THUMPD3-AS1 inhibits ovarian cancer cell apoptosis through the miR-320d/ARF1 axis

doi:10.21203/rs.3.rs-3579609/v1

Download PDF

Research Article

THUMPD3-AS1 inhibits ovarian cancer cell apoptosis through the miR-320d/ARF1 axis

https://doi.org/10.21203/rs.3.rs-3579609/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 04 Jul, 2024

Read the published version in The FASEB Journal →

Version 1

posted

You are reading this latest preprint version

Background

Ovarian cancer is one of the most common gynecologic malignancies that has a poor prognosis. THUMPD3-AS1 is an oncogenic long noncoding RNA (lncRNA) in several cancers. Nevertheless, the role of THUMPD3-AS1 in ovarian cancer and the underlying mechanism has yet to be elucidated.

Methods

Human normal ovarian epithelial cells (IOSE80) and ovarian cancer cell lines (CAVO3, A2780, SKOV3, OVCAR3 and HEY) were adopted for in vitro experiments. The functional roles of THUMPD3-AS1 in cell viability and apoptosis were determined using CCK-8, flow cytometry and TUNEL assays. Western blot and RT-qPCR were performed to assess the levels of ARF1, Bax, Bcl-2 and caspase 3, THUMPD3-AS1and miR-320d, respectively. The targeting relationship between miR-320d and THUMPD3-AS1 or ARF1 was validated with dual luciferase assay.

Results

THUMPD3-AS1 and ARF1 were highly expressed in ovarian cancer cells, whereas miR-320d level was lowly expressed. THUMPD3-AS1 knockdown was able to repress cell viability and accelerate apoptosis of OVCAR3 and SKOV3 cells. Also, THUMPD3-AS1 acted as a sponge for miR-320d, preventing the degradation of its target gene ARF1. MiR-320d downregulation reversed the tumor suppressive function induced by THUMPD3-AS1 depletion. Additionally, miR-320d overexpression inhibited ovarian cancer cell viability and accelerated apoptosis, which was overturned by overexpression of ARF1.

Conclusion

THUMPD3-AS1 inhibited ovarian cancer cell apoptosis by modulation of miR-320d/ARF1 axis. The discoveries might provide a prospective target for ovarian cancer treatment.

ovarian cancer

apoptosis

ARF1

miR-320d

THUMPD3-AS1

Ovarian cancer is a frequently lethal gynecologic malignancy with an extremely poor prognosis [1]. The primary therapeutics for ovarian cancer include surgery and chemotherapy [2]. However, patients often succumb to recurrence within several years after the initial treatment [3]. Hence, understanding the mechanisms of ovarian cancer progression is critically important for the development of novel therapies.

Long noncoding RNAs (lncRNAs) are transcripts with a length of more than 200 nucleotides with few or limited protein coding potential, and serving as competing endogenous RNAs (ceRNAs) with miRNAs to indirectly modulate the expression of downstream target mRNAs [4]. Research has discovered lncRNAs play critical roles in cancer progression [5]. The abnormal expressions of lncRNAs are often discovered in ovarian cancer and significantly contribute to malignant phenotype alterations [6]. LncRNA THUMPD3-AS1 has been proven to be an oncogenic gene in several cancers. For example, THUMPD3-AS1 accelerates cell growth and aggressiveness in colorectal cancer [7]. In prostate cancer, a high level of THUMPD3-AS1 is related to the increased possibility of metastatic progression [8]. Besides, THUMPD3-AS1 silencing leads to a decrease in migration and proliferation in hepatocellular carcinoma cells [9]. Through using UALCAN database (http://ualcan.path.uab.edu/index.html), we discovered THUMPD3-AS1 is upregulated in ovarian cancer, nonetheless, its function and potential mechanism have not been elucidated in ovarian cancer.

MicroRNAs (miRNAs) are evolutionarily conserved small non-coding RNAs with a length of 18–22 nucleotides, which modulated gene expression and protein translation, besides, miRNAs can function as tumor suppressors or oncogenes in multiple cancers [10]. MiR-320d has been reported to be a cancer-associated miRNA that serves as a tumor suppressor in some cancers [11, 12]. Notably, miR-320d is reduced in plasma exosomes of ovarian cancer patients, and a low level of miR-320d is relevant to ovarian cancer tumor stage and lymph node metastasis [13]. Besides, miR-320d low expression is involved in platinum resistance development in ovarian cancer [14], which indicates that miR-320d plays a vital role in ovarian cancer. Potential interaction between miR-320d and THUMPD3-AS1 is predicted through using starbase database (http://starbase.sysu.edu.cn/). The above information suggested that THUMPD3-AS1 might interact with miR-320d to support the survival of ovarian cancer cells.

MiRNAs can bind to specific mRNA targets to post-transcriptionally modulate gene expressions [15]. ADP-ribosylation factor 1 (ARF1) is a small GTPase which involved participates in regulating numerous cellular processes, including cell proliferation, invasion migration and apoptosis [16]. High expression of ARF1 has been observed in breast cancer cells, while depletion of ARF1 leads to breast cancer cell apoptosis [17]. Similarly, in prostate cancer, inhibiting ARF1 activation with a small-molecule inhibitor Exo2 induces cell apoptosis, as well as represses proliferation, migration and invasion [18]. Furthermore, ARF1 is demonstrated to be increased in the tissues and cell lines of epithelial ovarian cancer, as well as promoted epithelial ovarian cancer malignant progression [19, 20]. Through starbase database, we uncovered that ARF1 is a target of miR-320d. Accordingly, miR-320d may participate in regulating apoptosis in ovarian cancer via targeting ARF1.

Here, we intended to probe the effect of THUMPD3-AS1 in ovarian cancer and investigate the underlying mechanisms. Our research explored the abnormal expressions of THUMPD3-AS1 in ovarian cancer cell lines, as well as the modulation of THUMPD3-AS1 in ovarian cancer cell apoptosis. The direct relationship between miR-320d and THUMPD3-AS1/ARF1 was also verified. Furthermore, we studied whether THUMPD3-AS1 modulated ovarian cancer cell apoptosis via the miR-320d/ARF1 axis. This study might provide an innovative insight for treating ovarian cancer.

Cell culture

Human normal ovarian epithelial cells (IOSE80) and ovarian cancer cell lines (A2780, SKOV3, OVCAR3, CAVO3 and HEY) were gained from Chinese Academy of Sciences (Shanghai, China). They were kept at 37°C with 5% CO2 in DEME medium (Gibco, Grand Island, NY, USA) containing 10% fetal bovine serum (Invitrogen, Carlsbad, CA, USA), 100 mg/mL streptomycin and 100 U/mL penicillin.

Cell transfection

The negative control (pcDNA3.1 vector) and overexpressing plasmids pcDNA3.1-ARF1 (OE-ARF1), short hairpin RNA (shRNA) against THUMPD3-AS1 (sh-THUMPD3-AS1) and corresponding negative control (sh-NC), inhibitor/mimics NC and miR-320d inhibitor/mimics were synthesized by Gene Pharma (Shanghai, China). In line with the instructions, cell transfection was carried out by Lipofectamine 2000 (Invitrogen) for 48 h.

Cell Counting Kit-8 (CCK-8)

CCK-8 (Solarbio, Beijing, China) was applied to assess cell viability. In short, cells (5×10³cells/well) were seeded in a 96-well plate before incubated overnight. Following transfection, cells were kept for 48 h. Later, they were added with CCK-8 solution (10 µL/well) before 2 h incubation. A microplate reader was employed to measure the absorbance value at 450 nm

Flow cytometry

The apoptosis of cells was evaluated employing Annexin V-FITC apoptosis detection kit (Thermo, Waltham, MA, USA). Briefly, cells (5×10⁵ cells/well) were seeded in a 6-well plate. After transfection, cells were incubated in the dark for 15 min at 4°C with 5 µL of Annexin V-FITC and 10 µL of PI. Finally, flow cytometer (Becton Dickinson, Franklin Lakes, NJ, USA) was employed for cell apoptosis assessment.

Terminal deoxynucleotidyl transferase dUTP nick-end labeling (TUNEL) assay

TUNEL Apoptosis Assay Kit (Beyotime, Shanghai, China) was applied for detecting cell apoptosis. Cells (3×10⁴ cells/300 µL) were planted in confocal dishes. Afterwards, they were fixed for 30 minutes at room temperature in paraformaldehyde (4%). Following rinsing with PBS, cells were treated with TritonX-100 (0.1%). Then they were incubated in TUNEL reaction mixture, before stained by DAPI. A fluorescence microscope (Olympus, Tokyo, Japan) was applied for obtaining the cell images.

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

Total RNA was isolated from cells with TRIzol reagent (Invitrogen). Subsequently, cDNA Synthesis SuperMix Kit (Trans Gen, Beijing, China) and miRNA First-Stand cDNA Synthesis Kit (GeneCopoeia, Rockville, MD, USA) were used for the reverse transcription of mRNA/lncRNA and miRNA, respectively. Then, 7500 Real-time PCR System (Thermo) was applied to operate RT-qPCR. Primers were displayed in Table 1. GAPDH and U6 were applied as internal references. The relative RNA expressions were evaluated using 2^−ΔΔCT method.

Table 1

The primer sequences used in RT-qPCR.
Gene	Forward primer (5’-3’)	Reversed primer (5’-3’)
THUMPD3-AS1	TGGTGCCACCTATGTTGTGG	ACACTTCAGCCAGCAGAGAC
miR-320d	AAAAGCTGGGTTGAGAGGA	TGGTGTCGTGGAGTCG
ARF1	CGTCAAGGTCATGTAGGTGGT	ACACCGTCTTCACAGCAAAC
GAPDH	AGCCACATCGCTCAGACAC	GCCCAATACGACCAAATCC
U6	CTCGCTTCGGCAGCACA	AACGCTTCACGAATTTGCGT

Western blot

Total protein was extracted from cells with RIPA lysis buffer (Beyotime). After centrifugation, the supernatants were gathered. Subsequently, protein concentration was tested utilizing BCA Assay Kit (Pierce, Appleton, WI, USA). Protein samples were then transferred onto PVDF membranes, followed separated by SDS-PAGE. Next, 5% skim milk was employed to block these membranes for 1 h. Later, primary antibodies, which included anti-ARF1 (Santa Cruz Biotechnology, Santa Cruz, CA, USA), anti-Bcl-2 (Invitrogen), anti-Bax (Invitrogen), anti-caspase 3 (Santa Cruz) and anti-GAPDH (Invitrogen), were added and incubated these membranes at 4℃ overnight. Next, horseradish peroxidase-labeled secondary antibodies were added to incubate the membranes for 1 h at room temperature. An electrochemiluminescence kit (Millipore, Bedford, MA, USA) was employed for developing the protein bands.

Dual luciferase reporter assay

Mutant (MUT) and wildtype (WT) sequences of THUMPD3-AS1 or ARF1 containing putative binding sites of miR-320d were cloned into pmirGLO vectors (Promega, Madison, WI, USA), named THUMPD3-AS1-MUT/WT or ARF1- MUT/WT, respectively. Then, using Lipofectamine 2000, cells (2 × 10⁵ cells/well) were co-transfected with miR-320d mimics or mimics NC and MUT/WT vectors for 48 h. Then, dual luciferase reporter assay system (Promega) was employed for the detection of luciferase activity, in accordance with the directions.

Statistical analysis

Data were described as mean ± standard deviation (SD) and analyzed by SPSS software. Data analysis was conducted among multiple groups using one-way analysis of variance (ANOVA), with Tukey’s test for subsequent analysis. Student's t-test was employed for data analysis between two groups. p < 0.05 was considered statistically significant.

THUMPD3-AS1 and ARF1 increased while miR-320d decreased in ovarian cancer cells.

Firstly, THUMPD3-AS1, miR-320d and ARF1 expressions were examined in normal ovarian epithelial cells and ovarian cancer cell lines. Compared with IOSE80 cells, the upregulation of THUMPD3-AS1 was observed in SKOV3, OVCAR3, HEY, A2780 and CAVO3 cells (Fig. 1A). Additionally, in ovarian cancer cell lines, miR-320d was obviously reduced (Fig. 1B). Furthermore, as shown in Fig. 1C, ARF1 was elevated in ovarian cancer cells. Collectively, THUMPD3-AS1 and ARF1 increased while miR-320d declined in ovarian cancer cells.

THUMPD3-AS1 knockdown facilitated ovarian cancer cell apoptosis

Depending on the above results, OVCAR3 and SKOV3 cells exhibited the most obvious alterations in THUMPD3-AS1 expression, these two cell lines were selected for subsequent assays. Next, sh-THUMPD3-AS1 was transfected into ovarian cancer cells, to explore the role of THUMPD3-AS1. In comparison with control or sh-NC groups, the downregulation of THUMPD3-AS1 was observed in cells transfected with sh-THUMPD3-AS1 (Fig. 2A), indicating the effective transfection. THUMPD3-AS1 knockdown led to miR-320d upregulation in ovarian cancer cells (Fig. 2B). Furthermore, THUMPD3-AS1 depletion repressed cell viability (Fig. 2C) and promoted cell apoptosis (Fig. 2D-E). The increased expressions of caspase 3 and Bax, while declined ARF1 and Bcl-2 expressions were exhibited in ovarian cancer cells after THUMPD3-AS1 knockdown (Fig. 2F). Taken together, THUMPD3-AS1 knockdown elevated miR-320d, reduced ARF1, and accelerated apoptosis of ovarian cancer cells.

MiR-320d bound to THUMPD3-AS1 and ARF1.

In order to explore the relationship among miR-320d, THUMPD3-AS1 and ARF1, the binding sites between them were predicted using starbase. Binding sites were found between miR-320d and THUMPD3-AS1, as shown in Fig. 3A. In comparison to mimics NC group, miR-320d overexpression downregulated luciferase activity in THUMPD3-AS1-WT transfected cells, nevertheless, no obvious alteration in THUMPD3-AS1-MUT transfected cells was observed (Fig. 3B). In the same way, by using starbase, binding sites of miR-320d and ARF1 were forecasted (Fig. 3C). Furthermore, in SKOV3 and OVCAR3 cells, the direct interaction of these two molecules was also validated by applying dual luciferase reporter assay (Fig. 3D). These findings revealed that miR-320d is bound to THUMPD3-AS1 and ARF1 in ovarian cancer cells.

THUMPD3-AS1 inhibited apoptosis by sponging miR-320d in ovarian cancer cells.

To explore whether THUMPD3-AS1 regulated apoptosis in ovarian cancer cells through modulating miR-320d, SKOV3 and OVCAR3 cells were transfected with miR-320d inhibitor or sh-THUMPD3-AS1. Compared with control or inhibitor NC groups; THUMPD3-AS1 was observed to be downregulated in sh-THUMPD3-AS1 group (Fig. 4A). And miR-320d was decreased by miR-320d inhibitor, indicating effective inhibition of miR-320d; besides, knockdown of THUMPD3-AS1 increased miR-320d level, which was reversed by inhibition of miR-320d (Fig. 4B). MiR-320d inhibition elevated cell viability of SKOV3 and OVCAR3 cells; THUMPD3-AS1 knockdown declined cell viability, whereas the effect induced by THUMPD3-AS1 knockdown was restored after miR-320d inhibition (Fig. 4C). Inhibition of miR-320d repressed cell apoptosis; moreover, THUMPD3-AS1 knockdown led to the promotion of apoptosis, while miR-320d inhibition overturned this outcome (Fig. 4D-G). MiR-320d inhibition upregulated ARF1 and Bcl-2, as well as downregulated caspase 3 and Bax; additionally, silencing of THUMPD3-AS1 resulted in the increase of Bax and caspase 3, as well as declined Bcl-2 and ARF1, which was reversed after miR-320d inhibition (Fig. 4H). Taken together, THUMPD3-AS1 repressed apoptosis in ovarian cancer cells by downregulating miR-320d.

MiR-320d promoted apoptosis in ovarian cancer cells through reducing ARF1.

MiR-320d mimics or OE-ARF1 was transfected into cells, to examine whether miR-320d participated in modulating apoptosis in ovarian cancer via ARF1. Compared to control or mimics NC groups, miR-320d level was increased in miR-320d mimics-transfected cells, indicating successful transfection; miR-320d level was not altered after transfection with OE-ARF1 (Fig. 5A). Besides, overexpression of miR-320d led to the downregulation of ARF1, while OE-ARF1 transfection upregulated ARF1 level (Fig. 5B). Compared with control or mimics NC groups, overexpression of miR-320d reduced cell ovarian cancer cell viability, whereas ARF1 overexpression overturned the impact induced by miR-320d (Fig. 5C). Furthermore, miR-320d overexpression accelerated cell apoptosis, which was overturned after overexpression of ARF1 (Fig. 5D-G). MiR-320d overexpression declined ARF1 and Bcl-2 levels, as well as upregulated caspase 3 and Bax levels, whereas these alterations were antagonized by overexpression of ARF1 (Fig. 5H). The above results indicated that miR-320d downregulated ARF1 to promote apoptosis in ovarian cancer cells.

Likewise treatment strategies for ovarian cancer continue to evolve, however, the survival rate remains very poor [21]. Recently, lncRNAs have been proven to implicate in the development of ovarian cancer [22]. Here, our study demonstrated that THUMPD3-AS1 knockdown efficiently stimulated apoptosis in ovarian cancer cells. Moreover, miR-320d is directly bound to THUMPD3-AS1 and ARF1. Mechanistic investigation indicated that THUMPD3-AS1 inhibited cell apoptosis through the miR-320d/ARF1 axis in ovarian cancer.

LncRNAs are functional for ovarian cancer progression [23]. Additionally, THUMPD3-AS1 abnormally expressed in several cancers and implicates disease development. For example, THUMPD3-AS1 expression upregulated in hepatocellular carcinoma, which is related to poor prognosis [24], moreover, THUMPD3-AS1 depletion resulted in a decline in cell proliferation and migration in hepatocellular carcinoma [9]. In non-small cell lung cancer, THUMPD3-AS1 is upregulated and promotes tumor progression via promoting cell proliferation and self-renewal [25]. Our research disclosed that THUMPD3-AS1 was elevated in ovarian cancer cells. Successively, silencing of THUMPD3-AS1 accelerated cell apoptosis and repressed viability of ovarian cancer cells, validated by loss-of-function assays. Our research indicates that THUMPD3-AS1 can play an oncogenic role in ovarian cancer.

LncRNAs may modulate mRNA expressions to participate in cancer development through competitively binding with miRNAs [26]. THUMPD3-AS1 is able to affect proliferation, migration and invasion through miR-1252-3p and C-X-C motif chemokine ligand 17 (CXCL17) in gastric cancer [27]. Besides, THUMPD3-AS1 regulates the miR-218-5p/Src kinase-associated phosphoprotein 1 (SKAP1) axis to promote cell growth and aggressiveness in colorectal cancer [7]. Subsequently, we explored latent regulatory mechanisms of THUMPD3-AS1 in ovarian cancer. In many types of tumors, MiR-320d plays a tumor suppressive role. Overexpression of miR-320d leads to apoptosis and restrains growth, migration and invasion in glioma [28]. In patients with epithelial ovarian cancer, miR-320d level in plasma exosomes is downregulated, which is associated with lymph node metastasis and tumor stage [13]. Consistently, we disclosed that miR-320d was downregulated in ovarian cancer cells. Our research verified that miR-320d is bound to THUMPD3-AS1 in ovarian cancer cells. Furthermore, rescue assays were performed to uncover that THUMPD3-AS1 restrained apoptosis via miR-320d in ovarian cancer.

MiR-320d is considered to be a tumor suppressor in many types of cancer. For instance, miR-320d directly targeted forkhead box M1 (FoxM1) to prevent gastric adenocarcinoma development [12]. MiR‑320d downregulation led to overexpression of cyclin-dependent kinase 6 (CDK6), promoting cell proliferation in diffuse large B‑cell lymphoma [29]. In pancreatic cancer, ARF1 is verified to participate in the modulation of apoptosis [30], meanwhile, it modulates proliferation and migration in cervical cancer [31]. ARF1 expression increases in ovarian cancer cells (OVCAR3 and SKOV3) and tissues, moreover, ARF1 overexpression reversed the suppressed migration, invasion and proliferation elicited by miR-744-5p [20]. Consistently, our study found that ARF1 was elevated in ovarian cancer cells (SKOV3, OVCAR3, CAVO3, HEY and A2780). Moreover, we verified ARF1 was a target gene of miR-320d. Importantly, ARF1 overexpression antagonized the accelerated cell apoptosis caused by miR-320d. Therefore, this study demonstrated that via the downregulation of ARF1, miR-320d promoted ovarian cancer cell apoptosis.

Upregulated level of THUMPD3-AS1 restrained apoptosis of ovarian cancer cells. As well, this study ascertained that THUMPD3-AS1 modulated ovarian cancer cell apoptosis via targeting miR-320d/ARF1. The findings provided a chance to increase our understanding of the mechanism of THUMPD3-AS1 in ovarian cancer development, our study manifested that THUMPD3-AS1 might function as one of the promising targets for treating ovarian cancer. The present research might be helpful to provide proof for investigating novel strategies for the improvement of ovarian cancer. On the other hand, this research includes several limitations. First, the role and functional mechanism of THUMPD3-AS1 in ovarian cancer progression has not been validated in vivo xenograft experiments. Additionally, the potential prognostic and diagnostic values of THUMPD3-AS1 in ovarian cancer patients should be further investigated.

ADP-ribosylation factor 1 (ARF1); competing endogenous RNA (ceRNA); C-X-C motif chemokine ligand 17 (CXCL17); cyclin-dependent kinase 6 (CDK6) forkhead box M1 (FoxM1); long noncoding RNA (lncRNA); microRNA (miRNA); Src kinase-associated phosphoprotein 1 (SKAP1).

Authors' contributions

Qingling Mu designed the research. Xin Wang performed the research. Kui Huang analyzed the data; Baoguo Xia wrote the paper. Shuna Bi supervised the study. Yujie Kong had primary responsibility for the final content. All authors read and approved the final manuscript.

Conflict

The authors declare that there are no competing interests.

Funding

None

Availability of data and materials

Data sharing not applicable to this article as no datasets were generated or analysed during the current study.

Jiang Y, Wang C, Zhou S: Targeting tumor microenvironment in ovarian cancer: Premise and promise. Biochim Biophys Acta Rev Cancer 2020, 1873:188361.
Yang C, Xia BR, Zhang ZC, Zhang YJ, Lou G, Jin WL: Immunotherapy for Ovarian Cancer: Adjuvant, Combination, and Neoadjuvant. Front Immunol 2020, 11:577869.
Guo C, Song C, Zhang J, Gao Y, Qi Y, Zhao Z, Yuan C: Revisiting chemoresistance in ovarian cancer: Mechanism, biomarkers, and precision medicine. Genes Dis 2022, 9:668-681.
Salamini-Montemurri M, Lamas-Maceiras M, Barreiro-Alonso A, Vizoso-Vazquez A, Rodriguez-Belmonte E, Quindos-Varela M, Cerdan ME: The Challenges and Opportunities of LncRNAs in Ovarian Cancer Research and Clinical Use. Cancers (Basel) 2020, 12.
Bhan A, Soleimani M, Mandal SS: Long Noncoding RNA and Cancer: A New Paradigm. Cancer Res 2017, 77:3965-3981.
Wang JY, Lu AQ, Chen LJ: LncRNAs in ovarian cancer. Clin Chim Acta 2019, 490:17-27.
Pu Y, Wei J, Wu Y, Zhao K, Wu Y, Wu S, Yang X, Xing C: THUMPD3-AS1 facilitates cell growth and aggressiveness by the miR-218-5p/SKAP1 axis in colorectal cancer. Cell Biochem Biophys 2022, 80:483-494.
Liu M, Chen MY, Huang JM, Liu Q, Wang L, Liu R, Yang N, Huang WH, Zhang W: LncRNA weighted gene co-expression network analysis reveals novel biomarkers related to prostate cancer metastasis. BMC Med Genomics 2022, 15:256.
Lee YE, Lee J, Lee YS, Jang JJ, Woo H, Choi HI, Chai YG, Kim TK, Kim T, Kim LK, Choi SS: Identification and Functional Characterization of Two Noncoding RNAs Transcribed from Putative Active Enhancers in Hepatocellular Carcinoma. Mol Cells 2021, 44:658-669.
He B, Zhao Z, Cai Q, Zhang Y, Zhang P, Shi S, Xie H, Peng X, Yin W, Tao Y, Wang X: miRNA-based biomarkers, therapies, and resistance in Cancer. Int J Biol Sci 2020, 16:2628-2647.
Yufeng Z, Ming Q, Dandan W: MiR-320d Inhibits Progression of EGFR-Positive Colorectal Cancer by Targeting TUSC3. Front Genet 2021, 12:738559.
Chen X, Gao S, Zhao Z, Liang G, Kong J, Feng X: MicroRNA-320d regulates tumor growth and invasion by promoting FoxM1 and predicts poor outcome in gastric cardiac adenocarcinoma. Cell Biosci 2020, 10:80.
Wang S, Song X, Wang K, Zheng B, Lin Q, Yu M, Xie L, Chen L, Song X: Plasma exosomal miR-320d, miR-4479, and miR-6763-5p as diagnostic biomarkers in epithelial ovarian cancer. Front Oncol 2022, 12:986343.
Liu YY, Zhao RF, Liu C, Zhou J, Yang L, Li L: MiR-320b and miR-320d as Biomarkers to Predict and Participate in the Formation of Platinum Resistance in Ovarian Cancer Patients. Front Oncol 2022, 12:881496.
Ali Syeda Z, Langden SSS, Munkhzul C, Lee M, Song SJ: Regulatory Mechanism of MicroRNA Expression in Cancer. Int J Mol Sci 2020, 21.
Prieto-Dominguez N, Parnell C, Teng Y: Drugging the Small GTPase Pathways in Cancer Treatment: Promises and Challenges. Cells 2019, 8.
Haines E, Schlienger S, Claing A: The small GTPase ADP-Ribosylation Factor 1 mediates the sensitivity of triple negative breast cancer cells to EGFR tyrosine kinase inhibitors. Cancer Biol Ther 2015, 16:1535-1547.
Lang L, Shay C, Zhao X, Teng Y: Combined targeting of Arf1 and Ras potentiates anticancer activity for prostate cancer therapeutics. J Exp Clin Cancer Res 2017, 36:112.
Gu G, Chen Y, Duan C, Zhou L, Chen C, Chen J, Cheng J, Shi N, Jin Y, Xi Q, Zhong J: Overexpression of ARF1 is associated with cell proliferation and migration through PI3K signal pathway in ovarian cancer. Oncol Rep 2017, 37:1511-1520.
Zhao LG, Wang J, Li J, Li QF: miR-744-5p inhibits cellular proliferation and invasion via targeting ARF1 in epithelial ovarian cancer. Kaohsiung J Med Sci 2020, 36:799-807.
Kurnit KC, Fleming GF, Lengyel E: Updates and New Options in Advanced Epithelial Ovarian Cancer Treatment. Obstet Gynecol 2021, 137:108-121.
Zhong L, Li X, Wang Y, Liu B, Ding X, Zhao Y: Long Noncoding RNAs in Ovarian Cancer-Functions and Clinical Applications. Front Biosci (Landmark Ed) 2023, 28:71.
Zhan L, Li J, Wei B: Long non-coding RNAs in ovarian cancer. J Exp Clin Cancer Res 2018, 37:120.
Zhang L, Li M, Cui Z, Chai D, Guan Y, Chen C, Wang W: Systematic analysis of the role of SLC52A2 in multiple human cancers. Cancer Cell Int 2022, 22:8.
Hu J, Chen Y, Li X, Miao H, Li R, Chen D, Wen Z: THUMPD3-AS1 Is Correlated With Non-Small Cell Lung Cancer And Regulates Self-Renewal Through miR-543 And ONECUT2. Onco Targets Ther 2019, 12:9849-9860.
Braga EA, Fridman MV, Moscovtsev AA, Filippova EA, Dmitriev AA, Kushlinskii NE: LncRNAs in Ovarian Cancer Progression, Metastasis, and Main Pathways: ceRNA and Alternative Mechanisms. Int J Mol Sci 2020, 21.
Tan Y, Liu L, Zhang X, Xue Y, Gao J, Zhao J, Chi N, Zhu Y: THUMPD3-AS1 Is Correlated with Gastric Cancer and Regulates Cell Function through miR-1252-3p and CXCL17. Crit Rev Eukaryot Gene Expr 2022, 32:69-80.
Qin CZ, Lv QL, Yang YT, Zhang JM, Zhang XJ, Zhou HH: Downregulation of MicroRNA-320d predicts poor overall survival and promotes the growth and invasive abilities in glioma. Chem Biol Drug Des 2017, 89:806-814.
Su H, Chang J, Xu M, Sun R, Wang J: CDK6 overexpression resulted from microRNA‑320d downregulation promotes cell proliferation in diffuse large B‑cell lymphoma. Oncol Rep 2019, 42:321-327.
Cheng J, Lou Y, Jiang K: Downregulation of long non-coding RNA LINC00460 inhibits the proliferation, migration and invasion, and promotes apoptosis of pancreatic cancer cells via modulation of the miR-320b/ARF1 axis. Bioengineered 2021, 12:96-107.
Xu J, Zhang J: LncRNA TP73-AS1 is a novel regulator in cervical cancer via miR-329-3p/ARF1 axis. J Cell Biochem 2020, 121:344-352.

No competing interests reported.

Download PDF

Journal Publication

published 04 Jul, 2024

Read the published version in The FASEB Journal →

Version 1

posted

You are reading this latest preprint version

THUMPD3-AS1 inhibits ovarian cancer cell apoptosis through the miR-320d/ARF1 axis

Status:

Journal Publication

Version 1

Abstract

Background

Methods

Results

Conclusion

Figures

Introduction

Materials and methods

Cell culture

Cell transfection

Cell Counting Kit-8 (CCK-8)

Flow cytometry

Terminal deoxynucleotidyl transferase dUTP nick-end labeling (TUNEL) assay

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

Western blot

Dual luciferase reporter assay

Statistical analysis

Results

THUMPD3-AS1 knockdown facilitated ovarian cancer cell apoptosis

Discussion

Abbreviations

Declarations

References

Additional Declarations

Status:

Journal Publication

Version 1