) that are known to express high levels of class I and class II HLA in the context of naturally occurring HLA haplotypes (Suppl. Figure 1A). B cells are biologically relevant as they play a central role in the adaptive immune response and the specific cell lines chosen carry HLA allotypes that are highly representative of substantial proportions of the human population (Suppl. Figure 1B). In this study we have explored the conventional transfection approach of cells with plasmids encoding SARS-CoV-2 nucleocapsid (N), envelope (E), Nsp8 and Nsp9 genes. Together with the structural N and E proteins, Nsp8 and Nsp9 are among the most highly abundant non-structural proteins detectable from a few hours post infection with continuing expression until at least 24h post infection²⁴. The transfection approach with plasmids containing a fluorescent marker allows the successfully transfected cells to be sorted, facilitating the establishment of stable cell lines of high purity. Such cells can be readily expanded in culture allowing the collection of a high number of cells conducive to deep coverage immunopeptidomics datasets that facilitate the discovery of rare peptide subsets, such as from SARS-CoV-2. However, this approach requires approximately two months and substantial tissue culture resources to complete. Hence, we also explored an alternative approach of directly delivering SARS-CoV-2 proteins into the cell. We hypothesised this approach would be capable of directing the viral proteins into both, class I and class II antigen presentation pathways, thereby maximising the detection of not only HLA class II, but also HLA class I derived SARS-CoV-2 epitopes. Electroporation of purified recombinant viral and other proteins is a time efficient, established technique with the steps from protein delivery into mammalian cells to cell harvest only requiring 48h. We reasoned that if such a delivery method could make the electroporated protein accessible to both antigen processing pathways, it would be of great use in future antigen discovery settings. Such an expedited approach would facilitate timely epitope discovery and vaccine development when novel pathogens or pathogen variants are encountered. The individual immunopeptidomics workflows for BLCL undergoing direct delivery of antigen and BLCL stable transfectants are depicted in Fig. 1 and follow previously described methodologies^{14, 25}.

Characterisation of HLA ligands presented by BLCL transfected with SARS-CoV-2 derived genes

We used mass-spectrometry based immunopeptidomic analysis to identify novel epitopes of the viral E, N, Nsp8 and Nsp9 proteins in stably transfected 9004 and 9087 BLCL cell lines. In all cases, raw data was searched using PEAKS 10 online against a human and SARS-CoV-2 combined proteome database. We detected an average of 34,164 8- to 12-mer human peptides isolated using the anti-pan class I antibody W6/32 and an average of 76,863 10- to 20-mer peptides per sample isolated using a mix of HLA class II specific antibodies (SPV-L3, B7/21 and LB3.1) with 5% FDR cut-off applied (Fig. 2A). In total, in excess of 500,000 nonredundant mammalian peptide sequences were identified. Collectively, this deep coverage of the BLCL immunopeptidome translated into the detection of 181 non-redundant SARS-CoV-2 derived peptides (Table S1). The non-structural proteins Nsp8 and Nsp9, which are not currently in focus for vaccine development, are efficiently presented: 78% of the Nsp8 and 85% of the Nsp9 sequences were covered by the 9004 and 9087 BLCL immunopeptidomes.

The overall length distribution of peptides eluted from class I and class II HLA molecules are shown in Fig. 2B. As expected, peptides presented by HLA class I were predominantly 9 amino acids in length, while HLA class II bound peptides were mainly 12–18 amino acids long. It is noteworthy that for the 9087 BLCL we additionally detected a comparatively high number of 8-mer peptides in the HLA class I dataset. Closer analysis revealed that the majority of 8-mer peptides in 9087 were attributable to the HLA-B*08:01 allotype (Suppl. Figure 2A-B). Although HLA-B*08:01 is known to bind to 8-mer peptides²⁶, our result was somewhat unexpected as previous studies have reported the number of HLA-B*08:01 derived 8-mers in proportion to 9-mers to constitute only up to a factor of 0.4 of peptides versus a factor of 0.8 in our dataset^{27, 28}. Notably, the trapped ion mobility cell of the Bruker timsTOF Pro instrument allowed ready MS/MS interrogation of singly charged precursors by targeting defined regions of the mobiligram (m/z vs ion mobility). Targeting singly charged precursors for MS/MS is particularly important for the detection of shorter non-tryptic peptides. We therefore analysed the charge state of 8-mers in our dataset and indeed confirmed that the majority carried a single charge in contrast to 9-mers which typically acquired a double charge (Suppl. Figure 2C). These singly charged peptides likely remained undetected when using alternative mass spectrometry approaches in earlier studies. Next, we performed binding motif analysis, the main anchor residues were in line with the expected binding motifs of HLA-I allotypes expressed in the cell lines, a representative 9087 elution is shown (Fig. 2C). In summary, this dataset not only serves its primary purpose of detecting a high number of previously unknown SARS-CoV-2 derived peptides, but also represents a valuable resource as an extended human immunopeptidome study of BLCLs with an expanded peptide detection for particularly 8-mers of the HLA-B*08:01 allotype (Tables S2, S3).

HLA-peptide identification using direct delivery of SARS-CoV-2-derived proteins

As an alternative approach, we chose to deliver SARS-CoV-2 proteins via electroporation into BLCL cells (direct delivery). Nsp9 and N proteins were used as representatives of shorter and longer proteins to compare both approaches. Additionally, Nsp1, Nsp4 and Nsp5 were delivered into BLCL to expand the number of investigated SARS-CoV-2 proteins in this study. On average, 10,578 8- to 12-mers were identified in HLA class I eluted samples and 22,044 10- to 20-mers in HLA class II eluted samples (Fig. 3A). These numbers are in line with the lower cell input used for direct delivery experiments compared to the transfected cells. The length distribution of eluted peptides was very similar to the previously detected length preference of transfected cells (Fig. 3B). The peptide binding analysis for the direct delivery approach was a close match to binding motifs from transfectants, a representative 9004 elution is shown (Fig. 3C). Of note, in 9004 BLCL the HLA-A*02:01 motif was predominant, so that a separation of motifs using Gibbs clustering was not evident (data not shown). Overall, we detected 81 unique SARS-CoV-2 derived peptides from the direct antigen delivery approach stemming from HLA class I and class II processing.

Comparison of direct delivery and stable transfection approaches

We next aimed to further examine the data for SARS-CoV-2 N protein and Nsp9 for which we have acquired datasets from both direct delivery and stable transfection approaches. For N protein, we detected a total of 32 and 33 peptides from HLA class I and II processing pathways in stably transfected 9004 and 9087 BLCL respectively. The outcome was markedly different for direct delivery where we found no N derived peptides in 9004 BLCL and ten peptides exclusively in the class II elution of 9087 BLCL. It would therefore appear that the use of both methods in combination allowed broader coverage of presented viral peptides. The nucleocapsid protein has been categorised as one of the less presentable canonical proteins of SARS-CoV-2 and this might have been a contributing factor to the high variability between methods²⁰. The presentation of Nsp9-derived ligands was more comparable between both methods. Peptide matches featuring the same 9-mer core were found between direct antigen delivery and stable transfected cells with an additional number of peptides detected only in stably transfected cells (Table S1, Fig. 4A). Overall, there was a substantial overlap in the HLA class I- and class II-derived antigens from Nsp9 using direct antigen delivery and stable transfection whereas for nucleoprotein-derived peptides the overlap between the methods is restricted to class II-derived peptides.

Immunopeptidomic profiling of viral antigen presentation

The detected viral HLA ligands were aligned to their SARS-CoV-2 source protein to generate an antigen presentation density map (Fig. 4A). Additionally, mutations found in these antigens in variants of concern are indicated as spikes projecting from the protein bar, thereby rapidly highlighting more conserved epitopes of potential high interest for vaccine design. The alignment revealed twelve hotspots of antigen presentation with clusters of closely located immunopeptides which are repeatedly detected across the different HLA classes, allotypes and cell lines (Fig. 4B). Collectively, binding prediction to source cell line-specific HLA allotypes confirmed that 53% (105/200) of the detected, PTM-stripped viral immunopeptides were predicted binders to at least one HLA allotype expressed by the cell lines. Specifically, the predicted binding of the eluted peptides to the expressed HLA class I and class II allotypes using netMHCpan and netMHCIIpan assigned 68% of 9-mers and 40% of 15-mers (9004 BLCL) as well as 77% of 9-mers and 83% of 15-mers (9087 BLCL) to at least one of the expressed HLA class I or class II allotypes respectively (Table S1).

Due diligence in vaccine design also aims to exclude, as much as possible, any potential cross-reactivity of the pathogenic antigen to human proteins to avoid adverse events such as the development of autoimmunity. We have therefore analysed the detected SARS-CoV-2-derived HLA ligands for similarity to the human genome. Each peptide was allowed up to two mismatched amino acids without insertions or deletions. Using this approach, 43 out of 200 peptides displayed similarity to human protein-derived peptides (Table S4).

Post-translational modification (PTM) of peptide ligands

Among all 248 identified non-redundant viral peptides, 54 peptides contained modified residues. Among the detected PTMs were oxidation (M), deamidation (Q and N), dehydration, acetylation, cysteinylation and others, consistent with known modifications of HLA-presented antigen, in source fragmentation of peptide ions or artefacts induced by sample processing (Suppl. Figure 3A). Two deamidated Asn-containing peptides are of particular interest, ³²YYN(+ 0.98)TTKGGRF⁴¹ and ²⁶⁷AYN(+ 0.98)VTQAF²⁷⁶ originating from Nsp9 and nucleoprotein respectively. Both were derived from HLA class I eluted ligands of stably transfected 9004 BLCLs and feature the NX(S/T) motif. We have recently shown that this modification is the result of N-glycan removal and as such is a feature of formerly glycosylated precursors³⁰. Indeed, glycoproteomic analysis has previously found that N269 of the nucleocapsid protein has a 94% glycan occupancy rate with the glycan mostly comprised of ~ 85% high-mannose type glycosylation³¹.

Immunogenicity of a subset of detected SARS-CoV-2 peptides

Next, we chose 56 SARS-CoV-2 peptides based on their predicted HLA binding while excluding peptides containing reactive cysteines. Peptides originating from both, the transfection and direct delivery approaches were synthesised and validated via LC-MS/MS and peptide spectrum matching (Suppl. Figure 3B-E). These peptides are currently documented in our virusMS database (https://virusms-dev.erc.monash.edu/browse.jsp; EXP_003; Username: visitor; Password: FDFRsfs#gvdf!)³². The synthetic peptides were subsequently distributed into three pools of 17–20 peptides with nested peptide sets pooled together where possible and used in T cell activation assays using PBMC collected at 12–223 days post SARS-CoV-2 infection from 9 individuals expressing HLA allotypes that matched the BLCLs (Table S5). All donor PBMCs were stimulated with three individual peptide pools and expanded for 10 days before the assessment of SARS-CoV-2 − reactive T cells by intracellular cytokine production. Responses against a number of peptide pools were detected across individuals (Fig. 5A). Cultures responding to a pool were restimulated on day 12–13 with individual peptides or nested subsets from peptide pools (Fig. 5B-D). Remarkably, in one donor with PBMC collection at 72 days post-symptom onset, we detected CD4⁺ T cell responses against nested peptide pairs derived from E, Nsp1- and Nsp9-proteins (Fig. 5B). The nested peptides E_{57 − 65} (YVYSRVKNL) and E_{58 − 73} (VYSRVKNLNSSRVPDL) are both predicted to bind to HLA-DRB1*01:01, which is expressed by both the source BLCL and the donor. The nested peptides Nsp1_{88 − 99} (LVAELEGIQYGR) and Nsp1_{89 − 97} (VAELEGIQY) could be derived from either HLA-DRB1*01:01 or HLA-DQB1*05:01, which are both shared between the BLCL source (DQA1*01:01) and donor (DQA1*01:01/05, DQA1*03:02/03/09). A further shared allotype, HLA-DPB1*04:01, is predicted to bind the remaining nested peptides Nsp9_{45 − 55} (LLSDLQDLKWA) and Nsp9_{45 − 59} (LLSDLQDLKWARFPK). The donor and BLCLs also share HLA-DPA1*01:03 for which both are homozygous.

Strikingly, we could further detect a dominant response across three individuals against the 19-mer peptide N_{343 − 361} (DPNFKDQVILLNKHIDAYK) whilst the overlapping N_{333 − 349} peptide (YTGAIKLDDKDPNFKDQ) did not have a noteworthy contribution to the antigen-specific response against pool 2 (Fig. 5C). PBMC from these three donors 1, 8 and 9 were collected at 109, 210 and 12 days post-symptom onset, respectively. The peptide N_{343 − 361} was detected in a HLA-class II elution from N protein-transfected 9004 BLCL (DRB1*01:01, DQB1*05:01, DPB1*04:01). Donor 1 shares DQB1*05:01 while donors 8 and 9 share the highly prevalent DPB1*04:01 allotype. Interestingly, whilst donors 1 and 8 were unvaccinated, donor 9 was a breakthrough infection indicating the initiation of a non-Spike N-specific T cell response post-vaccination. These results indicate that convalescent COVID-19 patients have persisting SARS-CoV-2 − specific CD4⁺ T cell immunity against N protein for over 7 months post-infection.

In addition to validating a number of peptides that elicit a CD4⁺ T cell response, we also detected a CD8⁺ T cell response against pool 3 in one donor where PBMC collection was at 214 days post-symptom onset (Fig. 5D). Due to limited sample size, further tests were carried out on sub-pools. We could narrow down the response to nested sub-pool 3B containing 10-15-mer peptides N_{71 − 85} (GVPINTNSSPDDQIG), N_{77 − 86} (NSSPDDQIGY) and N_{77 − 87} (NSSPDDQIGYY). N_{77 − 86} and N_{77 − 87} are both predicted to bind HLA-A*01:01, an allotype shared between the source BLCL and the immunoreactive PBMC donor.

Over recent years SARS-CoV-2 has become endemic and the disease still continues to pose a high burden on health systems worldwide. This continued burden is mainly caused by the spread of several new variants. Thus, an unmet need remains for the development of novel vaccines able to target several viral strains and confer wide-spread protection in the global population. Next generation of vaccines would benefit from eliciting T-cell mediated immunity towards multiple antigens, adding a further level of protection in addition to existing humoral immunity towards the Spike glycoprotein. Here we highlight several promising antigens for which a number of broadly reactive T cell epitopes were identified following immunopeptidomics assessment of their presentation.

We assembled a comprehensive in-depth profiling of BLCL-derived immunopeptides leading to the detection of a total of 128 non-redundant SARS-CoV-2 peptides in HLA-class I elutions and 158 unique SARS-CoV-2 peptides in HLA-class II elutions of stably transfected BLCL and collectively a total of 248 unique peptides. The peptides bind highly prevalent HLA alleles expressed by the chosen BLCL. Using peptide binding prediction tools in combination with an in vitro peptide stimulation of PBMC from convalescent donors, we validated at least eight peptides as eliciting an immune response. Our findings revealed CD4⁺ and CD8⁺ T cell epitopes from the Nucleoprotein that could be used in the future to elicit well-rounded immune responses facilitating not only humoral immunity via activation of CD4⁺ T cells, but also cytotoxic and tissue-resident immunity by CD8⁺ T cells. Strikingly, without exception all peptides with confirmed T cell responses were part of detected antigen presentation hotspots (Fig. 4B). To date, it is not clear what constitutes a protein region with high antigen processing and presentation compared to other regions. More work is needed to understand how proteasome processivity, post-translational modifications, antigen structure, influence antigen processing and why some antigenic regions go on to dominate the immunopeptidome.

Overall, our study provides important insights into SARS-CoV-2-specific T cell responses and contributes to our knowledge on experimentally verified, readily presented SARS-CoV-2 antigens. Prior to this study, the experimentally validated SARS-CoV-2 immunopeptidome was limited, but our in-depth probing of the immunopeptidome allowed us to validate 14% of the 56 tested peptides as epitopes of T cell targets. The immunopeptidome dataset adds a further layer of information to available T cell epitope data by exposing HLA ligands that are readily processed and presented by prevalent HLA allotypes. We anticipate that this new set of immunopeptides will be of importance to rationally design the next-generation COVID-19 vaccines to elicit broad T cell and B cell immunity targeting conserved epitopes across a range of emerging SARS-CoV-2 variants.

Declaration of Interests

NT, EJL, GP, MSK, JVK and ABS are employed by Evaxion Biotech A/S that holds IP for identifying neoepitopes and personalized immunotherapy. AWP is on the scientific advisory board of Evaxion Biotech A/S. AWP is on the advisory board of Bioinformatics Solutions (Canada), Grey Wolf Therapeutics (UK) and is a co-founder of Resseptor Therapeutics (Australia).

Acknowledgements

This work was supported by the Innovation Fund Denmark (0174-00039B). We thank Lauren Howson and Julie McAuley for provision of reagents. Authors acknowledge the Monash University FlowCore and Melbourne Cytometry Platform for flow cytometry and cell sorting. Computational resources were supported by the research cloud of Australian Research Data Commons, specifically designed for high-performance research computing. A.W.P. is supported by an Australian National Health and Medical Research Council (NHMRC) Investigator Grant (2016596). C.L. was supported by an NHMRC CJ Martin ECR Fellowship (1143366). A.B. was supported by the National Psoriasis Foundation (817907) and the Rebecca L. Cooper Medical Research Foundation (PG2020775). K.K. was supported by a NHMRC L1 (#1173871), T.H.O.N. by a NHMRC EL1 (#1194036) and a MRFF Award (#2016062) to K.K., T.H.O.N. and L.C.R; J.R. supported by NHMRC Investigator grant.

Cell lines and culture

The EBV transformed human B lymphoblastoid cell lines (BLCL) IHW09004 (A*02:01:01:01, B*27:05:02, C*01:02:01, DRA*01:01, DRB1*01:01:01, DRB6*01:01, DQA1*01:01:01, DQB1*05:01:01:03, DPA1*01:03:01:02, DPB1*04:01:01:01) and IHW09087 (A*01:01:01:01, B*08:01:01:01, C*07:01:01:01, DRA*01:02, DRB1*03:01:01, DRB3*01:01:02, DQA1*05:01:01:02, DQB1*02:01:01, DPA1*01:03:01, DPB1*03:01:01, DPB1*04:01:01) were obtained from the Victorian Transplantation and Immunogenetics Service. Cells were maintained in RPMI-10: RPMI (Invitrogen) supplemented with 10% FCS, 2 mM glutamine, 1% (v/v) non-essential amino acids, 5 mM HEPES, 50 µM β-mercaptoethanol, 50 IU/ml penicillin and 50 µg/ml streptomycin in upright standing flasks at high density and a splitting regime of 1:3 − 1:4 in 37°C/5% CO₂.

Protein expression and purification

SARS-CoV-2 RNA was extracted from second passage Vero cells infected with original SARS-CoV-2 patient isolate³³ using the QiaAmp Viral RNA Mini Kit (Qiagen) according to manufacturer’s instructions and a cDNA library was generated using and the SuperScript™ IV First-Strand Synthesis System (Invitrogen) and random hexamer primers. The DNA sequence coding for SARS-CoV-2 N protein was amplified from the cDNA library via PCR using primers 5’ GTAGGATCCTCTGATAATGGACCCCAAAATCAG 3’ and 5’ AGTACCGGTGGCCTGAGTTGAGTCAGCAC 3’ and cloned into a modified pHLsec expression vector³⁴ containing a murine IgK secretion signal sequence and c-terminal TwinStrepTag. NP was expressed for 7 days in Expi293F cells (GIBCO) transiently transfected with pHlSec-NP using polyethyleneimine³⁵. Culture supernatant was clarified at 12000 g, diluted with an equal volume of buffer containing 100 mM Tris, 150mM NaCl 1mM EDTA, filtered (0.8 µM membrane) and passed over a Streptactin-XT sepharose column (IBA). Bound NP was washed extensively with BTBS buffer (20mM Bis-Tris pH 6, 400 mM NaCl) and eluted with 20mM Biotin BTBS. Fractions containing NP were pooled and further purified via Superdex S200 Gel permeation chromatography in BTBS. Peak fractions were concentrated using an Amicon centrifugal filter (30 kDa MWCO) and stored at -80 ˚C.

The coding sequences for Nsp1, 4, 5 and 9 were cloned into pET-28 vector with a cleavable N-terminal His-tag and purified as described previously for Nsp9³⁶.

Direct Delivery of Antigen

For electroporation of soluble SARS-CoV-2 derived proteins, aliquots of 1x10⁷ cells were resuspended in 0.5 ml RPMI containing 20 µg of a purified SARS-CoV-2 protein. Following electroporation (390 V, 975 µF, ∞) in 4 mm MicroPulser Electroporation Cuvettes (Biorad, #1652088) using the Gene Pulser Xcell™ Electroporation Systems (Biorad), cells were transferred to tissue culture flasks and maintained in RPMI medium as above. Following incubation of 48 hrs at 37°C/5% CO₂, cells were harvested and washed in PBS. After washing, 0.9 x 10⁸ to 1.6 x 10⁸ cells were harvested and the cell pellet snap-frozen in liquid nitrogen.

Molecular cloning and generation of transfected cell lines

SARS-CoV-2 protein containing plasmids as deposited by the Krogan group with Addgene (141385, 141391, 141375) were used to clone genes of interest into the pEF1α-IRES-DsRed-Express2 Vector (Clontech) using the EcoRI and BamHI restriction enzymes^{37, 38}. For transfection, 40 µg of plasmid was mixed with 1 x 10⁷ cells in 800 µl of RPMI medium and electroporated as above. After 48h, cells were cultured under G418 selection and later sorted for DsRed expression. Pellets of 4 x 10⁸ to 1 x 10⁹ stably transfected cells were collected.

Purification of peptide-HLA complexes

Cell pellets were stored at -80°C until further use. Isolation of peptide HLA complexes has been described in detail previously^{14, 25}. Briefly, for large scale experiments stably transfected cells were ground in a Retsch Mixer Mill MM 400 under cryogenic conditions or were directly lysed for small scale experiments (direct antigen delivery). Cells were lysed in 0.5% IGEPAL (Sigma-Aldrich, #18896), 50 mM Tris, pH 8, 150 mM NaCl (Merck-Millipore, #106404) and protease inhibitors (Complete Protease Inhibitor Cocktail Tablet, 1 tablet per 50 mL solution; Roche Molecular Biochemicals, #11697498001) for 1 hour at 4°C with slow end-over-end mixing. Peptide-HLA complexes were immunoaffinity captured from clarified cell lysates by passing through the pan-HLA class I antibody W6/32 bound to protein A sepharose, followed by passing lysate through an HLA class II antibody mixture bound to protein A sepharose (anti-HLA-DQ SPV-L3 : anti-HLA-DP B7/21 : anti-HLA-DR LB3.1 at 1:1:1 ratio). For large scale peptide-HLA elution, antibodies previously underwent an additional step of crosslinking to protein A sepharose. Bound peptide-HLA complexes were eluted with 10% acetic acid. For small scale peptide-HLA elution, the eluted mixture of peptides was purified by Amicon® 5kDa Ultra-Centrifugal filter unit (Merck Millipore) and concentrated by OMIX C18 Pipette Tips (Agilent, A57003100) prior to mass spectrometric analysis. For large scale elution, the peptide-HLA mixtures were fractionated off-line using a 4.6-mm × 100-mm monolithic reversed-phase C18 high-performance liquid chromatography (HPLC) column (Chromolith SpeedROD; Merck Millipore) and an ÄKTAmicro HPLC system (GE Healthcare). The mobile phase consisted of Buffer A (0.1% trifluoroacetic acid; Thermo Fisher Scientific) and buffer B (80% acetonitrile, 0.1% trifluoroacetic acid; Thermo Fisher Scientific). Peptide-HLA mixtures were loaded onto the column at a flow rate of 1 mL/min with separation based on a gradient of 2 − 40% Buffer B for 4 min, 40 − 45% for 4 min and a final rapid 2-min increase to 100%. Fractions (1 ml) were collected, pooled, vacuum-concentrated and diluted in 0.1% formic acid with inclusion of retention alignment peptide standards (iRT peptides³⁹) prior to mass spectrometric analysis.

Mass spectrometry

Samples were analysed using a hybrid trapped ion mobility-quadrupole time of flight mass spectrometer (Bruker timsTOF Pro, Bruker Daltonics) coupled to nanoElute UHPLC liquid chromatography system. The HLA ligands were loaded onto a Trap PepMap Neo (C185mm x 300um 5um) trap column, eluted and separated on an IonOpticks Aurora (25 cm x 75um i.d.) analytical column using a linear step-wise gradient of Buffer A (Optima water, 2% acetonitrile, 0.1% formic acid) to Buffer B (acetonitrile, 0.1% formic acid) initially 0–17% buffer B over 60 min, then to 25% over the next 30 min, 37% over the next 10 min followed by a rapid rise to 95% Buffer B over a subsequent 10 min period with flow rate set to 300 nl/min in PASEF mode. Data dependent acquisition was performed with following settings: m/z range: 100-1700mz, capillary voltage:1600V, Target intensity of 30000, TIMS ramp of 0.60 to 1.60 Vs/cm 2 for 166 ms.

LC-MS/MS Data Analysis

Liquid Chromatography with tandem mass spectrometry (LC-MS/MS) data was searched against the human proteome appended with the Wuhan SARS-CoV-2 proteome using PEAKS Online 10 and peptide identities subject to strict bioinformatic criteria including the use of a decoy database to apply a false discovery rate (FDR) cut-off of 5%. For SARS-CoV-2 peptides additional high confidence re-testing of detection threshold at 1% FDR was performed. The following search parameters were used: no cysteine alkylation, no enzyme digestion (considers all peptide bond cleavages), instrument-specific settings for TimsTOF Pro (parent and fragment ion tolerance of 20 ppm and 0.02 Da respectively), human reviewed uniprot database (Uniprot/Swissprot v2020_03), variable modifications set to: oxidation of Met, Acetylation of Lys and deamidation of Asn/Gln. Additionally, Peaks PTM search was performed after a Peaks DB search with all default in-built modifications with same mass tolerance settings as Peaks DB. Cross-reactivity assessments were done using the agrep UNIX command (https://github.com/PurcellLab/agrep_for_crossreactivity) to search for 1 or 2 mismatched amino acids between detected SARS-CoV-2 peptides and the human proteome (UniProt download 2022_03). NetMHCpan and NetMHCIIpan binding prediction was used with %Rank cut-off 2 and 5 respectively to include strong and weak binders in the analysis.

Ethics statement

Human blood samples were collected between 12–223 days post-SARS-CoV-2 infection in heparinised tubes. Peripheral blood mononuclear cells (PBMCs) were isolated by density-gradient centrifugation (Ficoll-Paque, Cytiva) and cryopreserved in fetal calf serum with 10% DMSO (Cat# D2650, Sigma-Aldrich). All human experimental work was conducted according to the Declaration of Helsinki principles and the Australian NHMRC Code of Practice. All blood donors provided written informed consent. Ethics approval was granted from the Human Research Ethics Committee of Melbourne Health (HREC/66341/MH-2020) and The University of Melbourne (13344 and 20782).

Expansion of antigen-specific T cells

PBMCs were removed from storage in liquid nitrogen, thawed and washed with complete RPMI (RPMI-1640 with 10% heat-inactivated FCS, 100 mM MEM non-essential amino acids, 55mM 2-mercaptoethanol, 5 mM HEPES buffer solution, 1 mM MEM sodium pyruvate, 1 mM L-glutamine, 100 U mL − 1 penicillin, and 100 mg mL − 1 streptomycin (Gibco/ThermoFisher Scientific)). Antigen-specific T cells were expanded essentially as previously described⁴⁰, by peptide-pulsing one-third of PBMCs with a pool of up to 20 peptides at a total concentration of 10 µM for 1 h at 37°C/5% CO₂, before cells were washed twice with RPMI and added to the remaining autologous PBMCs. Cells were maintained in cRPMI at 37 ˚C/5% CO₂ for 4 days before adding and maintaining a concentration of 20 U/mL of recombinant human IL-2 (Roche Diagnostics, Mannheim, Germany).

T cell re-stimulation and intracellular cytokine staining

Intracellular cytokine staining was performed on day 10–13 to identify antigen-specific T cells after peptide stimulation. T cells were restimulated with 10 µM of individual or pooled SARS-CoV-2 peptides, in the presence of brefeldin A (GolgiPlug, BD Biosciences), monensin (GolgiStop, BD Biosciences) and anti-CD107a-AF488 antibody (Invitrogen). Cells were incubated for 5 h at 37°C/5% CO₂ and then stained with anti-CD3-BV510 (Biolegend), anti-CD4-BV650, anti-CD8-PerCPCy5.5 (BD Biosciences) and NIR Live Dead dye (Invitrogen). Cells were fixed and permeabilised using Cytofix and Cytoperm (BD Biosciences) and then stained with anti-TNF-AF700 and anti-IFN-γ-V450 (BD Biosciences). Samples were acquired on a BD LSRII Fortessa and analysed using FlowJo v10 software.

Plante, J.A., et al., Spike mutation D614G alters SARS-CoV-2 fitness. Nature, 2021. 592(7852): p. 116-121.
Jangra, S., et al., SARS-CoV-2 spike E484K mutation reduces antibody neutralisation. Lancet Microbe, 2021. 2(7): p. e283-e284.
Low, J.S., et al., Clonal analysis of immunodominance and cross-reactivity of the CD4 T cell response to SARS-CoV-2. Science, 2021. 372(6548): p. 1336-1341.
Mallajosyula, V., et al., CD8(+) T cells specific for conserved coronavirus epitopes correlate with milder disease in COVID-19 patients. Sci Immunol, 2021. 6(61).
Augusto, D.G., et al., A common allele of HLA is associated with asymptomatic SARS-CoV-2 infection. Nature, 2023.
Bilich, T., et al., T cell and antibody kinetics delineate SARS-CoV-2 peptides mediating long-term immune responses in COVID-19 convalescent individuals. Sci Transl Med, 2021. 13(590).
Nguyen, T.H.O., et al., Robust SARS-CoV-2 T cell responses with common TCRalphabeta motifs toward COVID-19 vaccines in patients with hematological malignancy impacting B cells. Cell Rep Med, 2023. 4(4): p. 101017.
Le Bert, N., et al., SARS-CoV-2-specific T cell immunity in cases of COVID-19 and SARS, and uninfected controls. Nature, 2020. 584(7821): p. 457-462.
Geers, D., et al., SARS-CoV-2 variants of concern partially escape humoral but not T-cell responses in COVID-19 convalescent donors and vaccinees. Sci Immunol, 2021. 6(59).
Carter, B., et al., A pan-variant mRNA-LNP T cell vaccine protects HLA transgenic mice from mortality after infection with SARS-CoV-2 Beta. Front Immunol, 2023. 14: p. 1135815.
Persson, G., et al., DNA immunization with in silico predicted T-cell epitopes protects against lethal SARS-CoV-2 infection in K18-hACE2 mice. Front Immunol, 2023. 14: p. 1166546.
Tai, W., et al., An mRNA-based T-cell-inducing antigen strengthens COVID-19 vaccine against SARS-CoV-2 variants. Nat Commun, 2023. 14(1): p. 2962.
Arieta, C.M., et al., The T-cell-directed vaccine BNT162b4 encoding conserved non-spike antigens protects animals from severe SARS-CoV-2 infection. Cell, 2023. 186(11): p. 2392-2409 e21.
Purcell, A.W., S.H. Ramarathinam, and N. Ternette, Mass spectrometry-based identification of MHC-bound peptides for immunopeptidomics. Nat Protoc, 2019. 14(6): p. 1687-1707.
Peters, B., M. Nielsen, and A. Sette, T Cell Epitope Predictions. Annu Rev Immunol, 2020. 38: p. 123-145.
Mateus, J., et al., Selective and cross-reactive SARS-CoV-2 T cell epitopes in unexposed humans. Science, 2020. 370(6512): p. 89-94.
Prachar, M., et al., Identification and validation of 174 COVID-19 vaccine candidate epitopes reveals low performance of common epitope prediction tools. Sci Rep, 2020. 10(1): p. 20465.
Parker, R., et al., Mapping the SARS-CoV-2 spike glycoprotein-derived peptidome presented by HLA class II on dendritic cells. Cell Rep, 2021. 35(8): p. 109179.
Knierman, M.D., et al., The Human Leukocyte Antigen Class II Immunopeptidome of the SARS-CoV-2 Spike Glycoprotein. Cell Rep, 2020. 33(9): p. 108454.
Weingarten-Gabbay, S., et al., Profiling SARS-CoV-2 HLA-I peptidome reveals T cell epitopes from out-of-frame ORFs. Cell, 2021.
Nagler, A., et al., Identification of presented SARS-CoV-2 HLA class I and HLA class II peptides using HLA peptidomics. Cell Rep, 2021. 35(13): p. 109305.
Pan, K., et al., Mass spectrometric identification of immunogenic SARS-CoV-2 epitopes and cognate TCRs. Proc Natl Acad Sci U S A, 2021. 118(46).
Lancaster, A.K., et al., PyPop update--a software pipeline for large-scale multilocus population genomics. Tissue Antigens, 2007. 69 Suppl 1(0 1): p. 192-7.
Bojkova, D., et al., Proteomics of SARS-CoV-2-infected host cells reveals therapy targets. Nature, 2020. 583(7816): p. 469-472.
Pandey, K., S.H. Ramarathinam, and A.W. Purcell, Isolation of HLA Bound Peptides by Immunoaffinity Capture and Identification by Mass Spectrometry. Curr Protoc, 2021. 1(3): p. e92.
Reid, S.W., et al., Antagonist HIV-1 Gag peptides induce structural changes in HLA B8. J Exp Med, 1996. 184(6): p. 2279-86.
Gfeller, D., et al., The Length Distribution and Multiple Specificity of Naturally Presented HLA-I Ligands. J Immunol, 2018. 201(12): p. 3705-3716.
Sarkizova, S., et al., A large peptidome dataset improves HLA class I epitope prediction across most of the human population. Nat Biotechnol, 2020. 38(2): p. 199-209.
Munday, P.R., et al., Immunolyser: A web-based computational pipeline for analysing and mining immunopeptidomic data. Comput Struct Biotechnol J, 2023. 21: p. 1678-1687.
Mei, S., et al., Immunopeptidomic analysis reveals that deamidated HLA-bound peptides arise predominantly from deglycosylated precursors. Mol Cell Proteomics, 2020.
Supekar, N.T., et al., Variable post-translational modifications of SARS-CoV-2 nucleocapsid protein. Glycobiology, 2021.
Li, C., et al., Resourcing, annotating, and analysing synthetic peptides of SARS-CoV-2 for immunopeptidomics and other immunological studies. Proteomics, 2021. 21(17-18): p. e2100036.
Ogando, N.S., et al., The Enzymatic Activity of the nsp14 Exoribonuclease Is Critical for Replication of MERS-CoV and SARS-CoV-2. J Virol, 2020. 94(23).
Aricescu, A.R., W. Lu, and E.Y. Jones, A time- and cost-efficient system for high-level protein production in mammalian cells. Acta Crystallogr D Biol Crystallogr, 2006. 62(Pt 10): p. 1243-50.
Fang, X.T., et al., Efficient and inexpensive transient expression of multispecific multivalent antibodies in Expi293 cells. Biol Proced Online, 2017. 19: p. 11.
Littler, D.R., et al., Crystal Structure of the SARS-CoV-2 Non-structural Protein 9, Nsp9. iScience, 2020. 23(7): p. 101258.
Gordon, D.E., et al., A SARS-CoV-2 protein interaction map reveals targets for drug repurposing. Nature, 2020. 583(7816): p. 459-468.
Gordon, D.E., et al., Comparative host-coronavirus protein interaction networks reveal pan-viral disease mechanisms. Science, 2020. 370(6521).
Escher, C., et al., Using iRT, a normalized retention time for more targeted measurement of peptides. Proteomics, 2012. 12(8): p. 1111-21.
Rowntree, L.C., et al., A Shared TCR Bias toward an Immunogenic EBV Epitope Dominates in HLA-B*07:02-Expressing Individuals. J Immunol, 2020. 205(6): p. 1524-1534.

Yes there is potential Competing Interest. NT, EJL, GP, MSK, JVK and ABS are employed by Evaxion Biotech A/S that holds IP for identifying neoepitopes and personalized immunotherapy. AWP is on the scientific advisory board of Evaxion Biotech A/S. AWP is on the advisory board of Bioinformatics Solutions (Canada), Grey Wolf Therapeutics (UK) and is a co-founder of Resseptor Therapeutics (Australia).

Download PDF

Journal Publication

published 30 Aug, 2024

Read the published version in Nature Communications →

Version 1

posted

You are reading this latest preprint version

Mapping the immunopeptidome of seven SARS-CoV-2 antigens across common HLA haplotypes

Status:

Journal Publication

Version 1

Abstract

Figures

Introduction

Results

Applying complementary approaches to identify novel SARS-CoV-2 epitopes

Characterisation of HLA ligands presented by BLCL transfected with SARS-CoV-2 derived genes

HLA-peptide identification using direct delivery of SARS-CoV-2-derived proteins

Comparison of direct delivery and stable transfection approaches

Immunopeptidomic profiling of viral antigen presentation

Post-translational modification (PTM) of peptide ligands

Immunogenicity of a subset of detected SARS-CoV-2 peptides

Discussion

Declarations

Materials and Methods

References

Additional Declarations

Supplementary Files

Status:

Journal Publication

Version 1