Repetitive mild traumatic brain injury elicits a reactive microglial morphology and elevates serum neurofilament light levels, independent of NLRP3 inflammasome inhibition

doi:10.21203/rs.3.rs-3566134/v1

Download PDF

Research Article

Repetitive mild traumatic brain injury elicits a reactive microglial morphology and elevates serum neurofilament light levels, independent of NLRP3 inflammasome inhibition

https://doi.org/10.21203/rs.3.rs-3566134/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

There is growing evidence that a second mild traumatic brain injury (mTBI) sustained prior to cellular and neurological recovery from the first increases risk of cumulative pathological and neurological deficits. Despite this, the pathophysiology of single and repeated mTBI (rmTBI) is not well understood, and as such, no therapeutic interventions are available to mitigate the cumulative deficits induced. The Nod-like receptor pyrin domain containing 3 (NLRP3) inflammasome is an intracellular protein complex that is critical to the innate immune response. Although neuroinflammation is a key feature of mTBI pathophysiology, little is known about the role of the inflammasome in rmTBI. To investigate this, we used a clinically relevant rat model of mTBI and assessed whether pharmacologically inhibiting NLRP3 with the specific NRLP3 inhibitor MCC950, reduced inflammasome activation in the brain and thereby improved acute behavioural and molecular outcomes. We hypothesised that rmTBI would result in up-regulation of inflammasome-associated genes, a reactive microglial phenotype, axonal injury, and neurobehavioural deficits, and that these factors would be attenuated by NLRP3 inflammasome inhibition with MCC950. We found that rmTBI increased hippocampal apoptosis-associated speck-like protein containing a caspase recruitment domain (ASC) mRNA expression, increased microglia cell number in the motor cortex, sensorimotor cortex, hippocampus, corpus callosum and thalamus, and elevated serum neurofilament light (NfL) levels that correlated with both the number of microglia in the corpus callosum, and sensorimotor deficits. These changes were not mitigated by MCC950 treatment. This study provides evidence that the NLRP3 inflammasome does not play a significant role in the acute neuroinflammatory response following rmTBI; however further studies are required to investigate its role chronically.

concussion

neuroinflammation

biomarkers

NfL

behaviour

Mild traumatic brain injury (mTBI) is a global health concern with an estimated 40 to 55 million cases worldwide per year [1–3]. Furthermore, certain populations, such as collision sport athletes, may be at risk of sustaining multiple mTBIs throughout their lifetime [4, 5]. While management strategies rely on symptom assessments, it is now known that recurrent mTBIs sustained prior to physiological recovery from the previous injury can have cumulative and chronic effects [4, 6, 7]. Despite this, the underlying pathophysiology of mTBI is not well defined, and there are no interventions to monitor or enhance physiological recovery.

Pharmacological targeting of mTBI pathophysiology may reduce vulnerability to cumulative effects of repeated mTBI (rmTBI). The Nod-like receptor pyrin domain containing 3 (NLRP3) inflammasome is a multiprotein complex that plays a critical role in the regulation of the innate immune response [8]. Following activation, NLRP3 oligomerises and activates caspase-1, which initiates cleavage of the inactive cytokines pro-IL-1β and pro-IL-18 to their active forms. Caspase-1 also cleaves gasdermin D which leads to pore formation in the cell membrane thereby facilitating release of the potent pro-inflammatory cytokines IL-1β and IL-18 [9, 10]. The functional regulation of the NLRP3 inflammasome requires two steps; i) a priming trigger/insult in which transcriptional upregulation of the constituent molecules of the inflammasome (i.e., NLRP3, ASC and caspase-1) occurs, and ii) a secondary activating step in which NLRP3, ASC and caspase-1 oligomerise to form the multiprotein NRLP3 inflammasome complex. Moderate and severe TBI have been found to increase the expression of the NLRP3 inflammasome, and pharmacological inhibition of the inflammasome decreased microglial reactivity and improved behavioural and functional deficits post-injury [11–14].

While expression of the NRLP3 inflammasome has been found in neurons and astrocytes, the NLRP3 inflammasome is most commonly found in microglia [15–17], the resident immune cells of the central nervous system. Microglia display a range of morphologies that are tightly coupled with their function. Quantification of microglial cell body size and process length are morphological outcomes commonly used to measure microglial reactivity [18, 19]. After a TBI, microglia rapidly migrate to areas of damage and proliferate to increase their functional capacity [20]. Reactive microglia morphology is characterised by an enlarged cell body with shortened processes, with increased capacity for production of bioactive mediators, and heightened ability for chemotaxis compared to microglia that are not responding to a pathological stimulus. While microglial activation is critical to the immediate TBI response [21], dysregulated or persistent activation can exacerbate neuronal damage [22]. As such, chronically activated microglia are hypothesised to contribute to mTBI-related chronic conditions, such as chronic traumatic encephalopathy [23].

The cytokines IL-1β and IL-18, which can be activated through the cleavage of their pro-isomers by the NLRP3 inflammasome, can promote the activation and proliferation of microglia [24, 25]. As such, inhibition of the NLRP3 inflammasome may prevent the deleterious chronic activation of microglia. One promising candidate is the NLRP3-inhibiting compound MCC950. MCC950 is a highly selective compound that binds directly with the Walker B motif of the NLRP3 NACHT domain and prevents the formation of the inflammasome. Furthermore, MCC950 has a suitable bioavailability and pharmacokinetic profile, can penetrate the CNS, and does not have off-target effects on other members of the NLR family that form inflammasomes, including NLRC4 and NLRP1 [26, 27].

A limitation of current therapeutic trials is the lack of objective outcomes of recovery post-TBI that can monitor the efficacy of potential therapeutic interventions. Peripheral levels of neurofilament light (NfL), a biomarker of axonal injury, has growing evidence as an objective biomarker of mTBI in the clinical setting [28–33]. In a rat model of mTBI, we have recently demonstrated that this utility translates to the pre-clinical setting and that the profile of serum NfL follows a similar, albeit abbreviated trajectory to the clinical profile [34]. In addition, the utility of serum NfL to monitor therapeutic improvement has been demonstrated by Karlsson and colleagues (2021) who found serum NfL levels to be decreased by cyclosporine treatment following moderate-TBI in porcine [35]. Given that neuroinflammation contributes to axonal injury [36], and inhibition of microglial activation has been shown to decrease the extent of axonal injury [37], we utilised serum NfL levels as a quantifiable neuropathological outcome to MCC950 efficacy.

Here, we tested the hypothesis that NLRP3 inhibition, with MCC950 treatment, would reduce CNS markers of inflammation, such as measures of reactive microglia (cell number and morphology), and mRNA expression levels of inflammatory mediators (NLRP3, ASC, caspase-1, IL-1β, and IL-18), and reduce serum NfL levels following rmTBI. To achieve this, we used an awake closed-head injury (ACHI) model to give rats five mTBI procedures (i.e., rmTBI) or five sham procedures (i.e., sham). The effect of rmTBI on behavioural, neuroinflammatory outcomes (i.e., NLRP3 inflammasome-related gene expression and microglial analyses), and axonal outcomes (i.e., serum NfL level) was assessed in rats administered the NLRP3 inflammasome inhibitor MCC950, or a vehicle control at one hour following the first mTBI and continuing thereafter.

Animals

Fifty-three male Sprague-Dawley rats were obtained from the Monash Animal Research Platform (Clayton, Victoria, Australia). Rats were housed in cages of three on a 12-hour light/dark cycle with food and water available ad libitum. All animal procedures were approved by the Alfred Medical Research and Educational Precinct Animal Ethics Committee (E/1953/2019/M). Animal experiments are reported in compliance with the ARRIVE guidelines and the Australian code of practice for the care and use of animals for scientific purposes by the Australian National Health and Medical Research Council.

Repeated mTBI Injury Model

The ACHI model, a clinically relevant anaesthetic- and craniotomy-free model of mTBI, was used to induce rmTBI, as previously described [34, 38]. To minimise any confounding effect of stress on the rat, there was a two-day habituation protocol performed prior to the first injury day. For the first habituation day the rat was placed into an open ended Decapicone bag (Braintree Scientific, MA, United States). Once stationary, the rat was restrained in the bag against a foam mattress for ten seconds. The second habituation day was performed similarly to the first, however once restrained in the bag, a tightly fitted steel helmet was placed on the head of the rat. The ACHI procedure was performed as per the second habituation day; however, once the rat was restrained and helmet fitted, injury was induced via the striking of a controlled cortical impactor device (Leica Biosystems, IL, United States) to an impact site centred over the left parietal bone (velocity: 6.5 m/s, depth: 4 mm, dwell time: 100 ms). Sham injuries were performed as per the ACHI; however, the impactor was not triggered. rmTBI was modelled by giving rats five ACHI procedures with each procedure separated by 24 hours. The sham group sustained five sham procedures in this same time period.

MCC950 Treatment

MCC950, a CNS-penetrating and specific NLRP3 inflammasome inhibitor [27, 39], was delivered via subcutaneous mini-osmotic pump (Model 2002, Alzet, CA, USA). To implant the pump, rats were lightly anesthetised with isoflurane and a small incision was made between the scapulae for the osmotic pump to be inserted subcutaneously [40]. The pump was filled following manufacturer’s instructions, and dispensed MCC950/saline at a rate of 0.5 µL/hour. The pump was implanted one hour following the first injury and delivered a continuous dose of MCC950 (or vehicle) until the pre-determined experimental endpoint at 72 hours post-final injury. A dose of 10 mg/kg/day was determined following previous investigations in moderate and severe TBI that reported improved CNS molecular, structural, and behavioural outcomes at a dose of 10 mg/kg, with no reported adverse effects [11, 13]. Vehicle treatment was performed as per MCC950 treatment; however, the osmotic pump was filled with saline.

Experimental Groups

To assess the effects of NRP3 inflammasome inhibition on behavioural and molecular outcomes following rmTBI, rats were randomly assigned to one of four groups: 1) Sham-injuries + saline-vehicle treatment (sham + vehicle; n = 11); 2) Sham-injuries + MCC950 treatment (sham + MCC; n = 14); 3) rmTBI + saline-vehicle treatment (rmTBI + vehicle; n = 14); 4) rmTBI + MCC950 treatment (rmTBI + MCC; n = 13*). Note that 14 rats were assigned to the rmTBI + MCC950 group; however, one rat died immediately after impact and hence was excluded from all analyses.

Behavioural Assessments

To assess the influence of inflammasome inhibition after rmTBI on behavioural outcomes, the beam task, Y-maze, and elevated plus maze (EPM) were utilised at 4, 24, and 48 hours following the final mTBI/sham.

Beam Task

The beam task was employed as a measure of sensorimotor function, with protocols followed as previously described [34, 38]. Training for this task occurred 3 days prior to the first injury. Rats were placed on a 4 cm wide beam, 25 cm away from a dark box and prompted to cross the beam. If the rat attempted to turn around, or remained stationary, the investigator corrected their position and prompted the rat in the correct direction. This was repeated at the same distance (25 cm), and then twice at 50 cm, and twice 1m from the home-cage. This training protocol was repeated on a 2 cm wide beam.

Testing for this task occurred one day prior to the initial injury (i.e., baseline), and at 4 hours following the final mTBI/sham. Briefly, the rat was placed on the 2 cm wide beam and required to cross the 1 m distance of the beam. The rat was then replaced at the starting point of the beam to perform a total of five trials. If the rat did not cross the beam in 30 seconds it was removed from the beam and the trial was excluded from all analyses. All trials were video recorded and the average time to cross the beam, and number of hind-limb slips across the five trials were quantified by an investigator blinded to the experimental conditions.

Y-Maze

The Y-maze was used as a measure of spatial memory with protocols followed as previously described [38, 41]. Briefly, the Y-maze consists of a Y-shaped apparatus with three 50 cm × 15 cm arms enclosed by 30 cm tall walls. Three visually distinct cues were placed at the distal end of each arm. The Y-maze was broken into two phases: acquisition and testing. For the acquisition phase, one arm was blocked off and the rat was placed in the ‘starting arm’ and allowed to freely explore two arms; the ‘starting arm’ and the unblocked arm (i.e., familiar arm). After ten minutes the rat was removed from the maze and returned to their home-cage. The testing phase of this task occurred 90 minutes after the acquisition phase. For the acquisition phase, the rat was placed in the same starting arm, and the arm previously blocked off (i.e., novel arm) was opened allowing the rat to explore all three arms for five minutes. A rat with intact spatial memory is hypothesised to spend more time exploring the novel arm than the familiar arm. All trials were recorded (TopScanLite version 2.0; Clever Sys Inc., Reston, VA, USA) and scored to determine the time spent in the novel and familiar arms. From these times, the discrimination index was calculated.

$$Y-maze discrimination index= \frac{Time in Novel-Time in Familiar}{Time in Novel+Time in Familar}$$

Due to technological issues, the trial from one rat (rmTBI + vehicle) was not recorded and hence not included in analyses for this task.

Elevated Plus Maze

The EPM was utilised as a measure of anxiety-like behaviour with protocols performed as previously described [38, 41]. The EPM is a 1 m × 1 m plus-shaped apparatus with two open arms and two arms that have 30 cm high walls (i.e., closed arms). For this task a rat was placed in the centre of the four arms and allowed to freely explore the maze for five minutes. A rat demonstrating anxiety-like behaviour is hypothesised to spend less time exploring the open arm than a rat without such behaviour. All trials were recorded (TopScanLite version 2.0; Clever Sys Inc., Reston, VA, USA) and time spent in the open arm was determined.

Tissue Collection

At 72 hours after the final mTBI/sham, rats were euthanised for blood and brain tissue collection. Fresh brain tissue was collected from 34 rats (n = 11–14 per group) for RNA analysis, and paraformaldehyde (PFA) fixed brains were collected from 18 rats (n = 4–5 per group) for microglia analyses. For both fresh and fixed tissue collection, rats were lightly anaesthetised via isoflurane inhalation and given a lethal intraperitoneal dose of pentobarbitone (180 mg/kg). For fresh tissue collection, cardiac blood was collected into BD SST™ Advance tubes from the right ventricle, and the ipsilateral hippocampus isolated, flash-frozen, and stored at -80°C for later analysis. For fixed tissue collection, cardiac blood was collected as above, however, immediately following blood collection an 18-gauge needle connected to a peristaltic pump was inserted into the left ventricle. A 4°C solution of phosphate buffered saline (PBS) was perfused through the rat via a pump, followed by a solution of 4% PFA to fix the tissue. The whole brain was then removed and placed in a solution of 4°C PFA. After 24 hours, the brains were removed from the PFA, washed, and stored in a solution of 4°C PBS. This wash was repeated twice daily for two days and then frozen and stored in Tissue-Tek® O.C.T. Compound (Sakura) at -20°C for subsequent cyro-sectioning.

Serum Isolation and NfL Quantification

Whole blood was collected and clotted at room temperature (RT) for 30 minutes. Following this, the tubes were spun at 1,500g for ten minutes, serum collected, flash frozen, and stored at -80°C for later analysis. Serum NfL levels were quantified with SIMOA® HD-X Analyzer™ (Quanterix, MA, USA) using commercially available NfL Advantage kits (Quanterix™). All protocols were performed as per manufacturer’s instructions and all samples were run in duplicate. All samples measured above the lower limit of detection (0.038 pg/ml) with an average coefficient of variation of (3.02%). Note that one blood sample was not able to be collected (sham + vehicle group). As such, 51 rats were included in the final analysis.

Quantitative Real-Time PCR (RT-qPCR)

To assess the effect of rmTBI and MCC950 treatment on mRNA levels of NLRP3, ASC, caspase-1, IL-1β, and IL-18, flash-frozen fresh tissue samples collected from the ipsilateral hippocampus of 34 rats (described above) were homogenised and total RNA extracted with the RNeasy Lipid Tissue Mini Kit (Qiagen©, Hilden, Germany). Subsequently, 500 ng of the collected total RNA was synthesised to create a 20 µL solution of cDNA using qScript XLT cDNA SuperMix (Quantabio©, MA, USA) following manufacturer’s instructions and stored at -20°C for PCR analysis. Two mRNA amplification methods were utilised: SYBR Green reagents/methods and Taqman reagents/methods. mRNA amplification/analysis was first performed with SYBR Green reagents on all mRNAs (i.e., NLRP3, ASC, caspase-1, IL-1β and IL-18); however only ASC and IL-18 demonstrated successful amplification and sufficient replication between duplicates. For this analysis the isolated cDNA was analysed with a master mix of SYBR Green FastMix and the forward and reverse probe for ASC (Forward: 5’–GCT CACAATGTCTGTGCTTASAG-3’); Reverse: 5’–GCAGTAGCCACAGCTCCAG-3’; Sigma) and IL-18 (Forward: 5’–CCTGATATCGACCGAACAGC-3’; Reverse: 5’–CCTTCCATCCTTCACAGATAGG-3’, Sigma). Due to poor amplification and high variation between duplicates for NLRP3, caspase-1, and IL-1β, these mRNAs were reanalysed using Taqman methods and reagents. For this, Taqman hydrolysis probes (Thermo Fisher Scientific: NLRP3 assay ID: Rn04244620_m1; caspase-1 assay ID: Rn00562724_m1; IL-1β assay ID: Rn00580432_m1) and the Taqman Gene Expression Master Mix (Thermo Fisher Scientific) were used following manufacturer’s instructions. The housekeeper gene beta-2-microglobulin was analysed with both SYBR Green (Forward: 5’–CTACAGCACACGCAGTCTGA-3’; Reverse: 5’ – GGGACTAAACCTCCAGCCAC, Sigma) and Taqman reagents and methods (Assay ID: Rn00560865_m1).

Amplification and quantification of mRNA levels were performed on a QUANTStudio 7 system (Thermofisher, MA, USA). All samples were run in duplicate. The cycle threshold (C_t) was determined for each primer/sample combination and relative levels quantified following the 2^−ΔΔCt method [42]. Briefly, the mean C_t value for each mRNA of interest was subtracted from the C_t values of the housekeeper gene (beta-2-microglobulin) and the mean expression of the sham-vehicle group to give a -ΔΔCt value. Values were then expressed as 2^−ΔΔCt and divided by the mean of the sham-vehicle group to give a relative expression. Note that insufficient RNA was extracted from one sample (rmTBI + vehicle). Additionally, there was not sufficient RNA for one further sample (sham + vehicle) to be re-analysed with Taqman reagents which was consequently not included in the analyses of NLRP3, caspase-1, or IL-1β only.

Immunohistochemistry Staining

Eighteen frozen whole brains were cryosectioned and three consecutive 20 µm sections were taken at 3.5 mm and 5.5 mm posterior to Bregma for the microglia cell count and morphology analysis respectively. Sections were slide mounted and stored at 80°C for subsequent staining for ionized calcium-binding adaptor molecule 1 (Iba-1).

To stain for Iba-1, frozen slides were thawed for 30-minutes at RT. Brains were post-fixed in 10% neutral buffered formalin at RT. Antigen retrieval was performed using a DAKO PT Link machine in a 1xDAKO Target Retrieval (Low pH) Solution (DAKO) at 98°C for 15 minutes. The slides were then washed in 1xDAKO EnVision Flex Wash Buffer (DAKO) twice for five minutes at RT. A peroxidase block (Real Peroxidase Blocking Solution, DAKO) was then applied for 15 minutes at RT and slides washed in 1xEnVision Flex Wash Buffer (DAKO) for five minutes. A protein block (Serum Free Protein Block, DAKO) was then applied for 30-minutes at RT, tipped off, and primary antibody applied to incubate overnight at 4°C (Rabbit-anti-Iba-1, 1:6000; FUJIFILM).

The next day, the slides were washed three times in DAKO wash buffer before the secondary antibody was applied to incubate for two-hours at RT (EnVision System-HRP Labelled Polymer Anti-Rabbit, DAKO). After this, the slides were again washed three times in DAKO wash buffer before DAB (Liquid DAB + Substrate Chromogen, DAKO) was applied for two minutes at RT. The slides were then rinsed in dH₂O. For the microglia cell count only an additional Haematoxylin (Automation Haematoxylin Staining Reagent, DAKO) nuclear counterstain was applied for 10 minutes at RT, and a second rinse in dH₂O. Finally, all slides were dehydrated in ethanol, cleared in xylene, and cover slipped with DPX mounting medium for scanning on an Aperio AT Turbo scanner (Leica Biosystems, Vista, CA, USA). Images were taken at 40X magnification.

Microglial Cell Count

To quantify the number of microglia, the annotation tool on ImageScope (v12.4.3.5008) was used to place 1 mm × 0.5 mm boxes on the region of interest: the motor cortex, sensorimotor cortex, entorhinal cortex, hippocampus, thalamus, the hypothalamus on the ipsilateral side of injury, and the central corpus callosum (Supplementary Fig. 1). The number of Iba-1 positive cell bodies within each box were manually labelled and counted by a researcher blinded to the experimental groups. An Iba-1 stained cell was only counted if its entire cell body was within the region of interest. Note that the microglia from four brain sections were not able to the be quantified due to poor section quality (one sham + vehicle, two rmTBI + vehicle, and one rmTBI + MCC950). As such final group numbers for this analysis were (sham + vehicle n = 3, sham + MCC950 n = 4, rmTBI + vehicle n = 3, rmTBI + MCC950 n = 4).

Microglial morphology analysis

Slide Scanner images were processed with Aperio ImageScope software. Three regions of interest (ROI; primary somatosensory barrel field (S1BF), CA1, and the perirhinal cortex from both the ipsilateral and contralateral hemispheres) from 2–3 tissue slices per mouse, were extracted as 1000 × 1000 pixel (248.3 × 248.3 µm) images (Fig. 1). All extracted images from each ROI were identical in area for comparability. Microglial morphology was analysed in ImageJ as previously published [18, 20, 43]. In brief, three randomly selected microglia were isolated from z-stacked images (total of 6–9 cells per ROI, per mouse, Fig. 1). Isolated microglia were converted to binary by using the ‘adjust threshold’ function, skeletonised, and analysed using the ‘analyse skeleton’ plugin. The number of branches, number of endpoints, and total branch length per cell were calculated.

Statistics

All analyses performed to investigate the relationship between rmTBI and MCC950 treatment (behavioural, molecular, and microglial) were assessed with a two-way ANOVA, with factors of rmTBI and treatment. The beam task was analysed with a two-way ANCOVA with a covariate of baseline beam performance. Tukey’s multiple comparisons test was used for post-hoc analyses where appropriate. Due to the distribution of serum NfL data, all NfL concentrations underwent a natural logarithmic transformation prior to statistical analyses. Additionally, Spearman’s and Pearson’s correlation analyses were performed where appropriate, to investigate the relationship between serum NfL levels, microglia cell count in each region, number of slips on the beam task, and ASC mRNA levels in rmTBI rats. All analyses were performed using GraphPad Prism version 8.4.2 for Windows (GraphPad Software, CA).

rmTBI resulted in acute deficits on the beam task, but not Y-maze or EPM.

To assess the relationship between rmTBI and MCC950 treatment on behavioural outcomes in the acute setting, a battery of tasks was performed in the first 48-hours following injury (beam task: 4 hours, Y-maze: 24 hours, EPM: 48 hours). With baseline beam performance included as a covariate, there was a significant effect of rmTBI (F(1,48) = 10.8, p = 0.002), but not treatment (F(1,48) = 0.014, p = 0.905) or rmTBI × treatment interaction (F(1,48) = 0.002, p = 0.966) for number of slips on the beam (Figure 2A). Additionally, for time to cross the beam (Figure 2B) there was a similar, albeit non-significant trend for an effect of rmTBI (F(1,48) = 3.63, p = 0.063), but not treatment (F(1,48) = 0.200, p = 0.659), or rmTBI × treatment interaction (F(1,48) = 1.29, p = 0.262). For the Y-maze (Figure 2C), no effect of rmTBI (F(1,47) = 1.14, p = 0.290), treatment (F(1,47) = 0.801, p = 0.375), or rmTBI × treatment effect (F(1,47) = 0.160, p = 0.691) was found for the discrimination index of time spent exploring the novel arm. Similarly, for the EPM (Figure 2D), no effect of rmTBI (F(1,48) = 0.001, p = 0.978), treatment (F(1,48) = 0.0030, p = 0.863) or rmTBI × treatment effect (F(1,48) = 0.018, p = 0.894) was found for time spent in the open arm.

At 72-hours, mRNA levels of ASC and protein levels of NfL were associated with rmTBI.

To assess the relationship between rmTBI and MCC950 treatment with levels of inflammasome-associated mRNAs (NLRP3; Figure 3A, ASC Figure 3B, caspase-1 Figure 3C, IL-1β Figure 3D, and IL-18 Figure 3E), PCR was performed on brain tissue collected from the ipsilateral hippocampus at 72 hours. A significant effect of rmTBI (F(1,29) = 7.82, p = 0.009) was found for ASC; however no significant effect of treatment (F(1,29) = 0.283, p = 0.947), or rmTBI × treatment interaction was found (F(1,29) = 0.002, p = 0.962). No significant effect of rmTBI, treatment, or rmTBI × treatment interaction was found for NLRP3, caspase-1, IL-1β, or IL-18. In addition, the relationship between rmTBI and MCC950 on protein levels of NfL was investigated at 72-hours (Figure 3F). An effect of rmTBI (F(1, 34) = 133.7, p < 0.0001) was found, however no effect of treatment (F(1,34) = 1.66, p = 0.206), or rmTBI × treatment effect (F(1,34) = 0.500, p = 0.485) was found. Full details of statistical results (F- and p-values) for molecular outcomes are provided in Table 1.

rmTBI increased microglia cell number compared to uninjured shams.

To investigate the relationship between rmTBI and MCC950 treatment on microglia number, a cell count was performed for the number of Iba-1 positive cell bodies in the corpus callosum, motor cortex, sensorimotor cortex, entorhinal cortex, hippocampus, thalamus, and hypothalamus (Figure 4). All regions were on the ipsilateral side of injury except for the corpus callosum which was analysed centrally. Significant effects of injury were found for increased microglia cell number in the corpus callosum (F(1,10) = 13.2, p = 0.005), motor cortex (F(1, 10) = 4.99, p = 0.0496), sensorimotor cortex (F(1,10) = 7.16, p = 0.023), and thalamus (F(1,10) = 13.2, p = 0.005). Only the hippocampus was found to have a significant rmTBI × treatment interaction (F(1,10) = 5.03, p = 0.049). Post-hoc analyses revealed that the rmTBI + MCC950 group had significantly greater number of microglial cells in the hippocampus compared to both the sham + vehicle group (95% CI (2.87 to 50.47), p = 0.028) and the sham + MCC950 group (95% CI (7.97 to 52.03), p = 0.009). No region was found to have a significant effect of treatment. Full details of the two-way ANOVA statistical results (F- and p-values) are provided in Table 2 and results from the Tukey’s multiple comparisons test for the hippocampus are provided in Supplementary Table 1.

Measures of reactive microglia morphology was increased after rmTBI compared to shams, regardless of MCC950 treatment.

To investigate the efficacy of the MCC950 treatment as a possible therapeutic treatment for TBI, we measured the number of branches, the number of branch endpoints, and the length of branches per microglial cell (Figure 5). Microglial cells were measured in the S1BF, hippocampus, and the perirhinal cortex. In the ipsilateral S1BF, rmTBI rats had a significantly fewer number of branches per microglia (F(1,10) = 10.57, p = 0.0087), fewer endpoints per microglia (F(1,10) = 19.33, p = 0.0013), and a shorter branch length per microglia (F(1,10) = 19.26, p = 0.0014). There were no differences in the number of branches (F(1,10) = 2.0, p = 0.1874), number of endpoints (F(1,10) = 2.389, p = 0.1533), or the length of microglial branches (F(1,10) = 1.498, p = 0.2491) between groups in the ipsilateral hippocampus. There were fewer microglial endpoints in the ipsilateral perirhinal cortex of rmTBI rats compared to shams (F(1,10) = 5.348, p = 0.0433), but there was no effect on the number of branches (F(1,10) = 4.241, p = 0.0665), or the branch length per microglial cell (F(1,10) = 4.585, p = 0.0579). See Supplementary Figure 2 for microglia morphology analyses in the contralateral hemisphere.

Serum NfL levels correlated with the number of slips on the beam task.

Additional analyses were performed to assess whether circulating levels of the axonal injury biomarker, NfL in rmTBI rats were associated with sensorimotor function at 4-hours, and the number of microglia in each of the seven brain regions at 72-hours (Figure 6). There was a significant correlation between serum NfL levels and number of slips on the beam task (Spearman’s r = 0.441, p = 0.021), as well as number of microglia in the corpus callosum (Spearman’s r = 0.821, p = 0.034). No correlations were found between serum NfL levels and number of microglia in the motor cortex (Spearman’s r = 0.607, p = 0.167), sensorimotor cortex (Spearman’s r = -0.179, p = 0.713), entorhinal cortex (Spearman’s r = 0.071, p = 0.906), hippocampus (Spearman’s r = -0.321, p = 0.498), thalamus (Spearman’s r = 0.393, p = 0.396), or hypothalamus (Spearman’s r = -0.214, p = 0.662). To further elucidate the relationship between NfL levels and neuroinflammation, a further correlation analysis was performed between serum NfL levels and ASC mRNA levels in the hippocampus; however no significant correlation was found (Pearson’s r = 0.109, p = 0.698, Supplementary Figure 3).

We hypothesised that the NLRP3 inflammasome, a key regulator of the innate immune response and emerging mediator of moderate- and severe-TBI, may be critical to the pathophysiology of rmTBI. Using a clinically relevant, anaesthetic and surgery-free rat model, we found that rmTBI was related to acute sensorimotor deficits and increased measures of microglial reactivity, and that serum levels of the axonal injury biomarker NfL positively correlated with both beam deficits and microglia cell number in the corpus callosum.

To investigate the involvement of the NLRP3 inflammasome in the acute pathophysiology of rmTBI we measured the expression of mRNAs related to the NLRP3 inflammasome (i.e., NLRP3, ASC, caspase-1, IL-1β, and IL-18). We also investigated whether inhibiting this inflammasome one hour after the first mTBI could reduce acute behavioural deficits, NLRP3 inflammasome-related gene expression, decrease microglia cell number and prevent a reactive microglia morphology; however, contrary to our hypothesis, we found limited evidence of increased NLRP3 inflammasome mRNA expression, with only mRNA levels of ASC increased at 72 hours, and no treatment effects with pharmacological inhibition of the NLRP3 inflammasome. While preliminary, this suggests that the NLRP3 inflammasome has a limited role in the acute pathophysiology of rmTBI. Increases in NLRP3, ASC, caspase-1, IL-1β, and IL-18 at the mRNA level have been consistently reported after moderate and severe TBI. One study in a weight drop model of TBI found increases in NLRP3, ASC, and caspase-1 at 4-, 24- (not NLRP3), 72-, and 168 hours [17]. Additionally, increased mRNA levels of NLRP3, ASC, and caspase-1 at 72-hours following lateral weight drop in mice has been reported [13]. Furthermore, mRNA levels of NLRP3 and IL-1β but not ASC, caspase-1 or IL-18 was found to be elevated at 24-hours following closed head moderate TBI in mice [14]. Notably, previous studies investigating the NLRP3 inflammasome in TBI have all been performed in moderate and severe-TBI and to date, no studies have investigated the NLRP3 inflammasome in a repeat TBI model. In the current study, we found that gene expression of ASC was increased after rmTBI. ASC is associated with the formation of the NLRP3 inflammasome, but ASC has also been shown to form pathways independent of NLRP3, such as the NLRP1, NLRC4 and AIM2 inflammasomes, and further can self-associate to form an ASC speck [44, 45]. ASC activation induces a form of programmed inflammatory cell death known as pyroptosis [45], a key feature of TBI pathophysiology [46]. After moderate fluid-percussion injury, inhibition of ASC with anti-ASC neutralizing antibodies reduced the activation of caspase-1 and IL-1β and decreased contusion volume at 24 hours post-injury [47].

Here, we found that the NLRP3 inflammasome had limited involvement in rmTBI compared to moderate and severe TBI literature, with the acute inhibition of the NLRP3 inflammasome with MCC950 demonstrating no effect on behavioural or molecular outcomes. MCC950 is a specific NRLP3 inflammasome inhibitor that prevents the formation of the NLRP3 inflammasome by binding reversibly to the NACT domain of the NLRP3 protein [26]. As such, treatment with MCC950 is unlikely to have direct effects on gene expression, although an indirect increase could be expected via the positive feedback loops of the NLRP3 inflammasome. Despite this, MCC950 treatment has been shown in moderate and severe TBI studies to alleviate acute behavioural outcomes, such as neurological severity score, motor and cognitive outcomes, and microglial reactivity [11, 12]. It is possible that the lack of therapeutic improvement from MCC950 following rmTBI is due to the timing of MCC950 inhibition (i.e., treatment commenced one hour following the initial mTBI and continued thereafter). This treatment regime was chosen with clinical translation in mind (i.e., treatment commenced after the first mTBI to prevent cumulative burden should future mTBIs occur). Notably, MCC950 intervention studies have found that pre-treatment with MCC950 (3 mg/kg IP dose) or genetic knockout of NLRP3, has detrimental effects in a closed head model of moderate TBI in mice; however post-injury inhibition (3 mg/kg IP dose one hour post-TBI) decreased blood brain barrier permeability and improved neurological severity score 24 hours after the injury [14]. A similar phenomenon has been reported in microglial depletion studies in which the timing of microglia depletion relative to injury has been shown to be critical [22, 48, 49]. Taken together, it is likely that neuroinflammation and NLRP3 inflammasome activation is required in the immediate response to an TBI, however chronic activation of inflammatory pathways may contribute to further damage. As such, by commencing MCC950 treatment after one, but before four mTBIs, it is possible that both the detrimental, and beneficial aspects of neuroinflammation were inhibited and hence overall effect of MCC950 treatment diminished. While the current study provides preliminary evidence that the NLRP3 inflammasome may have a limited role in the acute pathogenesis of rmTBI, future studies are required to investigate whether the NLRP3 inflammasome is involved in chronic setting of rmTBI, and hence whether delayed inhibition of this inflammasome may have utility to prevent chronic rmTBI-related deficits.

To assess microglial reactivity in response to rmTBI we performed manual cell counts and morphology analyses of microglia cells (i.e., Iba-1 positive cells). We found microglial cell number increased following rmTBI in the motor cortex, entorhinal cortex, hippocampus, corpus callosum and thalamus. We also found that rmTBI resulted in morphological changes associated with microglial reactivity. A prolonged reactive microglial phenotype is commonly (although variably) reported in pre-clinical rmTBI research with the variation likely due to differences between strains/species, age of injury, sex, injury severity, mTBI model, number of mTBIs and time-points assessed [50]. Furthermore, the type and duration of anaesthetic exposure likely contributes to these variations, as anaesthetic exposure at the time of TBI is known to affect behavioural and molecular outcomes post-injury [51]. While the exact consequences of anaesthetics on microglia reactivity is not known, both a detrimental and beneficial effect has been reported with one study in neonatal piglets finding 6 hour isoflurane exposure to cause a diffuse increase in microglial activation score [52], while another study of ischemic stroke in rats found microglia reactivity to be diminished with 30 minute isoflurane pre-treatment [53]. As the activation state of microglia (i.e., microglia priming) is known to influence subsequent microglia responses [54], it is likely that anaesthetic exposure at the time of mTBI is confounding conclusions of microglia reactivity. This is of particular relevance to rmTBI studies, in which priming of microglia by consecutive anaesthetic and mTBI exposures may greatly exaggerate the microglia response. While we cannot conclude whether increased microglial cell number and reactivity at 72 hours is beneficial or detrimental to recovery, the finding that microglial reactivity is increased for at least 72 hours following rmTBI, in the absence of anaesthetic at the time of injury, solidifies the mounting evidence supporting the role of microglia in the secondary cascade of rmTBI.

In line with previous work in the ACHI model, we saw a robust increase in serum NfL levels at 72 hours following rmTBI which were present in the absence of detectable behavioural deficits. Pre-clinical mTBI studies are routinely hampered by limitations in behavioural testing including variation in mTBI-related deficits between studies, likely due to the strain and age of the animals, as well as variation in experimental procedures between laboratories. Furthermore, mTBI deficits are by definition, subtle and transient and include affective deficits which are difficult to assess in the pre-clinical setting. The finding that serum NfL levels are sensitive to rmTBI where traditional behavioural tasks (i.e., Y-maze and EPM) were not, provide further evidence for the utility of NfL as an objective outcome in pre-clinical TBI studies.

To determine how later NfL measurements correlate with acute sensorimotor deficits, we tested the association between the beam walk task and serum NfL levels and found that the 72 hour serum NfL levels were significantly correlated to beam walk performance at 4 hours. This is in accordance with previous studies investigating NfL as a biomarker of pre-clinical mTBI that found 24 h NfL levels to be elevated in rats with substantial sensorimotor deficits (i.e., > 5 slips) at 4 hours following rmTBI (5 mTBIs separated by 24 hours) [34]. Similarly, a second study found that serum NfL levels at 7 days were correlated to immediate and 3 day sensorimotor function following rmTBI (4 mTBIs separated by 48 hours) [41]. The findings of the current study, and previous findings using the ACHI model support the utility of serum NfL as an objective outcome for pre-clinical mTBI. Together these results also suggest that NfL may provide an opportunity to monitor injury severity at later time-points and hence prolong the window in which the subtle, and transient deficits of mTBI can be detected.

While we did not see a treatment effect of MCC950 on serum NfL levels, we found that NfL levels were related to the number of microglia in the corpus callosum at 72 hours. The corpus callosum is commonly included in studies investigating axonal injury because the location and orientation of the white matter tracts in the corpus callosum make this region particularly susceptible to axonal injury [55, 56]. As such, it is possible that the finding that serum NfL levels correlated to the number of microglia in the corpus callosum, but no other region, is due to a high degree of axonal injury in this region. The relationship between axonal injury and neuroinflammation is well documented, with previous TBI investigations showing a correlation between axonal injury (as determined by amyloid precursor protein staining) and microglia number (as determined by Iba-1 staining) following rmTBI in mice [57]. Furthermore, the levels of circulating NfL have been shown to correlate to CSF NfL levels, as well as diffusion tract imaging estimates of axonal injury in the corpus callosum following TBI [58]. Despite this, the relationship between peripheral measures of axonal injury, such as serum NfL, with central measures of neuroinflammation has not previously been investigated and may provide a novel and accessible avenue to monitor ongoing pathology in the brain. Furthermore, while no correlation was found between serum NfL and ASC levels in the hippocampus, future studies should investigate ASC activity, specifically in the corpus callosum after rmTBI, to determine whether the relationship found between NfL levels and neuroinflammation in this region is ASC-dependent.

This study should be considered in the context of some limitations. Firstly, only male rats were included. Notably, all previous studies investigating the NLRP3 inflammasome in TBI have investigated male rodents. Given that there are known sex differences in outcomes following TBI, including microglial reactivity [59], future studies should investigate whether the findings of the current rmTBI study, and previous moderate and severe-TBI studies translates to females. Furthermore, while MCC950 has been shown to penetrate the CNS and have therapeutic utility in moderate and severe-TBI [11, 13, 39], in the current study it is not possible to determine how efficiently MCC950 entered the CNS, and consequently whether a potential decrease in MCC950 CNS concentration may have contributed to the lack of therapeutic improvement. In addition, this study only investigated mRNA levels of NLRP3 inflammasome associated molecules. To conclude with certainty that there is a reduced role of the inflammasome in the setting of mTBI, future studies are required to investigate measures downstream of mRNA expression, such as quantification of protein levels and NLRP3 inflammasome formation.

Despite increased awareness of the cumulative deficits related to rmTBI, the underlying pathophysiology is not well defined. With growing evidence implicating the NLRP3 inflammasome in the pathogenesis of moderate and severe TBI, we hypothesised the NLRP3 inflammasome would be activated following rmTBI and that its inhibition would have therapeutic utility to prevent acute behavioural, neuroinflammatory and axonal injury outcomes. Here, we found further evidence in a clinically relevant, anaesthetic free, model of rmTBI, that there is a widespread increase in microglial number and reactive phenotype after rmTBI. We also saw further evidence for the utility of serum NfL in the pre-clinical setting as a measure of injury severity and a pre-clinical outcome of mTBI, as well as preliminary evidence that circulating levels of this protein may be indicative of ongoing pathophysiology.

ACHI

Awake closed-head injury

ASC

Associated speck-like protein containing a caspase recruitment domain

C_t

Cycle threshold

EPM

Elevated plus maze

Iba

1-Ionized calcium binding adaptor molecule 1

mTBI

Mild traumatic brain injury

NfL

Neurofilament light

NLRP3

Nod-like receptor pyrin domain containing 3

PBS

Phosphate buffered saline

rmTBI

Repeated mild traumatic brain injury

Room temperature

Ethics approval: All animal procedures were approved by the Alfred Medical Research and Educational Precinct Animal Ethics Committee (E/1953/2019/M). Animal experiments are reported in compliance with the ARRIVE guidelines and the Australian code of practice for the care and use of animals for scientific purposes by the Australian National Health and Medical Research Council.

Consent for publication: Not applicable

Availability of data and materials: The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.

Competing interests: The authors declare that they have no competing interests.

Funding: This study was funded by Monash University and grants awarded to TJO (APP1176426), SRS (2018/GNT1159645) and SJM (2020/GNT2002689) by the Australian National Health and Medical Research Council.

Author’s contributions:

WTO contributed to the conception, design, acquisition and analysis, interpretation of data and drafted the manuscript. TRFG contributed to the design of the work, the analysis and interpretation of data, and drafted the manuscript. LP contributed to the acquisition and analysis of data and substantively revised the manuscript. JB contributed to the acquisition and analysis of data and substantively revised the manuscript. CGS contributed to the design of the work and substantively revised the manuscript. AABR contributed to the design of the work and substantively revised the manuscript. TJO contributed to the design of the work and substantively revised the manuscript. MM contributed to the conception and design of the work, the interpretation of data and substantively revised the manuscript. SRS contributed to the conception and design of the work, the interpretation of data and substantively revised the manuscript. RKR contributed to the conception and design of the work, the analysis and interpretation of data, and substantively revised the manuscript. SJM contributed to the conception and design of the work, the analysis and interpretation of data, drafting and substantively revising the manuscript.

All authors have approved the submitted version of this manuscript, and have agreed both to be personally accountable for the author's own contributions and to ensure that questions related to the accuracy or integrity of any part of the work, even ones in which the author was not personally involved, are appropriately investigated, resolved, and the resolution documented in the literature.

Acknowledgements: We thank the staff at the Monash Histology Platform for their assistance slicing, staining, and imaging the tissue for microglia cell count analysis.

Thomas E, Fitzgerald M, Cowen G: Post-concussion states: How do we improve our patients’ outcomes? An Australian perspective. Journal of Concussion 2020, 4:2059700220960313.
Dewan MC, Rattani A, Gupta S, Baticulon RE, Hung YC, Punchak M, Agrawal A, Adeleye AO, Shrime MG, Rubiano AM, et al: Estimating the global incidence of traumatic brain injury. J Neurosurg 2018:1–18.
Gardner RC, Yaffe K: Epidemiology of mild traumatic brain injury and neurodegenerative disease. Mol Cell Neurosci 2015, 66:75–80.
Guskiewicz KM, McCrea M, Marshall SW, Cantu RC, Randolph C, Barr W, Onate JA, Kelly JP: Cumulative effects associated with recurrent concussion in collegiate football players: the NCAA Concussion Study. JAMA 2003, 290:2549–2555.
McAllister T, McCrea M: Long-Term Cognitive and Neuropsychiatric Consequences of Repetitive Concussion and Head-Impact Exposure. J Athl Train 2017, 52:309–317.
Shultz SR, Bao F, Omana V, Chiu C, Brown A, Cain DP: Repeated mild lateral fluid percussion brain injury in the rat causes cumulative long-term behavioral impairments, neuroinflammation, and cortical loss in an animal model of repeated concussion. J Neurotrauma 2012, 29:281–294.
Guskiewicz KM, Marshall SW, Bailes J, McCrea M, Harding HP, Jr., Matthews A, Mihalik JR, Cantu RC: Recurrent concussion and risk of depression in retired professional football players. Med Sci Sports Exerc 2007, 39:903–909.
Menu P, Vince JE: The NLRP3 inflammasome in health and disease: the good, the bad and the ugly. Clin Exp Immunol 2011, 166:1–15.
Martinon F, Burns K, Tschopp J: The inflammasome: a molecular platform triggering activation of inflammatory caspases and processing of proIL-beta. Mol Cell 2002, 10:417–426.
Jha S, Srivastava SY, Brickey WJ, Iocca H, Toews A, Morrison JP, Chen VS, Gris D, Matsushima GK, Ting JP: The inflammasome sensor, NLRP3, regulates CNS inflammation and demyelination via caspase-1 and interleukin-18. J Neurosci 2010, 30:15811–15820.
Xu X, Yin D, Ren H, Gao W, Li F, Sun D, Wu Y, Zhou S, Lyu L, Yang M, et al: Selective NLRP3 inflammasome inhibitor reduces neuroinflammation and improves long-term neurological outcomes in a murine model of traumatic brain injury. Neurobiol Dis 2018, 117:15–27.
Ismael S, Nasoohi S, Ishrat T: MCC950, the Selective Inhibitor of Nucleotide Oligomerization Domain-Like Receptor Protein-3 Inflammasome, Protects Mice against Traumatic Brain Injury. J Neurotrauma 2018, 35:1294–1303.
Chen Y, Meng J, Xu Q, Long T, Bi F, Chang C, Liu W: Rapamycin improves the neuroprotection effect of inhibition of NLRP3 inflammasome activation after TBI. Brain Res 2019, 1710:163–172.
Lopez-Rodriguez AB, Decouty-Perez C, Farre-Alins V, Palomino-Antolin A, Narros-Fernandez P, Egea J: Activation of NLRP3 Is Required for a Functional and Beneficial Microglia Response after Brain Trauma. Pharmaceutics 2022, 14.
Liu X, Zhao Z, Ji R, Zhu J, Sui QQ, Knight GE, Burnstock G, He C, Yuan H, Xiang Z: Inhibition of P2X7 receptors improves outcomes after traumatic brain injury in rats. Purinergic Signal 2017, 13:529–544.
Xu KY, Wu CY, Tong S, Xiong P, Wang SH: The selective Nlrp3 inflammasome inhibitor Mcc950 attenuates lung ischemia-reperfusion injury. Biochem Biophys Res Commun 2018, 503:3031–3037.
Liu HD, Li W, Chen ZR, Hu YC, Zhang DD, Shen W, Zhou ML, Zhu L, Hang CH: Expression of the NLRP3 inflammasome in cerebral cortex after traumatic brain injury in a rat model. Neurochem Res 2013, 38:2072–2083.
Green TRF, Murphy SM, Rowe RK: Comparisons of quantitative approaches for assessing microglial morphology reveal inconsistencies, ecological fallacy, and a need for standardization. Sci Rep 2022, 12:18196.
Reddaway J, Richardson PE, Bevan RJ, Stoneman J, Palombo M: Microglial morphometric analysis: so many options, so little consistency. Front Neuroinform 2023, 17:1211188.
Green TRF, Murphy SM, Moreno-Montano MP, Audinat E, Rowe RK: Reactive morphology of dividing microglia following kainic acid administration. Front Neurosci 2022, 16:972138.
Roth TL, Nayak D, Atanasijevic T, Koretsky AP, Latour LL, McGavern DB: Transcranial amelioration of inflammation and cell death after brain injury. Nature 2014, 505:223–228.
Rice RA, Spangenberg EE, Yamate-Morgan H, Lee RJ, Arora RP, Hernandez MX, Tenner AJ, West BL, Green KN: Elimination of Microglia Improves Functional Outcomes Following Extensive Neuronal Loss in the Hippocampus. J Neurosci 2015, 35:9977–9989.
Cherry JD, Tripodis Y, Alvarez VE, Huber B, Kiernan PT, Daneshvar DH, Mez J, Montenigro PH, Solomon TM, Alosco ML, et al: Microglial neuroinflammation contributes to tau accumulation in chronic traumatic encephalopathy. Acta Neuropathol Commun 2016, 4:112.
Ferrari CC, Depino AM, Prada F, Muraro N, Campbell S, Podhajcer O, Perry VH, Anthony DC, Pitossi FJ: Reversible demyelination, blood-brain barrier breakdown, and pronounced neutrophil recruitment induced by chronic IL-1 expression in the brain. Am J Pathol 2004, 165:1827–1837.
Felderhoff-Mueser U, Schmidt OI, Oberholzer A, Buhrer C, Stahel PF: IL-18: a key player in neuroinflammation and neurodegeneration? Trends Neurosci 2005, 28:487–493.
Coll RC, Hill JR, Day CJ, Zamoshnikova A, Boucher D, Massey NL, Chitty JL, Fraser JA, Jennings MP, Robertson AAB, Schroder K: MCC950 directly targets the NLRP3 ATP-hydrolysis motif for inflammasome inhibition. Nat Chem Biol 2019, 15:556–559.
Coll RC, Robertson AA, Chae JJ, Higgins SC, Munoz-Planillo R, Inserra MC, Vetter I, Dungan LS, Monks BG, Stutz A, et al: A small-molecule inhibitor of the NLRP3 inflammasome for the treatment of inflammatory diseases. Nat Med 2015, 21:248–255.
McDonald SJ, O'Brien WT, Symons GF, Chen Z, Bain J, Major BP, Costello D, Yamakawa G, Sun M, Brady RD, et al: Prolonged elevation of serum neurofilament light after concussion in male Australian football players. Biomark Res 2021, 9:4.
Shahim P, Tegner Y, Marklund N, Blennow K, Zetterberg H: Neurofilament light and tau as blood biomarkers for sports-related concussion. Neurology 2018, 90:e1780-e1788.
Zetterberg H, Blennow K: Fluid biomarkers for mild traumatic brain injury and related conditions. Nat Rev Neurol 2016, 12:563–574.
Shahim P, Zetterberg H, Tegner Y, Blennow K: Serum neurofilament light as a biomarker for mild traumatic brain injury in contact sports. Neurology 2017, 88:1788–1794.
Clarke GJB, Skandsen T, Zetterberg H, Einarsen CE, Feyling C, Follestad T, Vik A, Blennow K, Haberg AK: One-Year Prospective Study of Plasma Biomarkers From CNS in Patients With Mild Traumatic Brain Injury. Front Neurol 2021, 12:643743.
McDonald SJ, Piantella S, O'Brien WT, Hale MW, O'Halloran P, Kinsella G, Horan B, O'Brien TJ, Maruff P, Shultz SR, Wright BJ: Clinical and blood biomarker trajectories after concussion: New insights from a longitudinal pilot study of professional flat-track jockeys. J Neurotrauma 2022.
O'Brien WT, Pham L, Brady RD, Bain J, Yamakawa GR, Sun M, Mychasiuk R, O'Brien TJ, Monif M, Shultz SR, McDonald SJ: Temporal profile and utility of serum neurofilament light in a rat model of mild traumatic brain injury. Exp Neurol 2021, 341:113698.
Karlsson M, Yang Z, Chawla S, Delso N, Pukenas B, Elmer E, Hugerth M, Margulies S, Ehinger JK, Hansson MJ, et al: Evaluation of Diffusion Tensor Imaging and Fluid Based Biomarkers in a Large Animal Trial of Cyclosporine in Focal Traumatic Brain Injury. J Neurotrauma 2020.
Loane DJ, Byrnes KR: Role of microglia in neurotrauma. Neurotherapeutics 2010, 7:366–377.
Huang X, You W, Zhu Y, Xu K, Yang X, Wen L: Microglia: A Potential Drug Target for Traumatic Axonal Injury. Neural Plast 2021, 2021:5554824.
Pham L, Shultz SR, Kim HA, Brady RD, Wortman RC, Genders SG, Hale MW, O'Shea RD, Djouma E, van den Buuse M, et al: Mild Closed-Head Injury in Conscious Rats Causes Transient Neurobehavioral and Glial Disturbances: A Novel Experimental Model of Concussion. J Neurotrauma 2019, 36:2260–2271.
Chen W, Foo SS, Zaid A, Teng TS, Herrero LJ, Wolf S, Tharmarajah K, Vu LD, van Vreden C, Taylor A, et al: Specific inhibition of NLRP3 in chikungunya disease reveals a role for inflammasomes in alphavirus-induced inflammation. Nat Microbiol 2017, 2:1435–1445.
Sun M, Baker TL, Wilson CT, Brady RD, Mychasiuk R, Yamakawa GR, Vo A, Wilson T, McDonald SJ, Shultz SR: Treatment with vascular endothelial growth factor-A worsens cognitive recovery in a rat model of mild traumatic brain injury. Front Mol Neurosci 2022, 15:937350.
Pham L, Wright DK, O'Brien WT, Bain J, Huang C, Sun M, Casillas-Espinosa PM, Shah AD, Schittenhelm RB, Sobey CG, et al: Behavioral, axonal, and proteomic alterations following repeated mild traumatic brain injury: Novel insights using a clinically relevant rat model. Neurobiol Dis 2020:105151.
Livak KJ, Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25:402–408.
Young K, Morrison H: Quantifying Microglia Morphology from Photomicrographs of Immunohistochemistry Prepared Tissue Using ImageJ. J Vis Exp 2018.
Fernandes-Alnemri T, Wu J, Yu JW, Datta P, Miller B, Jankowski W, Rosenberg S, Zhang J, Alnemri ES: The pyroptosome: a supramolecular assembly of ASC dimers mediating inflammatory cell death via caspase-1 activation. Cell Death Differ 2007, 14:1590–1604.
Schroder K, Tschopp J: The inflammasomes. Cell 2010, 140:821–832.
Hu X, Chen H, Xu H, Wu Y, Wu C, Jia C, Li Y, Sheng S, Xu C, Xu H, et al: Role of Pyroptosis in Traumatic Brain and Spinal Cord Injuries. Int J Biol Sci 2020, 16:2042–2050.
de Rivero Vaccari JP, Lotocki G, Alonso OF, Bramlett HM, Dietrich WD, Keane RW: Therapeutic neutralization of the NLRP1 inflammasome reduces the innate immune response and improves histopathology after traumatic brain injury. J Cereb Blood Flow Metab 2009, 29:1251–1261.
Bray CE, Witcher KG, Adekunle-Adegbite D, Ouvina M, Witzel M, Hans E, Tapp ZM, Packer J, Goodman E, Zhao F, et al: Chronic Cortical Inflammation, Cognitive Impairment, and Immune Reactivity Associated with Diffuse Brain Injury Are Ameliorated by Forced Turnover of Microglia. J Neurosci 2022, 42:4215–4228.
Henry RJ, Ritzel RM, Barrett JP, Doran SJ, Jiao Y, Leach JB, Szeto GL, Wu J, Stoica BA, Faden AI, Loane DJ: Microglial Depletion with CSF1R Inhibitor During Chronic Phase of Experimental Traumatic Brain Injury Reduces Neurodegeneration and Neurological Deficits. J Neurosci 2020, 40:2960–2974.
Eyolfson E, Khan A, Mychasiuk R, Lohman AW: Microglia dynamics in adolescent traumatic brain injury. J Neuroinflammation 2020, 17:326.
Rowe RK, Harrison JL, Thomas TC, Pauly JR, Adelson PD, Lifshitz J: Using anesthetics and analgesics in experimental traumatic brain injury. Lab Anim (NY) 2013, 42:286–291.
Broad KD, Hassell J, Fleiss B, Kawano G, Ezzati M, Rocha-Ferreira E, Hristova M, Bennett K, Fierens I, Burnett R, et al: Isoflurane Exposure Induces Cell Death, Microglial Activation and Modifies the Expression of Genes Supporting Neurodevelopment and Cognitive Function in the Male Newborn Piglet Brain. PLoS One 2016, 11:e0166784.
Sun M, Deng B, Zhao X, Gao C, Yang L, Zhao H, Yu D, Zhang F, Xu L, Chen L, Sun X: Isoflurane preconditioning provides neuroprotection against stroke by regulating the expression of the TLR4 signalling pathway to alleviate microglial activation. Sci Rep 2015, 5:11445.
Perry VH, Holmes C: Microglial priming in neurodegenerative disease. Nature Reviews Neurology 2014, 10:217–224.
Cloots RJ, van Dommelen JA, Kleiven S, Geers MG: Multi-scale mechanics of traumatic brain injury: predicting axonal strains from head loads. Biomech Model Mechanobiol 2013, 12:137–150.
Hill CS, Coleman MP, Menon DK: Traumatic Axonal Injury: Mechanisms and Translational Opportunities. Trends Neurosci 2016, 39:311–324.
Mouzon BC, Bachmeier C, Ferro A, Ojo JO, Crynen G, Acker CM, Davies P, Mullan M, Stewart W, Crawford F: Chronic neuropathological and neurobehavioral changes in a repetitive mild traumatic brain injury model. Ann Neurol 2014, 75:241–254.
Shahim P, Politis A, van der Merwe A, Moore B, Chou YY, Pham DL, Butman JA, Diaz-Arrastia R, Gill JM, Brody DL, et al: Neurofilament light as a biomarker in traumatic brain injury. Neurology 2020, 95:e610-e622.
Villapol S, Loane DJ, Burns MP: Sexual dimorphism in the inflammatory response to traumatic brain injury. Glia 2017, 65:1423–1438.

Table 1: Statistical results for analyses of 72 hour molecular outcome. Results from a two-way ANOVA for analyses of mRNA levels of NLRP3, ASC, caspase-1, IL-1β, IL-18, and serum NfL at 72 hours. F- and p-values are provided for the effect of rmTBI, treatment, and rmTBI × treatment interaction. Significant effects are in bold text.

Molecule

rmTBI X treatment

(F-statistic, p-value)

rmTBI

(F-value, p-value)

Treatment

(F-statistic, p-value)

NLRP3

F(1,28) = 2.26,

p = 0.144

F(1,28) = 0.112,

p = 0.740

F(1,28) = 0.554,

p = 0.463

ASC

F(1,29) = 1.44,

p = 0.240

F(1,29) = 7.82,

p = 0.009

F(1,29) = 0.283,

p = 0.745

Caspase-1

F(1,28) = 0.283,

p = 0.600

F(1,28) = 3.00,

p = 0.094

F(1,28) = 0.989,

p = 0.329

IL-1β

F(1,28) = 2.683,

p = 0.113

F(1,28) = 0.271,

p = 0.607

F(1,28) = 1.58,

p = 0.220

IL-18

F(1,29) = 0.002,

p = 0.962

F(1,29) = 2.22,

p = 0.147

F(1,29) = 0.004,

p = 0.947

Serum NfL

F(1,47) = 0.372,

p = 0.545

F(1,47) = 217.4,

p < 0.0001

F(1,47) =2.28,

p = 0.138

Table 2: Statistical results for analyses of 72 hour microglia cell number. Results from a two-way ANOVA for analyses of microglia cell number in the motor cortex, sensorimotor cortex, entorhinal cortex, hippocampus, corpus callosum, thalamus, and hypothalamus. F- and p-values are provided for the effect of rmTBI, treatment, and rmTBI × treatment interaction. Significant effects are in bold text.

Brain region

rmTBI X treatment

(F-statistic, p-value)

rmTBI

(F-value, p-value)

Treatment

(F-statistic, p-value)

Corpus Callosum

F(1,10) = 5.34x10^-5,

p = 0.994

F(1,10) = 13.2,

p = 0.005

F(1,10) = 0.0361,

Pp 0.853

Motor cortex

F(1,10) = 0.0229,

p = 0.883

F(1,10) = 4.99,

p = 0.0496

F(1,10) = 0.481,

p = 0.504

Sensorimotor cortex

F(1,10) = 0.255,

p = 0.625

F(1,10) =7.16,

p = 0.023

F(1,10) = 0.0843,

p = 0.778

Entorhinal cortex

F(1,10) = 2.07,

p = 0.181

F(1,10) = 4.88,

p = 0.052

F(1,10) =1.90,

p = 0.198

Hippocampus

F(1,10) =5.03,

p = 0.049

Thalamus

F(1,10) = 1.13,

p = 0.313

F(1,10) = 13.2,

p = 0.005

F(1,10) =1.09,

p = 0.320

Hypothalamus

F(1,10) = 0.0671,

p = 0.800

F(1,10) =4.49,

p = 0.060

F(1,10) =0.410,

p = 0.537

No competing interests reported.

OBRIENGREENSupplementaryFiles.docx

Download PDF

Version 1

posted

You are reading this latest preprint version

Repetitive mild traumatic brain injury elicits a reactive microglial morphology and elevates serum neurofilament light levels, independent of NLRP3 inflammasome inhibition

Status:

Version 1

Abstract

Figures

INTRODUCTION

MATERIALS AND METHODS

Animals

Repeated mTBI Injury Model

MCC950 Treatment

Experimental Groups

Behavioural Assessments

Beam Task

Y-Maze

Elevated Plus Maze

Tissue Collection

Serum Isolation and NfL Quantification

Quantitative Real-Time PCR (RT-qPCR)

Immunohistochemistry Staining

Microglial Cell Count

Microglial morphology analysis

Statistics

RESULTS

DISCUSSION

CONCLUSIONS

Abbreviations

Declarations

References

Tables

Additional Declarations

Supplementary Files

Status:

Version 1