Response of nitrogen metabolism to nitrogen regulation in different nitrogen-efficient rice seedlings

doi:10.21203/rs.3.rs-3572970/v1

Download PDF

Research Article

Response of nitrogen metabolism to nitrogen regulation in different nitrogen-efficient rice seedlings

https://doi.org/10.21203/rs.3.rs-3572970/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

The aim of this study was to determine the different mechanisms of nitrogen absorption and nitrogen regulation response of different rice varieties with diverse nitrogen efficiencies.On the premise of the same root distribution angle and the same type of DRO1 gene, the DRO1 gene of the low-nitrogen-efficient rice variety was highly expressed under low-nitrogen conditions, which made the root length and the depth of rooting significantly increased compared to that of the high-nitrogen-efficient rice variety. The high expression of key enzyme genes of nitrogen absorption and assimilation (OsAMT2;1, OsGS2, OsGS1;1, OsGS1;2) under low-nitrogen conditions in the low-nitrogen-efficient rice variety had higher nitrogen and phosphorus absorption capacity, and thus improved the accumulation of dry matter in plants. The expression of nitrogen metabolism genes at the seedling stage of different nitrogen-efficient rice varieties showed significant differences in the corresponding laws of nitrogen regulation. The high expression of nitrogen metabolism genes in the high-nitrogen-efficient rice varieties under the condition of sufficient nitrogen fertilizer ensured the full absorption and assimilation of nitrogen.The limiting factors of nitrogen absorption in the seedling stage of the two nitrogen-efficient rice varieties differed under the control of nitrogen fertilizer. The main reason for low nitrogen and high efficiency was that low-nitrogen-efficient rice varieties had a strong rooting ability under low-nitrogen conditions.

Rice (Oryza sativa L.)

Nitrogen efficiency

Root system

Nitrogen is a mineral element that plants require the most for growth, and it is also the most common limiting factor for the growth of plants and natural and artificial ecosystems (Matson et al. 2002). Increasing the amount of nitrogen fertilizer used in rice fields ensures the adequate yield of rice (Wang et al. 2012). Compared with the world average, the total amount of nitrogen fertilizer utilized in the rice fields in China and its proportion in chemical fertilizers is higher; the usage was 32 million tons in 2007 (Heffer et al. 2013). However, with the continuous increase in fertilizer application, the utilization efficiency of fertilizers decreases annually (Zhang et al. 2021). Surplus nitrogen fertilizer enters the water body through surface runoff and rice field leakage, resulting in resource wastage and aggravating environmental pollution (Guo et al. 2010; Ju et al. 2015).

Nitrogen uptake by plants mainly depends on the nitrate transporter (NRT) and ammonium transporter (AMT), where the NRT and AMT are distinct in different plants. Nitrogen concentration, form, environmental temperature, and other factors affect the activities of NRT and AMT in plants, thus affecting the acquisition and absorption of nitrogen by the roots (Harrison et al. 2007; Garnett et al. 2009). The process of plant nitrogen assimilation involves the synthesis of nitrogen-containing organic compounds, such as amino acids and proteins, and through a series of reactions, NO³⁻ or NH⁴⁺ are absorbed from the environment into the body of the plant (Feng et al. 2020). The NO³⁻ absorbed by most plant roots is loaded into the xylem vessels, transported upward, and assimilated into the stems (Krapp 2015). NH⁴⁺ is catalytically assimilated into glutamic acid (Glu) by glutamine synthetase (GS) and glutamic acid synthase (GOGAT) and then enters various protein synthesis pathways (Cao et al. 2020).

Studies have shown that there are significant differences in the nitrogen use efficiency in rice among the different types (conventional and hybrid rice), subspecies (indica and japonica rice), and varieties within the subspecies (Haefele et al. 2008; Wei et al. 2011; Chu et al. 2016). The results showed that there were significant differences in the responses of the rice varieties to nitrogen during different periods of production. Rice varieties before 2000 were more sensitive to nitrogen (Zhou et al. 2020). Currently, super rice varieties have higher fertilizer tolerance than earlier varieties and are more suitable for growth under high nitrogen conditions (Zhao et al. 2019; Chen et al. 2020). Although the currently promoted hybrid rice varieties have high fertilizer tolerance, they can also be divided into low- and high-nitrogen efficient types because of their different responses to low nitrogen conditions (Zhao et al. 2019). The low-nitrogen efficient hybrid rice varieties used in production have a fast rejuvenation speed and strong growth ability under low-nitrogen conditions. Therefore, further study on the mechanism of nitrogen absorption and metabolism of different low-nitrogen-efficient hybrid rice varieties at the seedling stage is conducive to guide field management at the rejuvenation stage and ensuring optimal yield.

2.1. Experimental Design

In 2020, a rice pot experiment was conducted at the rice experimental base of the Southwest University of Science and Technology. The diameter and height of the bucket was 30 and 50 cm, respectively, and the soil weighed 20 kg per bucket. The total nitrogen, phosphorus, and potassium content in soil was 157.6, 70.3, and 64.59 mg/kg, respectively, and the available nitrogen, phosphorus, and potassium content was 80.3, 43.3, and 76.2 mg/kg, respectively. The experiment used four nitrogen fertilizer treatments that were N0:0, N1:60, N2:90, and N3:120 kg/ha. The amount of phosphorus fertilizer (P₂O₅) was 150 kg/ha, and that of potassium fertilizer (K₂O) was 120 kg/ha, which were applied as base fertilizers. The two rice varieties tested were different nitrogen-efficient varieties: Deyou4727 (low-nitrogen efficient type, referred to as low nitrogen type) and Jingyou781 (high-nitrogen efficient type, referred to as high nitrogen type). Seedlings were raised on April 15 and transplanted on May 10, with one plant per bucket; each treatment consisted of 16 buckets. In addition, Deyou 4727, Jingyou 781 and IR64 (Typical shallow root rice varieties) were uniformly sown on the seedling tray, and transplanted into the self-made root distribution observation device (sand culture basket method) at the stage of one leaf and one heart. One plant per basket, three replicates of each genotype. The soil in the basket is the base soil without additional fertilizer, and the baskets were placed in the same environment, and the roots distribution was observed at the 5-leaf stage.

2.2. Samples and Measurements

2.2.1. Nitrogen and Phosphorus Consumption

After transplanting, soil samples were taken from the 10–30 cm tillage layer at 0, 15, 30, and 45 d, for each treatment and ground into a 100 mesh sieve after natural air drying. After digestion with sulfuric acid and the dioxygen method, the nitrogen content was determined using the Kjeldahl method, and the phosphorus content was determined using ammonium molybdate spectrophotometry.

2.2.2. Root Length and Distribution

After transplanting for 15 days, three plants were taken from each treatment, the root system was washed, and the soil was cleaned off the root surface and photographs were taken in a self-made root plane observation device. The root length was then measured using the LA-S plant root image analysis system, dried at 80°C to a constant mass, and its dry weight determined. Observe the distribution of the basket root system. After the basket was taken out, rinse the outer surface of the basket with a watering can to remove the soil attached to it, and then hang the basket with the whole rice root system horizontally for photos.

2.2.3. Genotype and Expression Level of Root Growth Angle

After transplanting for 15 days, the roots were sampled and immediately frozen in liquid nitrogen until the relevant genotypes and expression levels were determined.

The genotype of root DRO1, a quantitative trait locus that controls root growth angle and encodes an auxin response protein was determined. DNA was extracted from leaf tissues using the cetyltrimethylammonium bromide method (Duan et al. 2015). The DRO1 gene and primer sequences are shown in Table 1. The amplified samples were sent to TsingKe Biological Technology Company (Chengdu, China) for DRO1 gene sequencing.

Table 1

Fluorescent quantitative PCR primers
Gene	Primer	Primer pairs
DRO1	Actin-F	CACCAGGTGCTACTGAATGG
	Actin-R	CATCCACTCCTTCTTAGGACC
	DRO1-F	CCGCAAAATTCTTCCACGCT
	DRO1-R	TTGCCAGGACCTTTGGAACC
Nitrogen metabolism gene	Actin-F	CTTCATGGAATGGAAGCTGGGTA
	Actin-R	CGACCACCTTGATCTTCATGCTA
	OsAMT2;1-F	GATGAATCACGCCGAAACAC
	OsAMT2;1-R	GCACGGACGAATCGCTACTT
	OsGS2-F	AGAACTTGGACGATGAATCGGGGC
	OsGS2-R	GAGGGAAGGACGCAGGACTGAAGA
	OsGS1;1-F	CAAGTCTTTTGGGCGTGATATTGTTGAC
	OsGS1;1-R	CACCTGATCACCGGCAGAAATGCCGACA
	OsGS1;2-F	AAAGGCGTTCGGCCGCGACATCGTGGAC
	OsGS1;2-R	CACTTGGTCAGCAGCGGCGATGCCAACT

RNA was extracted using TRIzol reagent, and the RNA concentration was determined using a micro spectrophotometer. Using the reverse transcription kit from Accurate Biology for reverse transcription of DNA, cDNA was generated. SYBR Green Pro Taq HS premix 5 µL, cDNA 2 µL, and 0.2 µL of each primer along with enzyme free water up to a reaction mixture of 10 µL was used in a qPCR kit manufactured by Accurate Biology. Real-time fluorescent quantitative PCR was performed using a Bio-Rad PCR instrument, and the DRO1 gene expression in the roots was determined.

2.2.4. Nitrogen Metabolism Gene Expression

After transplanting for 15 days, the leaves were sampled and immediately frozen in liquid nitrogen until the expression level was determined. The leaf nitrogen metabolism genes OsAMT2;1 (ammonium transporter gene), OsGS2, OsGS1;1, and OsGS1;2 (glutamine synthetase gene) were identified. The specific determination method was the same as that used for the DRO1 gene in section 2.2.3.

2.2.5. Plant Nutrient Accumulation

Complete plant samples after 30 days of transplanting and fertilizing were procured and dried at 80°C to a constant mass; the roots and aboveground parts were weighed and ground into 100-mesh sieves. After digestion with sulfuric acid and dioxygen, the nitrogen content was determined using the Kjeldahl method.

2.3. Statistical Methods

The variance among the different treatments was calculated using one-way analysis of variance (ANOVA) in SPSS (Version 19, Chicago, IL, USA), with the least significant difference statistic (LSD = 0.05). Origin 9.0 and Excel 2017 statistical software were used for data visualization.

3.1 Differences in Root Distribution of Rice with Different Nitrogen Efficiencies

3.1.1 DRO1 Genotype of Rice Roots with Different Nitrogen Efficiency

Phenotypic identification showed that the roots of IR64 were mostly distributed around the basket, and almost no roots protruded from the bottom of the basket. Different from IR64, Deyou4727 and Jingyou 781 have more roots around and at the bottom of the basket (Fig. 1). There is no significant difference in root tiller between Deyou4727 and Jingyou781. According to the gene sequencing of DOR1, it was found that Deyou 4727 and Jingyou 781 showed the same genotype as Nipponbare, while IR64 had a single nucleotide mutation (A→T) at the 752bp of the third exon and a deletion mutation of the “A” base at 943bp in the fourth exon which caused the termination of DOR1 transcription (Fig. 2B and 2C). Therefore, IR64 showed shallow root distribution characteristics different from Deyou 4727 and Jingyou 781. Although the root angles of Deyou 4727 and Jingyou 781 are similar, the observation of basket shows that the root quantity of Deyou 4727 is significantly greater than that of Jingyou 781, which may be related to the difference in response of DRO1 gene expression in rice roots with different nitrogen efficiency to basket environment.

3.1.2 Root Characteristics of Rice with Different Nitrogen Efficiencies and Its Response to Nitrogen Fertilizer

Fifteen days after the application of nitrogen fertilizer, the root growth of the low- and high-nitrogen-efficient rice varieties showed different responses under the different nitrogen fertilizer treatments (Fig. 3). The effect of nitrogen fertilizer treatment on the total root length and dry weight of a single plant reached a significantly increased level. Only the root length difference between the different rice varieties was significant. The effects of nitrogen fertilizer treatment and variety of interactions on the total root length and dry weight of a single plant reached a significant or extremely significant level. The expression of DRO1 was significantly affected by nitrogen fertilizer treatment and the interaction between nitrogen fertilizer and variety of rice, while the difference between the rice varieties was not significant (Table 2). The number of roots directly affects the absorption of nutrients by plants. After the application of nitrogen fertilizer, the length and dry weight of roots first decreased and then increased with increasing nitrogen application. Nitrogen deficiency significantly promoted the growth of rice roots. Under N0, the root length and dry weight for a single plant of the two varieties reached their maximum, and the expression of DRO1 showed a similar trend. The nitrogen-deficient condition induced high expression of DRO1 gene, and promoted the lateral and downward growth of roots. There were significant differences in root length, root dry weight, and DRO1 gene expression in response to nitrogen fertilizer in the different nitrogen-efficient rice varieties. The root length, root dry weight, and DRO1 gene expression of Deyou4727 decreased with an increase in nitrogen fertilizer application, whereas Jingyou781 showed a significant upward trend under N3. Deyou4727 had significantly greater root length, root dry weight, and DRO1 gene expression than Jingyou781 under N0 and N1 conditions. The root length and dry weight of single Deyou4727 plants under N0 were 16.51% and 18.18% higher than those of Jingyou781, respectively, and 13.47% and 29.41% higher than those of Jingyou781 under N1, respectively. In contrast, under medium- and high-nitrogen conditions, the root length and dry weight of Jingyou781 was significantly higher than those of Deyou4727.

Table 2

Analysis of variance of rice plant traits and *DRO1* gene
Treat	Variety	Root length	Root dry weight	DRO1 gene expression
N0	Dy4727	37.68 ± 1.07a	0.26 ± 0.01a	1.42 ± 0.03a
N0	Jy781	32.34 ± 0.91b	0.22 ± 0.01b	1.36 ± 0.02b
N1	Dy4727	36.30 ± 0.43a	0.22 ± 0.01b	1.20 ± 0.01c
N1	Jy781	31.99 ± 0.64b	0.17 ± 0.02c	1.12 ± 0.02d
N2	Dy4727	31.32 ± 1.00b	0.14 ± 0.02d	1.11 ± 0.04d
N2	Jy781	33.46 ± 1.23ab	0.18 ± 0.02c	1.15 ± 0.05cd
N3	Dy4727	28.43 ± 0.92c	0.14 ± 0.01d	0.86 ± 0.04e
N3	Jy781	32.26 ± 0.32ab	0.23 ± 0.01ab	1.08 ± 0.06d
F value	N	34.10**	20.90**	218.19**
	PV	6.78*	2.92	3.41
	N×PV	41.99**	21.21**	22.67**

3.2 Differences in Nitrogen and Phosphorus Absorption Capacity of Rice Varieties with Different Nitrogen Efficiencies

3.2.1 Response of Soil Nitrogen and Phosphorus Consumption to Varieties and Nitrogen Fertilizers

There were significant differences in the soil nitrogen supply capacity under the different nitrogen fertilizer treatments. Within 45 days of transplanting, the nitrogen and phosphorus contents in the soil showed a decreasing trend. There were significant differences in soil nitrogen consumption rates among the different nitrogen fertilizer treatments and rice varieties with different nitrogen efficiencies, whereas the difference in phosphorus consumption was smaller than that of nitrogen (Fig. 4A, B, C, D).

Under different nitrogen application conditions, the soil nitrogen for Deyou4727 decreased rapidly within 15 days after fertilization (Fig. 4A). The soil nitrogen content decreased by 28.57 (N0), 52.38 (N1), 68.88 (N2), and 65.73% (N3) at 15 days, and the decline rate slowed down between 15 and 45 days. With an increase in the nitrogen application rate, the consumption rate of nitrogen within 15 days increased. At the end of 45 days, there was no significant difference in the soil nitrogen content between N1 and N2, and N3 was significantly higher than N1 and N2. Under the N0 condition, the loss of soil nitrogen was lower, and the final soil nitrogen content was significantly lower than that of the nitrogen application treatment. The consumption rate of phosphorus in the soil was similar to that of nitrogen (Fig. 4C). With an increase in nitrogen application, the consumption of phosphorus in the soil increased. Under nitrogen application, the final phosphorus content of the soil was significantly lower than that of N0.

The relationship between the consumption of nitrogen and phosphorus in soil for Jingyou781 and the amount of nitrogen application was similar to that of Deyou4727 (Fig. 4B, D), but the consumption rate of nitrogen within 15 days was significantly different from that of Deyou4727. On the 15th day, the soil nitrogen content decreased by 28.57% (N0), 9.52% (N1), 44.09% (N2), and 50.35% (N3). Under nitrogen application, the consumption rate of nitrogen within 15 days was significantly lower than that of Deyou4727. At 45 days of fertilization, the nitrogen content in the soil was similar to that of Deyou4727. At 45 days, the nitrogen content in the soil for N3 was not significantly different from that for N1 and N2. Therefore, under the N3 condition, the late nitrogen consumption of Jingyou781 was higher than that of Deyou4727.

3.2.2 Differences in Dry Matter and Nitrogen Accumulation and Metabolism of Rice with Different Nitrogen Efficiencies

3.2.2.1 Response of Nitrogen Accumulation of Rice with Different Nitrogen Efficiencies to Nitrogen Fertilizer

Nitrogen fertilizer treatment had a significant effect on the dry matter mass and nitrogen content of the roots and shoots. The difference in root dry matter mass among the rice varieties was highly significant. The interaction effect of nitrogen fertilizer and rice variety had a significant impact on the dry weight of roots and the nitrogen content of roots and shoots (Table 3).

Table 3

Effects of nitrogen fertilizer treatment on dry matter mass and nitrogen accumulation of different varieties (45d after fertilization)
Treats	Variety	Root		Shoot
Treats	Variety	Dry matter mass(g/plant)	Nitrogen content(g/kg)	Dry matter mass(g/plant)	Nitrogen content(g/kg)
N0	Dy4727	1.39 ± 0.20e	9.70 ± 1.15e	15.23 ± 1.38d	11.17 ± 0.57e
N0	Jy781	1.16 ± 0.09e	7.67 ± 1.40f	14.24 ± 1.22d	13.32 ± 1.64de
N1	Dy4727	3.36 ± 0.24d	14.39 ± 0.89c	23.38 ± 1.10c	12.68 ± 1.49de
N1	Jy781	3.13 ± 1.10d	12.67 ± 1.49d	21.93 ± 0.58c	14.72 ± 1.45d
N2	Dy4727	9.14 ± 0.59b	17.59 ± 1.81b	27.60 ± 0.52b	18.21 ± 0.60b
N2	Jy781	7.81 ± 0.52c	17.08 ± 0.54b	26.22 ± 0.68b	16.59 ± 0.85c
N3	Dy4727	8.10 ± 0.46c	17.87 ± 1.24b	29.13 ± 1.43a	21.81 ± 0.67a
N3	Jy781	13.69 ± 1.08a	20.86 ± 1.52a	29.65 ± 0.76a	19.32 ± 0.94ab
F value	N	456.13**	280.47**	421.96**	192.03**
	PV	20.57**	1.25	6.94	0.005
	N×PV	56.03**	16.80**	2.18	20.03**

The application of nitrogen fertilizer significantly increased the accumulation of root and shoot matter. After 45 days of application of nitrogen fertilizer, the accumulation of dry matter increased significantly with increasing application amount. There was a correlation between the response of shoot dry matter accumulation to nitrogen fertilizer and the root system between the rice varieties with different nitrogen efficiencies. Under nitrogen deficiency, rice can promote root growth in a short time (within 15 days) after fertilization, but it inhibits root growth 45 days after fertilization.

Under N0 and N1 conditions, the shoot dry weights of rice varieties with different nitrogen efficiencies were significantly different, but under N2 and N3 conditions, the difference was not significant. Under N0 and N1 conditions, the shoot dry matter mass of Deyou4727 was significantly higher than that of Jingyou781, which was 18.92% and 12.60% higher than that of Jingyou781, respectively. Under N0 and N1 conditions, the root nitrogen content of Deyou4727 was also significantly higher than that of Jingyou781, whereas under high nitrogen conditions, the root nitrogen content was lower than that of Jingyou781, and the shoot nitrogen content was significantly higher than that of Jingyou781. The root system of nitrogen-efficient rice varieties can store relatively high nitrogen under low-nitrogen conditions, while the nitrogen in the root system can be transported to the shoot under high-nitrogen conditions.

3.2.2.2 Response of Nitrogen Metabolism Gene Expression of Rice with Different Nitrogen Efficiencies to Nitrogen Fertilizer

To further explore the response mechanism of nitrogen metabolism to nitrogen regulation in rice varieties with different nitrogen efficiencies, the key genes related to nitrogen absorption, assimilation, and transport in rice were selected, and the differences in the expression of nitrogen metabolism genes under different nitrogen regulation conditions were determined. There were significant differences in the expression of nitrogen metabolism genes between rice varieties with different nitrogen efficiencies, and in the response to nitrogen regulation (Fig. 5A, B, C, D).

The variation trend of OsAMT2;1 gene expression with the amount of nitrogen fertilizer application was significantly different among different nitrogen-efficient rice varieties (Fig. 5A). With the increase in nitrogen fertilizer application, the expression of the OsAMT2;1 gene of Deyou4727 first decreased and then increased. The expression was lowest under N2 and significantly higher under N0 conditions. The OsAMT2;1 gene expression in Jingyou781 increased with increasing nitrogen fertilizer application, but it only increased significantly under N3 conditions, and there was no significant difference between other nitrogen application levels. Under the same nitrogen fertilizer treatment, there were significant differences in OsAMT2;1 gene expression among the rice varieties with different nitrogen efficiencies. Under N0 and N1 conditions, the expression of OsAMT2;1 in Deyou4727 was significantly higher than that in Jingyou781, which was 40.66% (N0) and 10.75% (N1) higher, respectively. Under N2 and N3 conditions, OsAMT2;1 gene expression in Jingyou781 was significantly higher than that in Deyou4727.

The variation trend of OsGS2 gene expression with the amount of nitrogen fertilizer application was significantly different among the different nitrogen-efficient rice varieties (Fig. 5B). The expression of OsGS2 in Deyou4727 first decreased and then increased with increasing nitrogen fertilizer application. The expression was the lowest under N2 conditions, and was significantly higher under N3 conditions than under other treatments. The OsGS2 gene expression of Jingyou781 first increased and then decreased with an increase in nitrogen fertilizer application, and the expression under N2 was significantly higher than that under other treatments. There were significant differences in OsGS2 expression between rice varieties with different nitrogen efficiencies under the same nitrogen level. Under N0 condition, the OsGS2 gene expression of Deyou4727 was significantly higher than that of Jingyou781, by 130.65%. Under N3 conditions, OsGS2 gene expression in Jingyou781 was 38.05% higher than that in Deyou4727.

The change trend of OsGS1;1 and OsGS1;2 gene expression with the application of nitrogen fertilizer was similar among different nitrogen efficiency rice varieties (Fig. 5C, D), and the expression first decreased and then increased with the increase in the application of nitrogen fertilizer. The OsGS1;1 gene expression in rice varieties with different nitrogen efficiencies was the highest under N0 conditions. Under N0 conditions, OsGS1;1 expression in Deyou4727 increased by 27.55% (N1), 48.81% (N2), and 45.35% (N3), respectively. There was no significant difference in OsGS1;1 gene expression between the medium- and high-nitrogen treatments. The OsGS1;1 gene expression of Jingyou781 was the highest under N0 and the lowest under N1 and N2 treatments, and there was no significant difference. The expression increased significantly after N3 treatment. There were significant differences in OsGS1;1 expression between rice varieties with different nitrogen efficiencies under the same nitrogen treatment. Under all nitrogen application conditions, OsGS1;1 gene expression in Deyou4727 was significantly higher than that in Jingyou781. There was no significant difference in the trend of OsGS1;2 gene expression with the application of nitrogen fertilizer among the different nitrogen-efficient rice varieties (Fig. 5D). There were significant differences in OsGS1;2 expression between rice varieties with different nitrogen efficiencies under N0 and N1 conditions. The expression of Deyou4727 was significantly higher than that of Jingyou781, which was 28.42% (N0) and 21.43% (N1) higher than Jingyou781.

3.3 Relationship between Rice Root Characteristics, Nitrogen Metabolism Gene Expression, and Soil Nitrogen and Phosphorus Consumption

3.3.1 Relationship between Root DRO1 Gene Expression and Plant Dry Matter Accumulation and Soil Nutrient Consumption

There was a significant negative correlation between soil nitrogen and phosphorus consumption rate, and there was a significant negative correlation between shoot dry matter mass and soil nitrogen consumption rate (Figs. 6 and 7). It can be seen that there is a certain antagonistic effect on the absorption of soil nitrogen and phosphorus by plants, and the growth of the shoot will be inhibited when the root system has a strong ability to absorb soil nitrogen. There were significant differences between root growth and DRO1 gene expression, as well as between the root and nitrogen absorption capacity of rice varieties with different nitrogen efficiencies.

The root dry weight and root length of nitrogen-efficient rice were significantly positively correlated with the expression of DRO1, root growth was significantly positively correlated with the soil nitrogen consumption rate, and root growth was significantly negatively correlated with shoot growth (Fig. 6). The correlation between root growth of nitrogen-deficient rice and the DRO1 gene was not significant, and the correlation between root growth and soil nitrogen consumption rate and shoot growth was not significant (Fig. 7). The high expression of the DRO1 gene in nitrogen-efficient rice varieties during soil nitrogen deficiency, which increases the root growth ability and root volume, is the main reason for the high absorption of nitrogen by their roots.

3.3.2 Relationship between Plant Nitrogen Metabolism Gene Expression, Nitrogen Content, and Soil Nitrogen Consumption

There was a significant positive correlation between nitrogen content in different parts of hybrid rice plants (roots and shoots), and between plant nitrogen content and soil nitrogen consumption. There was a significant negative correlation between root nitrogen content and OsGS1;1 gene expression and a significant positive correlation between OsGS1;2 and OsAMT2;1 gene expression (Figs. 8 and 9). There were significant differences between nitrogen assimilation genes and the relationship between the expression of nitrogen metabolism genes and plant nitrogen absorption in hybrid rice with different nitrogen efficiencies.

There was a significant positive correlation between the expression of the different nitrogen metabolism genes in Deyou4727, and the interaction between the different nitrogen metabolism genes was strong. The expression of nitrogen metabolism genes was mostly negatively correlated with plant nitrogen absorption, especially root nitrogen content (Fig. 8). There was no significant correlation between other nitrogen metabolism genes in Jingyou781, except that there was a significant positive correlation between OsAMT2;1 and OsGS1;2 gene expression and a significant negative correlation between OsGS1;1 and OsGS2 gene expression. However, the expression of nitrogen metabolism genes OsAMT2;1, OsGS2, and OsGS1;2 was significantly positively correlated with plant nitrogen content, and the expression of OsGS1;1 was significantly negatively correlated with plant nitrogen content (Fig. 9).

It can be seen that the high expression of ammonium transporter gene OsAMT2;1 promotes the expression of the root nitrogen assimilation gene OsGS1;2. The relationship between efficient absorption of nitrogen by rice with different nitrogen efficiencies and the expression of nitrogen metabolism genes is different. The accumulation of nitrogen in Jingyou781 had a great correlation with the expression of these major nitrogen metabolism genes. Nitrogen accumulation in Deyou4727 was mainly related to the root characteristics.

4.1 Increase of DRO1 Gene Expression in Roots Increased the Number of Roots

The root system is the main organ through which rice absorbs and transports water and nutrients. The extent of the root system directly affects the absorption of nutrients by plants, which then affects shoot growth (Henry et al. 2016). As a key gene controlling the root angle, the DRO1 genotype is closely related to the root distribution angle (Kitomi et al. 2020). Previous studies have found that, compared with the “A” type of IR64, the “C” type in rice has a larger root angle and deeper root penetration in the soil. When the DRO1 genotype is the same, it has been speculated that its gene expression is the main factor affecting the length and depth of the root system (Nabi et al. 2022). In this study, the effect of nitrogen regulation on the root length and dry weight of rice was significant. Nitrogen-deficient environments can significantly promote the growth of rice roots; under the condition of no nitrogen, the root length and root dry weight of different types of rice varieties reached a maximum, and the root length and dry weight decreased after the application of nitrogen fertilizer. In this experiment, the DRO1 genotypes of rice with different nitrogen efficiency types were the same, but there were significant differences in their expression under different nitrogen treatments. High expression of DRO1 under nitrogen deficiency was the main reason for promoting root growth. Under the condition of nitrogen deficiency, the expression of the DRO1 gene in low-nitrogen-type rice was significantly higher than that in high-nitrogen-type rice varieties, which leads to significantly higher root length, rooting depth, and dry weight of the low-nitrogen-type rice than those of high-nitrogen-type rice variety. A larger root system is the basis for efficient nitrogen absorption by low-nitrogen rice, and a larger root depth is conducive to the absorption of deep soil nutrients.

The dry matter accumulation of rice shoots increased significantly with increasing nitrogen fertilizer application. The relationship between shoot dry matter and nitrogen fertilizer application was opposite to that of the root system and nitrogen fertilizer application, that is, low nitrogen promoted root growth, and high nitrogen promoted the accumulation of shoot matter. The response of shoot dry matter accumulation in different types of rice varieties to nitrogen fertilizer is related to the root system. Under nitrogen deficiency, the shoot dry matter mass of low-nitrogen rice varieties was significantly higher than that of the high-nitrogen rice varieties.

4.2 Difference of Nitrogen Metabolism Gene Expression in Response to Nitrogen Fertilizer Leads to the Difference of Nitrogen Absorption Capacity among Varieties

The main source of nitrogen in paddy fields is ammonium fertilizer. Under submerged anaerobic conditions, NH4⁺ is the main form of nitrogen fertilizer in the soil (Mahajan et al. 2012), and NH4⁺ has become the main form for plants to absorb nitrogen from the soil. Rice is an NH4⁺ loving crop with 12 AMTs (Suenaga et al. 2003; Li et al. 2013), and its root system has a high NH4⁺ assimilation ability (Chen et al. 2020; Wu et al. 2022), of which OsAMT2;1 is the key gene in the ammonium ion absorption pathway. Under the experimental conditions, the expression of the OsAMT2;1 gene in rice varieties with different nitrogen efficiencies varied with the increase in nitrogen application. The expression of the OsAMT2;1 gene in low-nitrogen rice varieties first decreased and then increased with the increase in nitrogen fertilizer application, while the expression of the OsAMT2;1 gene in high-nitrogen rice varieties continuously increased. A low-nitrogen environment can induce high expression of OsAMT2;1 in low-nitrogen type rice varieties. The expression of the OsAMT2;1 gene in low-nitrogen type varieties was significantly higher than that in high-nitrogen type rice varieties in nitrogen-deficient environments, which promotes the increase in the nitrogen absorption capacity of plants. Therefore, the nitrogen consumption of soil planted with low-nitrogen type varieties was significantly higher than that of high-nitrogen type rice varieties within 0–15 days after fertilization.

As the key enzyme of nitrogen assimilation and reactivation, GS has two isoforms: cytoplasmic GS1 and plastid GS2. Cytosolic GS1 is responsible for primary ammonium assimilation in roots or the re-assimilation of ammonium into proteins, whereas GS2 is mainly responsible for ammonium assimilation produced through photorespiration in chloroplasts. There are three GS1 members in rice, of which OsGS1.1 and OsGS1.2 are expressed in all organs and respond to the ammonium supply, whereas OsGS1.3 is expressed in spikelets and assimilates ammonium into the seeds. OsGS2 is abundantly expressed in leaves and is an important participant in the assimilation of light oxygen, reduced nitrogen, and circulating ammonia (James et al. 2018). In this experiment, we studied the metabolism of nitrogen in rice seedlings; therefore, we chose OsGS1.1, OsGS1.2, and OsGS2 to study the response of the expression of three nitrogen assimilation genes to the level of nitrogen fertilizer. In the experiment, the gene expression levels of nitrogen assimilation genes OsGS1.1 and OsGS1.2 at the seedling stage of different nitrogen-efficient rice varieties were similar to those of nitrogen fertilizer, and nitrogen deficiency and nitrogen excess induced high expression of these two genes. The high expression of OsGS1.1 and OsGS1.2 under nitrogen deficiency may help to improve the absorption of nitrogen by plants. High expression under excessive nitrogen application is conducive to accelerating nitrogen assimilation and avoiding NH4⁺ accumulation. The expression of these two genes in low nitrogen type rice varieties was significantly higher than that in high nitrogen type rice varieties under conditions of nitrogen deficiency and excess nitrogen fertilizer. The expression pattern of OsGS2 in low-nitrogen-type rice varieties was similar to that of OsGS1.1 and OsGS1.2. Nitrogen deficiency and excess nitrogen fertilizer induce high expression of the OsGS2 gene, while the expression of the OsGS2 gene in high nitrogen type rice varieties will not be upregulated under the condition of nitrogen deficiency but will increase with the increase in nitrogen application. Simultaneously, the study found that OsGS1 is involved in the reuse of nitrogen during the aging process of rice. The high expression of OsGS1;1 in low-nitrogen rice varieties under low-nitrogen conditions may be beneficial for the recovery and utilization of nitrogen under nitrogen-deficient conditions and the growth of seedlings under nitrogen-deficient conditions. The high expression of nitrogen assimilation genes under high-nitrogen conditions is the reason for the rapid accumulation of biomass at the seedling stage.

4.3 Response of Nitrogen Absorption and Utilization Capacity of Different Types of Rice Varieties to Nitrogen and Phosphorus Regulation is Significantly Different

Current studies mostly consider that there are significant differences in nitrogen absorption and utilization among indica and japonica subspecies, hybrid and conventional rice, and different genotypes of the same type of rice subspecies. The main reason is that there are three AtNRT1.1 homologous proteins in the rice genome (namely OsNRT1.1A, OsNRT1.1B, and OsNRT1.1C according to the sequence similarity). OsNRT1.1A is involved in the regulation of nitrate and ammonium in rice cells. OsNRT1.1A is induced by ammonium salt, indicating that the functional differentiation of rice OsNRT1.1A is of great significance for its environmental adaptability (Wang et al. 2018). The ability to use nitrate in indica rice varieties was significantly higher than that in japonica rice varieties, and the single-base variation of the nitrate transporter gene OsNRT1.1B was an important reason for the difference in nitrogen use efficiency between japonica and indica rice (Hu et al. 2015). However, there was no significant difference in nitrogen nutrition efficiency among conventional indica, conventional japonica and indica hybrid (Cheng et al. 2007), which may be related to the fertilization treatment of experimental materials and settings. For example, Yin Chunyuan studied the differences in nitrogen absorption and utilization of paddy rice at four nitrogen levels (Yin et al. 2012). The results showed that the nitrogen absorption and utilization rates of indica rice were significantly higher than those of japonica rice at low and medium nitrogen levels, and the opposite was true at high nitrogen levels. This demonstrates that the evaluation of rice nitrogen efficiency should not be limited to the same nitrogen fertilizer level.

In this experiment, high-yield and high-quality hybrid rice varieties utilized in the Sichuan Province in recent years were selected, and their maximum yield levels were similar, but the production showed significant differences in response to nitrogen fertilizer (after transplanting, Deyou4727 shows that it returns to green faster and has stronger tillering ability under low nitrogen conditions). The experiment found that there were significant differences in nitrogen absorption and utilization efficiency between the two varieties under low-nitrogen conditions. The low-nitrogen and high-efficiency rice Deyou4727 had a stronger nitrogen absorption capacity under low-nitrogen conditions. The regulatory mechanisms of nitrogen absorption of the two varieties are different. Under low nitrogen conditions, low-nitrogen-efficient rice promotes the growth of roots through high expression of the DRO1 gene, and its strong roots are the main reason for nitrogen absorption under low-nitrogen conditions. The nitrogen absorption of the high-nitrogen-efficient rice Jingyou781 is mainly regulated by the expression of nitrogen metabolism genes. Under increased nitrogen fertilizer application, the high expression of nitrogen metabolism genes is the main reason for the plant to absorb and assimilate a large amount of nitrogen.

Large roots and high expression of nitrogen metabolism genes can improve the efficiency of nitrogen absorption and assimilation. Low- and high-nitrogen-efficient rice varieties can achieve high yields under conditions of sufficient nitrogen fertilizer. Under conditions of low nitrogen and high efficiency, rice can improve the nitrogen absorption efficiency of the plant by increasing the number and depth of roots, thereby ensuring the rapid rejuvenation of rice after transplanting. High-nitrogen-efficient rice has a weak ability to absorb nitrogen under low-nitrogen conditions. When nitrogen is sufficient, it has a higher ability for nitrogen absorption and assimilation due to the high expression of nitrogen metabolism genes. In rice production, high-nitrogen-efficient rice must appropriately increase the proportion of tillering fertilizer to ensure the optimal absorption of nitrogen by plants.

Author Contributions Statement

Guotao Yang & Guohao Zhang: Conceptualization, Investigation, Methodology, Validation, Writing - original draft. Peng Ma & Rong Liu: Data curation, Formal analysis. Hong Chen & Xuechun Wang: Software, Writing - review & editing. Yungao Hu : Funding acquisition, Project administration, Writing - review & editing.

Acknowledgments

This research was funded by the Sichuan Science and Technology program (2022YFH0030).

Conflicts of interest

The author declares no conflict of interest.

Cao XC, Wu MY, Zhu CQ, et al (2020) Glutamate dehydrogenase mediated amino acid metabolism after ammonium uptake enhances rice growth under aeration condition. Plant Cell Rep 39(3):363–379. https://doi.org/10.1007/s00299-019-02496-w
Chen M, Chen G, Di DW, et al (2020) Higher nitrogen use efficiency (NUE) in hybrid “super rice” links to improved morphological and physiological traits in seedling roots. J Plant Physiol 251153191. https://doi.org/10.1016/j.jplph.2020.153191
Cheng JF, Dai TB, Cao WX, et al (2007) Variations of nitrogen nutrition efficiency in different rice germplasm types. Plant Nutr Fertil Sci 13(2):175–183
Chu G, Wang Z, Zhang H, et al (2016) Agronomic and physiological performance of rice under integrative crop management. Agron J 108(1):117–128. https://doi.org/10.2134/agronj15.0310
Duan YJ, Jiang YZ, Ye SL, et al (2015) PtrWRKY73, a salicylic acid-inducible poplar WRKY transcription factor, is involved in disease resistance in Arabidopsis thaliana. Plant Cell Rep 34(5):831–841. https://doi.org/10.1007/s00299-015-1745-5
Feng HM, Fan XR, Miller AJ, Xu G (2020) Plant nitrogen uptake and assimilation: regulation of cellular pH homeostasis. J Exp Bot 71(15):4380–4392. https://doi.org/10.1093/jxb/eraa150
Garnett T, Conn V, Kaiser BN (2009) Root based approaches to improving nitrogen use efficiency in plants. Plant Cell Environ 32(9):1272–1283. https://doi.org/10.1111/j.1365-3040.2009.02011.x
Guo JH, Liu XJ, Zhang Y, et al (2010) Significant acidification in major Chinese croplands. Science 327(5968):1008–1010. https://doi.org/10.1126/science.1182570
Haefele SM, Jabbar SMA, Siopongco JDLC, et al (2008) Nitrogen use efficiency in selected rice (Oryza sativa L.) genotypes under different water regimes and nitrogen levels. Field Crops Res 107(2):137–146. https://doi.org/10.1016/j.fcr.2008.01.007
Harrison KA, Bol R, Bardgett RD (2007) Preferences for different nitrogen forms by coexisting plant species and soil microbes. Ecology 88(4):989–999. https://doi.org/10.1890/06-1018
Heffer P, Gruère A, Roberts T (2013) Assessment of fertilizer use by crop at the global level. Int Fertil Ind Assoc Paris
Henry A, Wehler R, Grondin A, et al (2016) Environmental and physiological effects on grouping of drought-tolerant and susceptible rice varieties related to rice (Oryza sativa) root hydraulics under drought. Ann Bot 118(4):711–724. https://doi.org/10.1093/aob/mcw068
Hu B, Wang W, Ou SJ, et al (2015) Variation in NRT1.1B contributes to nitrate-use divergence between rice subspecies. Nat Genet 47(7):834–838. https://doi.org/10.1038/ng.3337
James D, Borphukan B, Fartyal D, et al (2018) Concurrent Overexpression of OsGS1;1 and OsGS2 Genes in Transgenic Rice (Oryza sativa L.): Impact on Tolerance to Abiotic Stresses. Front Plant Sci 9786. https://doi.org/10.3389/fpls.2018.00786
Ju CX, Buresh RJ, Wang ZQ, et al (2015) Root and shoot traits for rice varieties with higher grain yield and higher nitrogen use efficiency at lower nitrogen rates application. Field Crops Res 17547–55. https://doi.org/10.1016/j.fcr.2015.02.007
Kitomi Y, Hanzawa E, Kuya N, et al (2020) Root angle modifications by the DRO1 homolog improve rice yields in saline paddy fields. Proc Natl Acad Sci U S A 117(35):21242–21250. https://doi.org/10.1073/pnas.2005911117
Krapp A (2015) Plant nitrogen assimilation and its regulation: a complex puzzle with missing pieces. Curr Opin Plant Biol 25115–122. https://doi.org/10.1016/j.pbi.2015.05.010
Li ST, He P, Jin JY (2013) Nitrogen use efficiency in grain production and the estimated nitrogen input/output balance in China agriculture. J Sci Food Agric 93(5):1191–1197. https://doi.org/10.1002/jsfa.5874
Mahajan G, Chauhan BS, Timsina J, et al (2012) Crop performance and water-and nitrogen-use efficiencies in dry-seeded rice in response to irrigation and fertilizer amounts in northwest India. Field Crops Res 13459–70. https://doi.org/10.1016/j.fcr.2012.04.011
Matson P, Lohse KA, Hall SJ (2002) The globalization of nitrogen deposition: consequences for terrestrial ecosystems. Ambio 31(2):113–119. https://doi.org/10.1579/0044-7447-31.2.113
Nabi F, Sajid S, Yang GT, et al (2022) The Adenine at the 4th Exon of the DRO1 Gene Provides Drought-Tolerance Capacity to Hybrid Rice Deyou4727 and Its Maintainer Line Dexiang074B. Agronomy 12(3):752. https://doi.org/10.3390/agronomy12030752
Suenaga A, Moriya K, Sonoda Y, et al (2003) Constitutive expression of a novel-type ammonium transporter OsAMT2 in rice plants. Plant Cell Physiol 44(2):206–211. https://doi.org/10.1093/pcp/pcg017
Wang Q, Huang JL, He F, et al (2012) Head rice yield of “super” hybrid rice Liangyoupeijiu grown under different nitrogen rates. Field Crops Res 13471–79. https://doi.org/10.1016/j.fcr.2012.05.001
Wang XJ, Jia ZK, Liang LY, et al (2018) Changes in soil characteristics and maize yield under straw returning system in dryland farming. Field Crops Res 21811–17. https://doi.org/10.1016/j.fcr.2017.12.003
Wei D, Cui KH, Pan JF, et al (2011) Genetic dissection of grain nitrogen use efficiency and grain yield and their relationship in rice. Field Crops Res 124(3):340–346. https://doi.org/10.1016/j.fcr.2011.07.003
Wu XY, Xie XX, Yang S, et al (2022) OsAMT1;1 and OsAMT1;2 Coordinate Root Morphological and Physiological Responses to Ammonium for Efficient Nitrogen Foraging in Rice. Plant Cell Physiol 63(9):1309–1320. https://doi.org/10.1093/pcp/pcac104
Yin CY, Wang SY, Xue YZ, et al (2012) Effects of Nitrogen Treatment on Rice Yield and Leaves Conformation Characteristics of ‘Xindao No.18’. J Agric Sci Technol 14(3):101–106
Zhang S, Zhu LM, Shen CB, et al (2021) Natural allelic variation in a modulator of auxin homeostasis improves grain yield and nitrogen use efficiency in rice. Plant Cell 33(3):566–580. https://doi.org/10.1093/plcell/koaa037
Zhao X, Wang XC, Wu F, et al (2019) Differences in response of hybrid rice to low nitrogen stress and screening methods in Sichuan Province. Chin J Appl Environ 25(4):0909–0917. https://doi.org/10.19675/j.cnki.1006-687x.2019.03014
Zhou T, Zhou Q, Li EP, et al (2020) Effects of nitrogen fertilizer on structure and physicochemical properties of “super” rice starch. Carbohydr Polym 239116237. https://doi.org/10.1016/j.carbpol.2020.116237

Download PDF

Reviewers agreed at journal
13 Dec, 2023
Reviewers invited by journal
10 Dec, 2023
Editor assigned by journal
08 Nov, 2023
First submitted to journal
06 Nov, 2023

You are reading this latest preprint version

Response of nitrogen metabolism to nitrogen regulation in different nitrogen-efficient rice seedlings

Status:

Version 1

Abstract

Figures

1. Introduction

2. Materials and Methods

2.1. Experimental Design

2.2. Samples and Measurements

2.2.1. Nitrogen and Phosphorus Consumption

2.2.2. Root Length and Distribution

2.2.3. Genotype and Expression Level of Root Growth Angle

2.2.4. Nitrogen Metabolism Gene Expression

2.2.5. Plant Nutrient Accumulation

2.3. Statistical Methods

3. Results

3.1 Differences in Root Distribution of Rice with Different Nitrogen Efficiencies

3.1.1 DRO1 Genotype of Rice Roots with Different Nitrogen Efficiency

3.1.2 Root Characteristics of Rice with Different Nitrogen Efficiencies and Its Response to Nitrogen Fertilizer

3.2 Differences in Nitrogen and Phosphorus Absorption Capacity of Rice Varieties with Different Nitrogen Efficiencies

3.2.1 Response of Soil Nitrogen and Phosphorus Consumption to Varieties and Nitrogen Fertilizers

3.2.2 Differences in Dry Matter and Nitrogen Accumulation and Metabolism of Rice with Different Nitrogen Efficiencies

3.2.2.1 Response of Nitrogen Accumulation of Rice with Different Nitrogen Efficiencies to Nitrogen Fertilizer

3.2.2.2 Response of Nitrogen Metabolism Gene Expression of Rice with Different Nitrogen Efficiencies to Nitrogen Fertilizer

3.3 Relationship between Rice Root Characteristics, Nitrogen Metabolism Gene Expression, and Soil Nitrogen and Phosphorus Consumption

3.3.1 Relationship between Root DRO1 Gene Expression and Plant Dry Matter Accumulation and Soil Nutrient Consumption

3.3.2 Relationship between Plant Nitrogen Metabolism Gene Expression, Nitrogen Content, and Soil Nitrogen Consumption

4. Discussion

4.1 Increase of DRO1 Gene Expression in Roots Increased the Number of Roots

5. Conclusion

Declarations

References

Status:

Version 1