Molecular marker-based evaluation of wheat advance lines for leaf rust and strip rust

doi:10.21203/rs.3.rs-3572470/v1

Download PDF

Research Article

Molecular marker-based evaluation of wheat advance lines for leaf rust and strip rust

https://doi.org/10.21203/rs.3.rs-3572470/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background: Leaf and brown rust are two common fungal diseases that affect wheat crops in Pakistan, as they do in many wheat-producing regions around the world.

Objective: The present study was conducted to explore rust resistance potential of 50 advance lines of spring wheat.

Material and methods: DNA markers linked with different genes conferring resistance to leaf rusts and Yellow rust were employed in this study. A total of 10 genes, consisting of seven Lr (Lr10, Lr19, Lr28, Lr29, Lr34, Lr46, Lr67) and three Yr (Yr5, Yr10, Yr15) were studied through linked DNA markers.

Result: Marker Lr10 and SCS265 identified the presence of the Lr10 and Lr 19 gene in 30 and one advance lines out of the 50 advances lines correspondingly, indicating their resistance to leaf rust. Marker SCS421 for Lr 28 and Lr 29 for Lr 29 amplified in 34 and 50 wheat advance lines. Marker csLV34 and XMC44 detected the presence of the Lr34/YR18/Pm38 and Lr46/YR29/Pm39 gene in 5 and 13 lines respectively. Marker CFD 23 for Lr67/Yr46/Sr55/ and Xgwm413 for Yr 15 was not amplified in any wheat line. Wms501 and Xpsp3000 confirmed the presence of the Yr-5/Yr43 and Yr 10 gene in 9 and 31 wheat lines, indicating their potential rust resistance.

Novelty Statement: This particular subset of wheat lines, including AKHBAR-19, 10141, V-20330, PGMB-20-48, V-19080, INDUS-21, NR-564, and WVH-1214, attributed to selective breeding practices or spontaneous allelic accumulation.

Wheat

Leaf or brown rust

Strip or yellow rust

SSR markers

Rust percentage

Wheat (Triticum aestivum L.) is the most important staple food in over 40 countries that constitute about 27% of the world's population [1]. It is known as king of cereal due to the high economic value and more adaptation in different ecological zone [2]. Wheat was grown on 9.043 million hectares (mha) in 2022-23, a 0.7% increase from the previous year's area of 8.977mha. Wheat add 1.9% of the GDP and 8.2% of the total value added in agriculture. Wheat yield production increased by 5.4% to 27.634 million tonnes, from 26.208 million tonnes in 2021-22 to 27.634 million tonnes 2022-23 [3].

Different types of pathogens are the sources of commercially significant diseases in wheat. The most prevalent of these diseases include three different types of rusts: wheat stem rust, also referred to as black rust; wheat leaf rust, often referred to as brown rust; and wheat stripe rust, frequently referred to as yellow rust. The causing agents behind these diseases are Puccinia graminis, P. triticina, and P. striiformis, respectively. Wheat leaf rust is comparatively more widely distributed than stem rust and yellow rust [4, 5]. In the scenario of a serious outbreak, major wheat producing Asian countries such as Pakistan, might suffer production losses of up to 70% in severe condition and a yield loss of up to 10% has been estimated to be worth over 80 million dollars. The disease still poses a major danger to Pakistan's wheat crop in areas like Central and Northern Punjab, where generally warm environmental conditions provide ideal condition for the spread of disease. With widespread deployment of resistant cultivars, effective disease control might guarantee limited losses over upcoming years [5].

Rust disease is easily controllable for a period by using resistance breeding. However, due to the rust population's constant changes, this is a never-ending battle. According to the previous reports, Pakistan, India, France, and Mexico have been facing variation in the pathogenicity and evolving pathogens that can infect previously known resistant varieties. Breeding for long-term resistance is challenging due to continuous variations in pathogens, since rust infections can produce distinct races with related virulence. As a result, the efficiency may last only a few years for varieties that are based on broadly used resistance genes until the disease acquires the equivalent pathogenicity [4, 6].

Researchers are paying close attention to marker assisted selection (MAS) since it allows for precise transfer of genes of interest and improves the parent plant genome [7]. In addition to resistance derived from genes expressing at seedling stage, adult plant resistance genes such as Lr34, Lr46, and Lr67 have also been used. Lr68, Lr74, Lr75, Lr77, and Lr78 are some more well-studied leaf rust resistance genes at adult stage. In certain situations, these genes collaborate with seedling resistance genes such as Lr10, Lr13, Lr16, and Lr18, which give resistance when combined with other genes, notably Lr34 [8]. DNA SSR markers for various yellow rust resistance genes, including Yr5, Yr9, Yr15, Yr17, Yr26, Yr33, and YrH52, have been reported as being accessible on MAS wheat, along with its whole marker assisted breeding procedure. Because of their highly polymorphic and co-dominant character, SSR markers are commonly utilized for yellow rust resistance gene pyramiding [9]. The present study was conducted to explore rust resistance potential of 50 advance lines of spring wheat.

Wheat leaves were collected from the field of Agricultural Biotechnology Research Institute, Faisalabad (Table 1.1). For DNA isolation from leaves, CTAB method with ISO-17025 protocol based modifications was used. A total of 10 genes, consisting of seven Lr (Lr10, Lr19, Lr28, Lr29, Lr34, Lr46, Lr67) and three Yr (Yr5, Yr10, Yr15) were studied through linked DNA markers as shown in table 1.2.

PCR Reaction and gel electrophoresis

2.0μl of 10X PCR buffer, 1.5μl of 25mM MgCl₂, 1.5μl of 2.0mM dNTPs, 1.0μl of each of the forward and reverse primers at 1.0μM, 0.2μl of 5U/μl Taq DNA polymerase, 2.0μl of 30ng/μl of isolated DNA, and 10.8μl of d₃H₂O were the components of the master mix for the PCR analysis with the final volume of 20μl. The thermal cycler PCR profile was as follows: initial denaturation at 94^oC for 5 minutes, (final denaturation at 94^oC for 1 minute, annealing temperature was according to the primer as stated in table 1.1, initial extension at 72^oC for 1 minute) with 35 cycles, and final extension at 72℃ for 7 minutes. 2% agarose gel was used to separate the PCR products.

Among the markers used, Lrh-10 revealed the presence of Lr-10 gene in 30 out of the 50 wheat lines as shown in Table 1.3 and Fig. 1. This indicated that these specific lines possess resistance against leaf rust, a valuable trait in wheat breeding programs. Similarly, marker SCS265 confirmed the presence of the Lr19 gene, responsible for leaf rust resistance, in only one of the 50 tested lines, showing an amplified fragment of 512 bp. Marker SCS421 was employed to identify the Lr28 gene in 34 of the wheat lines under consideration (Table 1.3 and Fig. 1). The presence of this gene suggested resistance to leaf rust in these lines, with an amplified fragment of the expected 570 bp length. Additionally, marker Lr29 indicated that all 50 lines possess the Lr-29 gene, signifying resistance against leaf rust, as demonstrated by the presence of a 150 bp amplified fragment.

The results from marker csLV34 revealed the presence of Lr34/YR18/Pm38 genes in five of the 50 lines shown in Fig. 2. However, these lines remain susceptible to rust, as agarose gel electrophoresis analysis indicated the co-dominant nature of the Lr34/YR18/Pm38 gene, resulting in two bands, one of the desired 150 bp length and the other of 229 bp, causing susceptibility under field conditions. Marker XMC44 was utilized to identify the Lr46/YR29/Pm39 gene in 13 lines. Similar to csLV34, agarose gel electrophoresis analysis showed two fragments, with one at the expected 242 bp length shown resistance and the other at 240 bp indicating susceptibility due to the co-dominant nature of Lr46/YR29/Pm39. Notably, genes such as Lr67/Yr46/Sr55/Pm46/ Ltn3 were absent in all wheat lines, as the related marker CFD23 did not amplify in any of the advance lines (Table 1.3).

Marker Wms501 provided crucial insights into the genetic composition of the 50 advanced wheat lines, confirming the presence of genes associated with rust resistance. Specifically, it identified the presence of Yr-5/Yr43 gene in nine of these lines as shown in Table 1.4 and Fig. 1. This information highlights the potential rust resistance of these lines, which is a valuable trait in wheat breeding programs. Another marker, Xpsp3000, yielded insightful results by amplifying in 31 of the wheat lines, confirming the presence of the Yr10 gene as shown in Fig. 3. This gene is associated with rust resistance and significant interest to wheat breeders. Agarose gel electrophoresis of Xpsp3000 revealed four fragments, underscoring the co-dominant nature of the Yr-15 gene. Three of these fragments measured 220 bp, 260 bp, and 286 bp, which are indicative of resistance, while one fragment was 240 bp, signifying susceptibility to rust. Conversely, marker Xgwm413 did not amplify in any of the tested lines, providing evidence for the absence of the related Yr15 gene in these advanced wheat lines (Table 1.4). This absence of the gene underscores the importance of genetic diversity and the potential need for further breeding efforts to introduce rust resistance into these lines. These findings provided critical information about the rust resistance profiles of the advanced wheat lines, offering valuable insights for future breeding efforts aimed at developing rust-resistant wheat varieties.

In a comprehensive assessment of 50 advanced wheat lines, a noteworthy observation emerged as only 8 of these lines displayed a markedly elevated allelic frequency of lr (leaf rust) and yr (yellow rust) resistance genes. This particular subset of wheat lines, including AKHBAR-19, 10141, V-20330, PGMB-20-48, V-19080, INDUS-21, NR-564, and WVH-1214, exhibited a distinctive genetic profile in terms of rust resistance, as visually depicted in Fig. 4. This observation carries significant scientific implications, reflecting the complex genetic landscape of wheat. It is suggestive of a genetic enrichment that may be attributed to selective breeding practices or spontaneous allelic accumulation. Furthermore, these results underscore the intricate multigenic nature of rust resistance in wheat, where combinations of resistance alleles in these lines may confer robust immunity to both leaf rust and yellow rust.

In this study, a comprehensive screening of 50 advanced wheat lines was conducted for evaluating the presence of genes associated with resistance against leaf rust and yellow rust by utilizing 10 disease linked SSR markers. Our results shed light on the genetic composition of these wheat lines and their potential for rust resistance, which is of great significance in wheat breeding programs.

Among the SSR markers used, Lrh-10 was instrumental in identifying the presence of the Lr-10 gene in 30 out of the 50 wheat lines. The presence of Lr-10 in these specific lines is a promising indication of their resistance against leaf rust, a highly desirable trait in wheat breeding [7]. Similarly, screening with marker SCS265 confirmed the presence of the Lr19 gene, known for its role in conferring leaf rust resistance. The observed amplified fragment of 512 bp in only one line is consistent with the expected length reported in the literature, provides further validation of this finding [10]. Marker SCS265 with gene Lr19 amplified 130 bp fragment which is contrary to the finding of this study [7].

Marker SCS421 was employed to identify the Lr28 gene in 34 out of the 50 wheat lines which is a substantial number. The presence of Lr28 in these lines strongly suggests resistance to leaf rust, supported by the detection of an amplified fragment of the anticipated 570 bp length in agarose gel electrophoresis analysis [11]. Additionally, screening using marker Lr29 revealed that all 50 lines having the Lr29 gene with 150bp fragment size, indicative of their resistance against leaf rust. But it was differently demonstrated by the presence of a 900 bp amplified fragment for Lr29 [12].

The results obtained from marker csLV34 were intriguing, as they unveiled the presence of the Lr34/YR18/Pm38 gene in five of the 50 lines. However, it is noteworthy that these lines remain susceptible to rust, as agarose gel electrophoresis analysis revealed the co-dominant nature of the Lr34/YR18/Pm38 gene, resulting in two distinct bands one at the desired 150 bp length and the other at 229 bp, which is associated with susceptibility [13].

Marker XMC44 played a pivotal role in the identification of the Lr46/YR29/Pm39 gene in 13 lines. Similar to csLV34, our gel electrophoresis analysis displayed two fragments, one at the expected 242 bp length, indicating resistance, and the other at 240 bp, signifying susceptibility due to the co-dominant nature of Lr46/YR29/Pm39 [14].

Notably, genes such as Lr67/Yr46/Sr55/Pm46/Ltn3 were conspicuously absent in all lines, as indicated by the failure of the related marker CFD23 to amplify in any of the advanced lines.

In our investigation, the utilization of Marker Wms501 proved to be invaluable in unraveling the genetic underpinnings of rust resistance in the 50 advanced wheat lines. This marker confirmed the presence of the Yr-5/Yr43 gene in nine of these lines. This finding serves as a significant indicator of the potential rust resistance harbored by these lines, which holds great promise for their incorporation into wheat breeding programs [15].

Equally compelling were the results obtained through Marker Xpsp3000, which was successfully amplified in 31 of the wheat lines, demonstrating to the presence of the Yr10 gene. The Yr10 gene is a well-known player in rust resistance and is of significant interest to wheat breeders. Notably, the agarose gel electrophoresis analysis of Xpsp3000 yielded four distinct fragments, a clear reflection of the co-dominant nature of the Yr-15 gene. Three of these fragments, measuring 220 bp, 260 bp, and 286 bp, stand as strong indicators of resistance, while the presence of one fragment at 240 bp suggests susceptibility to rust. This intriguing result highlights the complexity of rust resistance mechanisms within these lines [16].

Conversely, the outcomes of Marker Xgwm413 were distinctive, as it failed to amplify in any of the tested lines. This lack of amplification provides compelling evidence for the absence of the related Yr-15 gene in these advanced wheat lines. The absence of this gene underscores the importance of genetic diversity and signals a potential avenue for further breeding efforts to introduce rust resistance attribute into these lines ((Kokhmetova et al., 2021).

The subset of wheat lines, which includes AKHBAR-19, 10141, V-20330, PGMB-20-48, V-19080, INDUS-21, NR-564, and WVH-1214, stands out with a unique genetic profile regarding rust resistance as similar discussed [17]. This finding holds profound scientific significance, shedding light on the intricate genetic intricacies within the realm of wheat. It implies the existence of a genetic enrichment phenomenon that could be ascribed to either deliberate selective breeding efforts or spontaneous accumulation of allelic variants.

This particular subset of wheat lines, including AKHBAR-19, 10141, V-20330, PGMB-20-48, V-19080, INDUS-21, NR-564, and WVH-1214, exhibited a distinctive genetic profile in terms of rust resistance. This observation carries significant scientific implications, reflecting the complex genetic landscape of wheat. It is suggestive of a genetic enrichment that may be attributed to selective breeding practices or spontaneous allelic accumulation.

Ethical Approval

The research conducted in this study adhered to ethical principles governing the use of plant materials in scientific investigation.

Authors' contributions

All authors contributed equally to this work. Junaid Iqbal, and Shahid Nazir were involved in the conceptualization, methodology, and formal analysis. Jazakat Ahmad, Sajid ur Rahman, and Muhammad Waqas Jamil contributed equally to the investigation, data curation, and validation of results. Junaid Iqbal, Jazakat Ahmad and Imran Habib equally participated in the writing, reviewing, and editing of the manuscript. The authors collectively agreed on the final version for submission.

Funding

This research received no specific funding from any public, private, or commercial sources.

Availability of data and materials

Data in the form of present and absent gene is presented in the table in this manuscript.

Conflict of interest:

No potential conﬂict of interest was reported by the author(s).

Sharma V, Dubey RB, Khan R. 2019. Genotype-environment interaction on stability of grain yield and physio-biochemical traits in bread wheat (Triticum aestivum L.). Bangladesh J of Botany, 48(4):1143–1151. doi: 10.3329/bjb.v48i4.49070
Sunil Kumar VP, Krishna H, Devate,NB, Manjunath KK, Chauhan D, Singh S, Singh PK 2022. Marker assisted improvement for leaf rust and moisture deficit stress tolerance in wheat variety HD3086. Frontiers in Plant Sci.13:1035016.
Pakistan Agriculture Survey 2022. Economic survey of Pakistan 2021-2022. Economics Wing Division, Government of Pakistan.
Khan MR, Imtiaz M, Munir I, Hussain I, Ali S 2021. Differential distribution of leaf rust across major wheat growing regions of Pakistan revealed through a three years’ surveillance effort. Pak J of Botany 21:261-266.
Ismail M, Khan MR, Iqbal A, Facho ZH 2021. Molecular markers and field-based screening of wheat germplasm for leaf rust resistance. Pak J of Botany 53(5):1909-1920.
Ali S, Rodriguez AJ, Thach T, Sørensen CK, Hansen JG, Lassen P 2017. Yellow rust epidemics worldwide were caused by pathogen races from divergent genetic lineages. Frontiers in Plant Sci, 8:1057.
Parveen Z, Iqbal N, Rahman SU, Younis M, Nawaz M, Raza SH, Iqbal MZ 2014. Rust resistance evaluation of advanced wheat (Triticum aestivum L.) genotypes using PCR-based DNA markers. Pak J of Botany 46(1):251-257.
Bokore FE, Knox RE, Cuthbert RD, Pozniak CJ, McCallum BD, N’Diaye A, Meyer B 2020. Mapping quantitative trait loci associated with leaf rust resistance in five spring wheat populations using single nucleotide polymorphism markers. PLoS One 15(4):0230855.
Jamil S, Shahzad R, Ahmad S, Fatima R, Zahid R, Anwar M, Iqbal MZ, Wang X 2020. Role of genetics, genomics, and breeding approaches to combat stripe rust of wheat. Frontiers in Nutrition 7:580715.
Gupta SK, Charpe A, Prabhu KV, Haque QMR 2006. Identification and validation of molecular markers linked to the leaf rust resistance gene Lr19 in wheat. Theor and App Genetics 113:1027-1036.
Revathi P, Tomar SMS, Singh NK 2010. Marker assisted gene pyramiding of leaf rust resistance genes Lr24, Lr28 along with stripe rust resistance gene Yr15 in wheat (Triticum aestivum L.). Indian J of Genetics and Plant Breeding 70(4):349-354.
Błaszczyk L, Kramer I, Ordon F, Chełkowski J, Tyrka M, Vida G, Karsai I 2008. Validity of selected DNA markers for breeding leaf rust resistant wheat. Cereal Res. Commun 36(2):201-213.
Tomkowiak A, Skowrońska R, Kwiatek M, Spychała J, Weigt D, Kurasiak-Popowska D, Khan K 2021. Identification of leaf rust resistance genes Lr34 and Lr46 in common wheat (Triticum aestivum L. ssp. aestivum) lines of different origin using multiplex PCR. Open Life Sci 16(1):172-183.
Chemayek B, Bansal UK, Miah H, Wagoire WW. Bariana HS 2020. Assessment of Genetic Diversity for Stem Rust and Stripe Rust Resistance in an International Wheat Nursery Using Phenotypic and Molecular Technologies. Uganda J of Agri Sci 20(1):1-27.
Skowrońska R, Tomkowiak A, Nawracała J, Kwiatek MT 2020. Molecular identification of slow rusting resistance Lr46/Yr29 gene locus in selected triticale (Triticale) cultivars. J of Applied Genetics 61(3):359-366.
Kokhmetova A, Rsaliyev A, Malysheva A, Atishova M, Kumarbayeva M, Keishilov Z 2021. Identification of stripe rust resistance genes in common wheat cultivars and breeding lines from Kazakhstan. Plants 10(11):2303.
Akhtar N, Kiran A, Kausar M, Khan M, Saleem U, Mahmood T 2021. Microsatellite markers based assessment of rust resistance genes in Pakistani bread wheat genotypes. JAPS: J. Animal & Plant Sci 31(3):877-887.

Table 1.1 Advance lines used for rust resistant

Sr. No.	Entries	Sr. No.	Entries	Sr. No.	Entries	Sr. No.	Entries	Sr. No.	Entries
1	V-20337	11	V-19590	21	V-20352	31	EV-19103	41	NR-564
2	V-19532	12	20C207	22	10HP-428	32	19BT022	42	WV-1196
3	AKBAR-19	13	PGMB-20-43	23	V-20330	33	BF-7799	43	NR-560
4	V-19559	14	TWS-1902	24	PGMB20-48	34	INDUS-21	44	19C160
5	V-20395	15	IS-18565	25	RUSTAM-21	35	PAKISTAN-13	45	WVH-1214
6	V-20355	16	10141	26	NW-74	36	IS-18363	46	191297
7	HYT-10-95	17	180007	27	V-19080	37	V-20241	47	JM-1683
8	V-20418	18	NR-559	28	AZP-21	38	AZRI-8	48	JM-1215
9	BF-20105	19	BF-7792	29	19C166	39	B-19261	49	18FJ-01
10	TWS-1907	20	TWS-1926	30	NW-103	40	NR-561	50	GOLDEN-100

Table 1.2. Primers sequences of 20 linked SSR markers to screen against rust disease

Markers	Gene	Forward (F:) and Reverse (R:) SSR Primer	T_n(^oC)
Lrh10	Lr10	F: GAAGCCCTTCGTCTCATCTG R: TTGATTCATTGCAGATGAGATCACG	56
SCS265	Lr19	F: GGC GGA TAA GCA GAG CAG AG R: GGC GGA TAA GTG GGT TAT GG	56
SCS421	Lr28	F: ACA AGG TAA GTC TCC AAC CA R: AGT CGA CCG AGA TTT TAA CC	56
Lr29	Lr29	F24: GTG ACC TCA GGC AAT GCA CAC AGT R24: GTG ACC TCA GAA CCG ATG TCC ATC	60
csLV34	Lr34/YR18/ Pm38	F: GTT GGT TAA GAC TGG TGA TGG R: TGC TTG CTA TTG CTG AAT AGT	56
XMC44	Lr46/YR29/ Pm39	F: GGT CTT CTG GGC TTT GAT CCT G R: GTT GCT AGG GAC CCG TAG TGG	56
CFD23	Lr67/Yr46/Sr55/ Pm46/Ltn3	F: CAA TAA GTA GGC CGG GAC AA R: TGT GCC AGT TGA GTT TGC TC	60
Wms501	Yr5/Yr43	F: CTC ACG CAT TTG ACC ATA TAC AAC T R: TAT TGC ATA ACA TGG CCT CCA GT	60
Xpsp3000	Yr10	F: TCAAAGACATCAAGAGCCGC R: TGGCCTACATGAACTCTGGAT	45
Xgwm413	Yr15	F: TGCTTGTCTAGATTGCTTGGG R: GATCGTCTCGTCCTTGGCA	56

Table 1.3. Presences of Lr gene in the advance lines

Markers	Gene	Advance lines	Lr gene	Fragment size (bp)
Lrh10	Lr-10	V-20337, V-19532, V-19559, V-20395, V-20355, HYT-10-95, V-20418, BF-20105, TWS-1907, V-19590, 20C207, 180007, NR-559, 10HP-428, V-20330, PGMB20-48, RUSTAM-21, V-19080, 19C166, BF-7799, INDUS-21, PAKISTAN-13, B-19261, NR-561, WV-1196, NR-560, 19C160, WVH-1214, JM-1683, JM-1215	+	310
SCS265	Lr19	TWS-1902	+	512
SCS421	Lr28	V-20337, V-19532, AKBAR-19, V-19559HYT-10-95, V-20418, BF-20105, TWS-1907, V-19590, 20C207, TWS-1902, 10141, 180007, NR-559, TWS-1926, V-20352, V-20330, PGMB20-48, AZP-21, NW-103, EV-19103, 19BT022, BF-7799, INDUS-21, PAKISTAN-13, IS-18363, AZRI-8, B-19261, NR-561, NR-564, WV-1196, NR-560, 19C160, WVH-1214	+	570
Lr29	Lr-29	Present in all genotypes	+	150
csLV34	Lr34/YR18/ Pm38 (codominant)	V-20355, TWS-1907, TWS-1902, 10141, WV-1196	+ (150bp) - (229bp)	150
XMC44	Lr46/YR29/ Pm39 (codominant)	V-19532, AKBAR-19, TWS-1926, V-20352, V-20330, PGMB20-48, V-19080, 19C166, NW-103, V-20241, NR-564, JM-1683, 18FJ-01	+ (242) -(240)	242
CFD23	Lr67/Yr46/Sr55/ Pm46/Ltn3	Absent in all genotypes	-	211

Table 1.4. Presences of Yr gene in the advance lines

Markers	Gene	Advance lines	Lr gene	Desire fragment size (bp)
Wms501	Yr-5/Yr43	AKBAR-19, V-20418, 10141, BF-7792, RUSTAM-21, NW-74, V-19080, 19BT022, INDUS-21	+	176
Xpsp3000	Yr10 (codominant)	V-20337, AKBAR-19, V-19559, V-20355, HYT-10-95, TWS-1907, 20C207, PGMB-20-43, IS, 18565, 10141, 180007, NR-559, BF-7792, TWS-1926, V-20352, 10HP-428, V-20330, PGMB20-48, RUSTAM-21, V-19080, AZP-21, 19C166, NW-103, EV-19103, INDUS-21, IS-18363, B-19261, NR-561, NR-564, WV-1196, NR-560	+(220bp) -(240bp) +(260bp) +(286bp)	260
Xgwm413	Yr-15 (codominant)	Absences in all advance lines	+(90,95bp) -(100bp)	90, 95

No competing interests reported.

Rust2021graph.xlsx

Download PDF

Version 1

posted

You are reading this latest preprint version

Molecular marker-based evaluation of wheat advance lines for leaf rust and strip rust

Status:

Version 1

Abstract

Figures

Introduction

Material Methods

Result

Discussion

Conclusion

Declarations

References

Tables

Additional Declarations

Supplementary Files

Status:

Version 1