Protective effect of vitamins A, E and C on the Zinc oxide nanoparticles induced oxidative stress status in Kidney of male Wistar rats

doi:10.21203/rs.3.rs-3579982/v1

Download PDF

Research Article

Protective effect of vitamins A, E and C on the Zinc oxide nanoparticles induced oxidative stress status in Kidney of male Wistar rats

https://doi.org/10.21203/rs.3.rs-3579982/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 12 Feb, 2024

Read the published version in BioNanoScience →

You are reading this latest preprint version

Introduction:

This study aimed to evaluate the protective effects of All-trans retinoic acid, Alpha-tocopherol, and vitamin C against on ZnO-NP-induced kidney damage.

Material and methods

Fifty-four rats were divided into nine groups including Groups Con1 (deionized water), Con2 (olive oil), VitA (All-trans retinoic acid 1000IU/Kg), Group VitE (Alpha-tocopherol 100IU/Kg), VitC (Vitamin C 200 mg/Kg), ZnO (ZnO-NPs 200 mg/Kg), ZnO + VitA (All-trans retinoic acid 1000 mg/Kg + ZnO-NP 200mg/Kg), ZnO + VitE (Alpha-tocopherol 100IU/kg + ZnO-NP 200mg/Kg) and ZnO + VitC (VitaminC 200 mg/Kg + ZnO-NPs 200 mg/Kg). Expression of Catalase (CAT), Glutathione peroxidase (GPX) and Superoxide mutase (SOD) genes were evaluated by Real-time PCR. Urea, Creatinine, Total antioxidant capacity (TAC), Total oxidant status (TOS), Malondialdehyde (MDA), CAT, GPX and SOD activity were assayed by colorimetric methods.

Results

ZnO-NPs decreased TAC levels and, CAT, GPX, and SOD activity, and increased the levels of Urea, TOS, and MDA in the kidney. ZnO-NPs also caused to histopatological lesions in the tissue. Treatment with All-trans retinoic acid and Alpha-tocopherol prevented the worsening of oxidative stress and increased Urea and BUN levels. Thus, the mentioned variables in the ZnO + VitA and ZnO + VitE groups were not significantly different from those in the control groups. These vitamins improved the ZnO-NPs-induced kidney lesions.

Conclusion

Although present study revealed All-trans retinoic acid and Alpha-tocopherol partly prevent ZnO-NP-induced kidney damage, no significant difference was observed between the level of the studied variables in the groups ZnO + VitA and ZnO + VitE, and group ZnO. Therefore, it is necessary to investigate effect of these vitamins effects on ZnO-NP-induced nephrotoxicity with emphasis on other aspects such as inflammation.

ZnO nanoparticles

All-trans retinoic acid

Alpha-tocopherol and vitamin C

Kidney

Nanoparticles (NPs) are tiny particles with diameters ranging from 1 nm to 100 nm [1]. The tendency to utilize NPs have been dramatically increasing in the world since last decades [2]. These particles are present in various aspects of modern human life including industry, electronics, biology, medicine and cosmetology [3]. Despite the various applications of NPs owing to their size, shape and surface reactivity, there are major concerns about the toxicity of NPs in the health industry, and the function of the body's vital organs and cells can be disturbed by NP-induced toxicity [4, 5]. The kidneys as one of the major organs of clearance these particles, are always susceptible to NP-induced damages [6, 7].

Zinc oxide nanoparticles (ZnO-NPs) are considered as the most widely used NPs. These NPs commonly were used in various industries such as food additives and cosmetics [8, 9]. Therefore, human exposure to ZnO-NPs is increasing because of their wide application, simple and cost-effective synthesis methods [10]. Available evidence shows ZnO-NPs enter the circulation and finally into body's organs through ingestion and inhalation. ZnO-NPs accumulation is associated with some problems like as kidney damage [3]. The generation of Reactive oxygen species (ROS) and ROS-associated oxidative stress have been considered as major mechanisms which involved in ZnO-NP-induced toxicity. ZnO-NPs release Zn^+ 2 ions in the stomach when they enter through food way. Zn^+ 2 ions also enter into circulation [11]. If exposure to these nanoparticles occurs by inhalation, they enter into the cells through diffusion and endocytosis and are dissolved by lysosomes [12–14]. ZnO-NPs and released Zn^+ 2 lead to increased (ROS) production and oxidative stress through four mechanism including chemical reaction, disturbance in the mitochondria electron transport chain, induction of some redox-active enzymes such as NADPH oxidase, and interaction with some receptors which activate the signaling pathways such as Nuclear factor-κB (NF-κB) [10]. ROS-induced oxidative stress causes to oxidative modification of biomolecules and activation of inflammatory processes which finally stimulates cell death, progression of renal damage and fibrosis. These events disrupt all kidney functions, including vascular reactivity, glomerular filtration and tubular reabsorption and secretion [15, 16] and eventually lead to acute and chronic kidney injury [17].

Vitamins, as exogenous non-enzymatic antioxidants can potentiate the antioxidant defense system and protect cells against oxidative stress-induced damage. Vitamins A, C, and E belong to the most used antioxidant compounds in human populations [18]. In addition to their intrinsic antioxidant property, Alpha-tocopherol (the active form of vitamin E) and All-trans retinoic acid (the most active form of vitamin A) can induce expression of genes which are involved in antioxidant defense against oxidative stress, including Superoxide dismutase (SOD), Glutathione peroxidase (GPX) and Catalase (CAT), and reduce inflammatory cytokines such as IL-6, TNF-α, TGF-β1 [19–21]. Vitamin C structurally is an antioxidant molecule that scavenge free radicals. In addition, this vitamin recovers the active form of vitamin E which is oxidized by oxidant agents [22].

Based on the role of oxidative stress in the pathogenesis of ZnO-NP-induced kidney injury and antioxidant properties of vitamins A, C and E, the present study was designed to evaluate the effects of these vitamins on SOD, GPX and CAT expression and activity, as well as oxidative stress-related factors in ZnO-NP-induced kidney injury.

2.1. Experimental design

2.1.1. Animals

Fifty-four eight-week old male wistar rats (180–200 g) were obtained from the animals’ laboratory center of Hamadan University of Medical Sciences. The rats were housed in the animal’s laboratory for a week to adapt to animal care conditions. The rats were kept under standard laboratory conditions based on animal care protocols and had free access to drinking water and chow diet.

2.1.2. Experimental procedure and animals grouping

All-trans retinoic acid and Alpha-tocopherol (Sigma, USA) were dissolved in olive oil (Sigma, USA) and orally administered to the rats (1000 and 100 IU/Kg body weight, respectively). Vitamin C also was dissolved in deionized water and orally given to the rats, daily (200 mg/Kg body weight). Used dosages were selected based on previous studies [23, 24]. Pretreatment with vitamins began one week before the ZnO-NP treatment. The properties and electron microscope graph of ZnO-NPs (Iranian Nanomaterials Pioneers, NANOSANY, Mashhad, Iran) are shown in Table 1 and Fig. 1, respectively. ZnO-NPs were suspended in deionized water (2 g/mL). The suspension of ZnO-NPs was dispersed using a sonicator device. Before each treatment, Stock suspension was dispersed again and diluted to the desired concentration which was proportional to the dose used (200 mg/kg body weight). The prepared ZnO-NPs suspension was re-dispersed and immediately gavaged to the rats. The dosage of ZnO-NPs was determined based on a previous study [25]. Treatment with vitamins and ZnO-NPs was continued for two week. Deionized water and olive oil were separately administered to the two groups as vehicle for vitamins and ZnO-NPs. The rats were randomly divided into nine groups (six rats per group):

Group Con 1: received deionized water for three week.

Group Con 2: received olive oil for three week.

Group Vit A: received All-trans retinoic acid for three week.

Group Vit E: received Alpha-tocopherol for three week

Group Vit C: received Vitamin C for three week

Group ZnO: received ZnO-NPs for two week from the second week

Group ZnO + Vit A: received All-trans retinoic for three week and ZnO-NPs from the second week for two week

Group ZnO + Vit E: received Alpha-tocopherol for three week and ZnO-NPs from the second week for two week

Group ZnO + Vit C: received Vitamin C for three week and ZnO-NPs from the second week for two week

Table 1

Properties of zinc oxide nanoparticles
Properties	Value	Properties	Value
Particle size	10–30 nm	Content of Pb	< 9 ppm
Content of ZnO	> 99%	True density	5.606 g/cm³
Content of Cu	< 3 ppm	Specific surface area	20–60 m²/g
Content of Mn	< 5 ppm	Color	Milky, white
Content of Cd	< 9 ppm	Crystal Morphology	Nearly spherical

2.2. Preparation of 24 hour urine samples

The rats in each group were placed in metabolic cage and their urine samples were collected. Urine sample volumes were determined. The samples were centrifuged and the supernatant of each sample was aliquoted and stored at -20°C.

2.3. Preparation of plasma and tissue samples

Twenty-four hours after the last treatment, 12-h fasted rats were anesthetized with Ketamine-Xylazine (50 − 10 mg/Kg of body weight) and weighed. Then, the animals underwent on an abdominal surgery. Blood (10 mL) was collected from the vena cava of each rat and transferred to heparinized sample tube. The samples were centrifuged (3000 × g, 10 min) to prepare plasma samples. Plasma samples were aliquoted and stored at -20°C to measure biochemical variables. The kidneys were removed and weighed. The same part of each left kidney was fixed in formaldehyde 10% to evaluate histopathological changes. The other kidney was sliced and aliquoted to evaluate gene expression of antioxidant enzymes and oxidative stress-related factors. Aliquoted tissues were kept at -70°C.

2.4. Biochemical measurements

Urine sample volumes were determined. Serum and urine levels of Urea, Uric acid and Creatinine were measured using available commercial kits (Pars Azmoon, Iran) based on the manufacturer's instructions. Blood urea nitrogen (BUN) also calculate based on the data sheet of the urea measurement kit:

BUN (mg/dl) = Urea (mg/dl) × 0.467

2.5. Glomerular filtration rate (GFR) calculation

The GFR of each rat was calculated based on the plasma and urine Creatinine levels using the following formula:

$$\text{G}\text{F}\text{R}=\frac{\text{U}\text{s}\times \text{V}}{\text{P}\text{s}}$$

Where Us refers to Urine level of Creatinine (mg/dl), Ps represents Urine level of Creatinine (mg/dl) and V is Urine volume.

2.6. Preparation of kidney lysates

To measure oxidative stress-related factors, the kidney tissues were powdered in liquid nitrogen. PBS or recommended buffer of kit (300 µL) was added to the tissues. The homogenized samples were vortexed and placed in a shaker/incubator (400 rpm, 4°C, 20 min). The tubes were centrifuged (12000 × g, 4°C, 15 min). The supernatants were aliquoted and stored at 70°C. The same method was performed to prepare lysates for measurement of antioxidant enzymes, with the difference that the used buffer contained protease inhibitor (Kiazist, Iran). Bradford method was used to measure protein content of each lysate [26].

2.7. Measurement of oxidative stress-related factor

Total antioxidant capacity (TAC) was determined by FRAP method [27]. In this method, the antioxidant compounds of the samples cause color by the reducing of ferric (Fe^+ 3) to Ferrous (Fe^+ 2) in the complex Fe^+ 3-TPTZ. Total oxidant status (TOS) xylenol orange method [28]. This method is based on the oxidation of Fe^+ 2 ions to Fe^+ 3 by the oxidants compounds of the samples and the measurement of ferric by xylenol orange. TAC and TOS were reported µmol/ mg protein. Malondialdehyde (MDA) were measured by commercial kits (Kiazist, Iran) according to the manufacturer's instructions and reported as nmol/ mg protein.

2.8. Measurement of antioxidant enzymes activity

Renal levels of Superoxide dismutase (SOD) and Glutathione peroxidase (GPX) activity were assayed using commercial kits (Kiazist, Iran) according to the manufacturer's protocols. Hadwan and Abed method was used to measure Catalase (CAT) activity [29]. Briefly, the lysates were diluted with deionized water (1:100) based on pilot measurements. CAT substrate (H₂O₂, 65 µM in 60 mM sodium–potassium phosphate buffer, pH = 7.4) was added to 100 µl of diluted kidney lysate (test tube). A control tube also contained 1 mL of H2O and 100 µL of diluted kidney lysate. H₂O₂ solution (100 µL in 1mL of deionized water) was used as the standard. The tube place in water bath (37°C, 3 min). Then, CAT reaction was stopped by adding 4 ml of Ammonium molybdate (32.4 mM) and the absorption of each tube was read at 374 nm. Finally, CAT activity was calculated using the following formula:

$$CAT \text{a}\text{c}\text{t}\text{i}\text{v}\text{i}\text{t}\text{y} \left(KU\right)=\frac{2.303}{t}\times \left[Log\frac{{S}^{0}}{S-M}\right]\times \frac{Vt}{Vs}$$

Where t represents time, S⁰ is absorbance of standard tube, S refers to absorbance of test tube, M is absorbance of control test, Vt represents total volume o reagents in test tube, and Vs is volume of serum. The enzymes activity was reported as IU/mg protein.

2.9. Evaluation of gene expression by quantitative Real time-PCR

Total RNA was extracted from the kidney tissues using Kiazol reagent (Kiazist, Hamedan, Iran) following the manufacturer’ instructions. NanoDrop One UV-Vis Spectrophotometer (Thermo Fisher Scientific, Waltham, MA) and 1% gel agarose electrophoresis were employed to evaluate the quantity and quality of extracted RNAs, respectively. cDNA synthesis was done using PrimeScriptTM RT reagent cDNA synthesis kit (Takara, Japan) and q Real-time PCR was performed using a LightCycler® 96 Instrument (Roche, Germany) with Cyber Green qPCR master mix (Ampliqon, Denmark). The sequences and properties of the primers is listed in Table 2. β-Actin was used as the reference gene. Finally, the relative gene expression levels of SOD, GPX, and CAT were calculated using the 2^{(−∆∆Ct)} method [30].

Table 2

Properties of zinc oxide nanoparticles
Primer	NCBI accession number		GC%	Tm	bp
Beta-Actin	NM_031144.3	Forward: ATCAGCAAGCAGGAGTACGAT Reverse: AAAGGGTGTAAAACGCAGCTC	47.62 47.62	59	94
CAT	NM_012520.2	Forward: TGGTTAATGCGAATGGAGAG Reverse: ATAATCCGGGTCTTCCTGTG	45.00 50.00	58	116
SOD	NM_017050.1	Forward: TCAGGACAGATTACAGGATTAAC Reverse: TCATCTTGTTTCTCGTGGAC	39.13 45.00	59	281
GPX	NM_030826.4	Forward: GGGACTACACCGAAATGAATG Reverse: TCACTCGCACTTCTCAAAC	47.62 47.37	59	191
CAT: Catalase, SOD: Superoxide dismutase, GPX: Glutathione peroxidase

2.10. Histopathological evaluation

Formalin-fixed kidney tissues were embedded in paraffin and cut into 5 µm-thick tissue slides. Tissue slides were fixed on glass slides and deparaffinized using xylene. Then, the slides were hydrated by serial dilution of ethanol (90%, 80%, and 70%) and stained using hematoxylin–eosin (H&E) method. Briefly, the slides were placed in hematoxylin reagent for 5 min and washed with deionized water. Then, they were immersed in acid–alcohol reagent (5 min) and washed again. Color stabilization was performed using saturated lithium carbonate solution and the slides were placed in eosin solution (5 min). The slides were dehydrated by serial dilutions of ethanol (70%, 80%, and 90%, respectively). Finally, the slides were cleared via xylene solution [31] and evaluated by an expert pathologist.

2.11. Statistical analysis

Statistical analyses were done by GraphPad Prism 8.0.2 and SPSS 16 software. Shapiro-Wilk test was used to determine if the data follow the normal distribution pattern. The data were reported as mean ± standard deviation (SD). Kruskal-Wallis or One-way ANOVA tests, following post hoc Tukey’s test, were employed to compare statistical differences between the groups based on the Shapiro-Wilk result. p-value less than 0.05 were regarded as statistically significant.

3.1. The effects of All-trans retinoic acid, vitamin C and Alpha-tocopherol on the body weight and kidney

There were no significant differences in the initial body weight, final body weight and body weight gaining between the groups (Table 3).

Table 3

The effects of vitamins on the body weight and kidney
Groups	IBW (g)	FBW (g)	BWG/21 day (g)	BMI
Con 1	178.33 ± 5.12	280 ± 25.45	101.66 ± 25.15	0.55 ± 0.06
Con 2	182.16 ± 6.82	276.16 ± 22.38	94 ± 19.78	0.55 ± 0.04
Vit A	173.83 ± 7.33	281.83 ± 36.44	108 ± 33.13	0.56 ± 0.05
Vit C	184.83 ± 7.52	266.5 ± 14.22	81.66 ± 7.33	0.55 ± 0.02
Vit E	172 ± 5.86	257.33 ± 16.02	85.33 ± 14.67	0.52 ± 0.03
ZnO	174.16 ± 6.27	275.66 ± 27.39	94 ± 19.78	0.62 ± 0.07
ZnO + Vit A	179.5 ± 4.32	272.33 ± 12.51	92.83 ± 13.39	0.58 ± 0.04
ZnO + Vit C	186 ± 7.94	264.83 ± 15.35	78.83 ± 18.55	0.54 ± 0.04
ZnO + Vit E	184.83 ± 5.84	263.66 ± 21.14	78.83 ± 25.08	0.52 ± 0.05
Con 1: received deionized water, Con 2: received olive oil, Vit A: received All-trans retinoic acid, Vit C: received vitamin C, Vit E: received Alpha-tocopherol, ZnO: received ZnO nanoparticles, ZnO + Vit A: received All-trans retinoic + ZnO nanoparticles, ZnO + Vit C: received vitamin C + ZnO nanoparticles, ZnO + Vit E: received Alpha-tocopherol + ZnO nanoparticles, IBW: Initial body weight, FBW: Final body weight, BWG/21 day: Body weight gain during 21 day, BMI: Body mass index

3.2. The effects of All-trans retinoic acid, vitamin C and Alpha-tocopherol on biochemical variables

The findings related to biochemical parameters are summarized in Table 4. Treatment with ZnO-NP significantly increased plasma levels of Urea and BUN in compared with the control groups (p < 0.05). Treatment with Alpha-tocopherol and All-trans retinoic acid in the ZnO + Vit A and ZnO + Vit E groups effectively prevented the increase in these variables, such that no significant difference was observed between this group and control groups in the plasma levels of Urea and BUN. Although, treatment with ZnO-NPs led to increase plasma levels of Uric acid and Creatinine as well as decrease GFR, the levels of these variables didn’t showed any significant difference between the studied groups. Urea and BUN levels in the Vit C + ZnO group also were significantly higher than the control groups (p < 0.05).

Table 4

The effects of vitamins on biochemical variables
Groups	Urea (mg/dl)	Uric acid (mg/dl)	Plasma Creatinine (mg/dl)	BUN (mg/dl)	GFR (ml/min)
Con 1	23 ± 2.6	1,21 ± 0.17	0.7 ± 0.04	10.74 ± 1.2	1.81 ± 0.04
Con 2	21.33 ± 3.07	1.16 ± 0.21	0.70 ± 0.05	9.96 ± 1.43	1,82 ± 0.05
Vit A	22.66 ± 2.8	1.23 ± 0.21	0,69 ± 0.048	10.58 ± 1.3	1,81 ± 0.05
Vit C	24 ± 2.68	1.28 ± 0.28	0.70 ± 0.05	11.2 ± 1.25	1.82 ± 0.03
Vit E	22.5 ± 2.88	1.21 ± 0.17	0.70 ± 0.03	10.5 ± 1.34	1.81 ± 0.04
ZnO	28.66 ± 2.65 ^af*	1.7 ± 0.14	0.81 ± 0.07	13.38 ± 1.24 ^ab*	1.89 ± 0.03
ZnO + Vit A	27.16 ± 3.31^c*	1.61 ± 0.11	0.801 ± 0.06	12.68 ± 1.5 ^c*	1.84 ± 0.06
ZnO + Vit C	28.5 ± 2.88^ab*	1.65 ± 0.32	0.805 ± 0.03	13.30 ± 1.3^ab*	1.87 ± 0.02
ZnO + Vit E	24.16 ± 3.06	1.46 ± 0.31	0.761 ± 0.08	11.28 ± 1.4	1.83 ± 0.02
Con 1: received deionized water, Con 2: received olive oil, Vit A: received All-trans retinoic acid, Vit C: received vitamin C, Vit E: received Alpha-tocopherol, ZnO: received ZnO nanoparticles, ZnO + Vit A: received All-trans retinoic + ZnO nanoparticles, ZnO + Vit C: received vitamin C + ZnO nanoparticles, ZnO + Vit E: received Alpha-tocopherol + ZnO nanoparticles, BUN: Blood urea nitrogen, GFR: Glomerular filtration rate a: significant difference with groups Con 1 and Con 2, b: significant difference with groups Vit A, Vit C and Vit E, c: significant difference with groups Con 2, f: significant difference with groups Vit A and Vit E, *= p < 0.05

3.3. The effects of All-trans retinoic acid, vitamin C and Alpha-tocopherol on the oxidative stress-related factor

Figure 2. The effects of All-trans retinoic acid, vitamin C and Alpha-tocopherol on the oxidative stress-related factor: TAC: Total antioxidant capacity, TOS: Total oxidant status, MDA: Malondialdehyde, Con 1: received deionized water, Con 2: received olive oil, Vit A: received All-trans retinoic acid, Vit C: received vitamin C, Vit E: received Alpha-tocopherol, ZnO: received ZnO nanoparticles, ZnO + Vit A: received All-trans retinoic + ZnO nanoparticles, ZnO + Vit C: received vitamin C + ZnO nanoparticles, ZnO + Vit E: received Alpha-tocopherol + ZnO nanoparticles, BUN: Blood urea nitrogen, GFR: Glomerular filtration rate

TOS, OSI and, MDA in the ZnO group also significantly were higher than the control groups (p < 0.01, p < 0.001and p < 0.01, respectively), whereas only Alpha-tocopherol prevented an increase TOS in the ZnO + Vit E group, in such a way that TOS level in this group didn’t showed any significant difference in compared with the control groups. Although, treatment with All-trans retinoic acid and Alpha-tocopherol in the ZnO + Vit A and ZnO + Vit E groups significantly decreased OSI versus the ZnO group (p < 0.001), only Alpha-tocopherol was able to return OSI to baseline level in the control groups. Treatment with All-trans retinoic acid and Alpha-tocopherol in the ZnO + Vit A and ZnO + Vit E groups also effectively returned MDA levels to its baseline levels in the control groups.

3.4. The effects of All-trans retinoic acid, vitamin C and Alpha-tocopherol on the gene expression of anti-oxidant enzymes activity

Figure 3 shows results of gene expression. ZnO-NPs significantly caused to decreased gene expression of SOD, GPX and CAT in the group ZnO versus the control groups (p < 0.01). Treatment with All-trans retinoic acid in the groups ZnO + Vit A effectively prevented to decrease gene expression of SOD, where no significant difference was observed between this group and the control groups. In addition, the expression level of GPX in the group ZnO + Vit A was significantly lower than the groups Con 2, Vit A, Vit C and Vit E (p < 0.05). Although, Alpha-tocopherol was able to recover the expression of SOD to baseline level in the control groups, the expression of these enzyme in the group ZnO + Vit E still significantly was lower than the group Con 2. Furthermore, the expression of CAT gene in all vitamin-treated groups significantly was lower than control groups (p < 0.01).

3.5. The effects of All-trans retinoic acid, vitamin C and Alpha-tocopherol on the activity of anti-oxidant enzymes

The findings of antioxidant enzymes activity are summarized in the Fig. 4. Treatment with ZnO-NPs significantly decreased renal activity of SOD, GPX and CAT in compared to the control groups (p < 0.01). No significant difference was observed in the SOD activity between the ZnO + Vit A and, ZnO + Vit E groups and the control groups. In addition, there was no significant difference between the ZnO + Vit A, ZnO + Vit C and ZnO + Vit E groups and the control groups in the renal activity of GPX, except for group ZnO + Vit A, which its GPX activity was significantly lower than

The group Vit A (p < 0.05). Furthermore, no significant difference was observed between Zno + Vit A, Zno + Vit C and Zno + Vit E groups, and control groups in the CAT activity.

3.6. The effects of All-trans retinoic acid, vitamin C and Alpha-tocopherol on ZnO-NP-induced tissue damage

Histopathological examination revealed normal microscopic architecture of the kidney tissue in controls and Vit groups. In contrast, pathological changes included a significant number of fragmented and shrunken atrophic glomeruli with increased size of the urinary space of the Bowman capsule (arrows), degeneration and coagulation necrosis of the epithelium, and detachment of urethral epithelial cells (arrowheads) were observed in ZnO-NPs-treated rats. The administration of All-trans retinoic acid reduced tissue damage by a limited reduction in the number of damaged glomeruli (arrows) and elimination of urinary tract epithelial degeneration, whereas administration of vitamin C did not significantly reduce tissue damage in the glomeruli compared to the ZnO group. However, Alpha-tocopherol showed greater protective effect against the ZnO-NPs (Fig. 5).

There is no doubt that with increasing the use of nanoparticles in modern human life, concerns about the nanoparticle-induced toxicity are also increasing [4, 5]. ZnO-NPs are widely used in food and cosmetic industries [8, 9]. Human exposure with these nanoparticles may cause to the disrupted function of organs such as kidney through induction of oxidative stress. The ability of cells to overcome oxidative stress can be evaluated from two aspects of their direct and indirect antioxidant capacity. Direct antioxidant capacity refers capacity to quench free radicals, ROS reactive nitrogen species (RNS) through donating of hydrogen or electrons to them and indirect capacity result from expression of antioxidant defense-associated genes [32]. In the present study, All-trans retinoic acid, Alpha tocopherol and vitamin C were used to improve the direct and indirect antioxidant capacity to overcome ZnO-Nps-induced oxidative stress in kidney tissue. Biochemical measurements and histopathological evaluation also were performed to examine how success the treatments prevent ZnO-Nps-induced kidney damage

The present study showed that the oral intake of ZnO-NPs caused to decrease TAC and increase TOS, MDA and OSI in the kidney tissue. Previous studies shown that ZnO-NPs treatment increased renal levels of TAC and MDA [33, 34]. As aforementioned above, ZnO-NPs induces ROS production which is included major portion of the TOS. Therefore, increased TOS level is an expected finding. A part of the antioxidant capacity of the cells is also used to neutralize ROS, that's probably why ZnO-NPs decrease TAC level. [10, 35]. Increased ROS level also leads to form lipid radicals via interaction with poly unsaturated fatty acids (PUFAs). These radicals are converted to lipid proxy radicals, which produce lipid hydroperoxides and other radicals through their integration with other PUFAs. Lipid hydroperoxides also are broken down into compounds such as MDA which is a lipid peroxidation marker [36]. The present study revealed that treatment with All-trans retinoic and Alpha-tocopherol in the ZnO + Vit A and ZnO + Vit E groups were able to recover TAC and MDA levels to baseline levels, respectively, while TOS only reduced in the ZnO + Vit E group. Therefore, it can be concluded that a part of the effects of these treatments occurs through the improvement of the direct antioxidant capacity of kidney tissue because these vitamins prevent increasing TAC level. All-trans retinoic acid and Alpha-tocopherol may trap free radicals or prevent free radicals formation by stopping radical reactions and preventing lipid peroxidation in the cell membrane [37, 38]. The findings of the present study also confirmed the role of All-trans retinoic acid and Alpha tocopherol in reducing lipid peroxidation because treatment with this vitamin prevented the increase in MDA levels induced by zinc nanoparticles. In addition, vitamin C treatment was unsuccessful in returning the levels of these variables to their baseline levels.

In line with Rahimi et al. (2022) and Yousef et al. study (2019) [34, 39], the findings of the present study also revealed that treatment with ZnO-NPs led to decrease gene expression of SOD, GPX and CAT as well as activity of these enzymes in the kidneys. Considering that antioxidant enzymes play an important role in free radical and ROS elimination [40], so decrease in the expression and activity of antioxidant enzymes can be considered as one of the possible reasons for the increased levels of TOS and MDA in the ZnO-NPs-induced oxidative stress. Yousef et al. also showed ZnO-NPs decreased peroxisome proliferator-activated receptor-gamma coactivator1-α (PGC-1α) expression. PGC-1α is a major regulator of antioxidant enzymes including SOD, GPX and CAT. Therefore, reduced PGC-1α expression possibly causes to induce oxidative stress, which is involved in kidney diseases [34, 41, 42]. Although All-trans retinoic acid and Alpha-tocopherol were able to restore SOD expression to the baseline levels, SOD activity in the group ZnO + Vit E was significantly lower than Con 2 group. Although the gene expression of GPX and CAT also showed a brief increase in the All-trans retinoic acid or Alpha tocopherol-treated groups, the expression level of these enzymes were still significantly different from the control group. Except for the effect of vitamin C on SOD activity, in almost all cases, treatment with vitamins prevented to reduce antioxidant enzymes activity. Elsayed et al. showed All-trans retinoic acid increased SOD and CAT activity in Cisplatin-induced kidney injury [43]. Kongkham et al. also reported Alpha tocpherol led to increase SOD activity in the contrast-induced nephropathy [44]. A pervious study revealed all-trans retinoic acid and Alpha tocopherol treatment caused to increase Nrf2 expression at the mRNA level in Titanium Dioxide nanoparticles (nTiO2)-Induced Oxidative Stress [45], that probably is why these treatment increased SOD expression in the ZnO + Vit A and ZnO + Vit E groups. Nrf2 is involved in expression of genes which participate in response to oxidative stress such as SOD, GPX and CAT [35]. According to the findings of present study, it apparently seems that All-trans retinoic acid, Alpha tocopherol and vitamin C exert their effects on the activity level of the antioxidant enzyme more than they effect on the enzymes expression at the mRNA level.

Histopathological evaluation disclosed treatment with ZnO-NPs induced extensive tissue lesions in kidney tissue. The present study also indicated that ZnO-NPs led to induce oxidative stress in the kidney tissue. Mounting evidence implies oxidative stress-induced lipid peroxidation impairs cell membrane properties and functions [35, 46], that is probably why ZnO-NPs induced cellular degeneration and necrosis in the group ZnO. Treatment with All-trans retinoic acid and Alpha-tocopherol partially prevented the worsening of ZnO-NP-induced lesions, which may relate to their protective effects against lipid peroxidation of cell membrane [37, 38].

In line with the findings of Yan et al. (2012) [47], the current study showed treatment with ZnO-NPs significantly increased BUN and Urea levels in the compared to the control groups. Yan et al. also reported these effects occurred in a dose dependent manner. The present findings clarified injurious effects of ZnO-NPs on oxidative stress-associated factors, antioxidant enzymes activity and tissue lesion in the kidney. Therefore, ZnO-NPs can affect kidney function. Yan et al. also showed Creatinine increases only in the treatment with high dose of ZnO-NPs (1000 mg/kg), whereas a dosage of 200 mg was used in the present study. In addition, when number of nephrons is lost because of kidney damage, the amount of plasma filtration is increased by a single nephron, which is a compensatory response [48]. Therefore, at the beginning of kidney injury, the GFR may not change or may even increase.

Based on the present findings, no significant difference was observed in the renal level of oxidative stress-associated factors or antioxidant enzymes activity between the ZnO + Vit A and ZnO + Vit E groups, and the control groups. The level of these variables in the ZnO + Vit A and ZnO + Vit E groups didn’t show significant difference with the ZnO group in the present study. Based on favorable effects of All-trans retinoic acid and Alpha-tocopherol on tissue damage induced by nanoparticles, it had better further studies design to investigate the effects of these vitamins on ZnO-NPs-induced nephrotoxicity with emphasis on the other aspects likes as inflammation in the future.

6.1. Ethical Approval

All steps of the present study were approved by the Ethics Committee in Research of Hamadan University of Medical Sciences, Hamadan, Iran (IR.UMSHA.REC.1397.650).

6.2. Funding

The present study was supported by the Research and Technology Vice-Chancellor of Hamedan University of Medical Sciences and Health Services, Hamedan, Iran (Grant number: 9710186253).

6.3. Conflict of interest

The authors declare that there isn't any conflict of interest in the present study.

Khan I, Saeed K, Khan I (2019) Nanoparticles: Properties, applications and toxicities. Arab J Chem.12(7):908-31.https://doi.org/10.1016/j.arabjc.2017.05.011
Gautam R, Yang S, Maharjan A, Jo J, Acharya M, Heo Y, et al. (2021) Prediction of skin sensitization potential of silver and zinc oxide nanoparticles through the human cell line activation test. Front Toxicol:26. https://doi.org/10.3389/ftox.2021.649666
Czyżowska A, Barbasz A (2022) A review: zinc oxide nanoparticles–friends or enemies? Int J Environ Health Res.32(4):885-901.https://doi.org/10.1080/09603123.2020.1805415
Ramakrishna D, Rao P (2011) Nanoparticles: is toxicity a concern? EJIFCC.22(4):92
Ajdary M, Moosavi MA, Rahmati M, Falahati M, Mahboubi M, Mandegary A, et al. (2018) Health concerns of various nanoparticles: A review of their in vitro and in vivo toxicity. Nanomaterials.8(9):634.https://doi.org/10.3390/nano8090634
Du B, Yu M, Zheng J (2018) Transport and interactions of nanoparticles in the kidneys. Nat Rev Mater.3(10):358-74.https://doi.org/10.1038/s41578-018-0038-3
Sengul AB, Asmatulu E (2020) Toxicity of metal and metal oxide nanoparticles: a review. Environ Chem Lett.18(5):1659-83. https://doi.org/10.1007/s10311-020-01033-6
Singh S (2019) Zinc oxide nanoparticles impacts: Cytotoxicity, genotoxicity, developmental toxicity, and neurotoxicity. Toxicol Mech Methods.29(4):300-11.https://doi.org/10.1080/15376516.2018.1553221
Ma H, Williams PL, Diamond SA (2013) Ecotoxicity of manufactured ZnO nanoparticles–a review. Environ Pollut.172:76-85
Sruthi S, Ashtami J, Mohanan P (2018) Biomedical application and hidden toxicity of Zinc oxide nanoparticles. Mater Today Chem.10:175-86.https://doi.org/10.1016/j.mtchem.2018.09.008
Khorsandi L, Heidari-Moghadam A, Jozi Z (2018) Nephrotoxic effects of low-dose zinc oxide nanoparticles in rats. J Nephropathol.7(3). https://doi.org/10.15171/jnp.2018.35
Choudhury SR, Ordaz J, Lo C-L, Damayanti NP, Zhou F, Irudayaraj J (2017) From the cover: zinc oxide nanoparticles-induced reactive oxygen species promotes multimodal cyto-and epigenetic toxicity. Toxicol Sci.156(1):261-74.https://doi.org/10.1093/toxsci/kfw252
Adamcakova-Dodd A, Stebounova LV, Kim JS, Vorrink SU, Ault AP, O’Shaughnessy PT, et al. (2014) Toxicity assessment of zinc oxide nanoparticles using sub-acute and sub-chronic murine inhalation models. Part Fibre Toxicol.11(1):1-15.https://doi.org/10.1186/1743-8977-11-15
Yin Y, Lin Q, Sun H, Chen D, Wu Q, Chen X, et al. (2012) Cytotoxic effects of ZnO hierarchical architectures on RSC96 Schwann cells. Nanoscale Res Lett.7(1):1-8.https://doi.org/10.1186/1556-276X-7-439
Ghareeb OA (2022) Defense Effect of Ganoderma lucidum Against Zinc Oxide Nanoparticles Induced Nephrotoxicity. Eurasian Medical Research Periodical.8:26-34
Ratliff BB, Abdulmahdi W, Pawar R, Wolin MS (2016) Oxidant mechanisms in renal injury and disease. Antioxid Redox Signal.25(3):119-46.https://doi.org/10.1089/ars.2016.6665
Kaushal GP, Chandrashekar K, Juncos LA (2019) Molecular interactions between reactive oxygen species and autophagy in kidney disease. Int J Mol Sci.20(15):3791.https://doi.org/10.3390/ijms20153791
Mihailovic V, Katanic Stankovic JS, Selakovic D, Rosic G (2021) An overview of the beneficial role of antioxidants in the treatment of nanoparticle-induced toxicities. Oxid Med Cell Longev.2021.https://doi.org/10.1155/2021/7244677
Moradi A, Ziamajidi N, Ghafourikhosroshahi A, Abbasalipourkabir R (2019) Effects of vitamin A and vitamin E on attenuation of titanium dioxide nanoparticles-induced toxicity in the liver of male Wistar rats. Mol Biol Rep.46(3):2919-32.https://doi.org/10.1007/s11033-019-04752-4
da Frota MLC, Da Silva EG, Behr GA, De Oliveira MR, Dal-Pizzol F, Klamt F, et al. (2006) All-trans retinoic acid induces free radical generation and modulate antioxidant enzyme activities in rat sertoli cells. Mol Cell Biochem.285(1):173-9.https://doi.org/10.1080/09603123.2020.1805415
Tucker J, Townsend D (2005) Alpha-tocopherol: roles in prevention and therapy of human disease. Biomed Pharmacother.59(7):380-7.https://doi.org/10.1016/j.biopha.2005.06.005
Sung C-C, Hsu Y-C, Chen C-C, Lin Y-F, Wu C-C (2013) Oxidative stress and nucleic acid oxidation in patients with chronic kidney disease. Oxid Med Cell Longev.2013. https://doi.org/10.1155/2013/301982
Verma RS, Mehta A, Srivastava N (2007) In vivo chlorpyrifos induced oxidative stress: attenuation by antioxidant vitamins. Pestic Biochem Physiol.88(2):191-6.https://doi.org/10.1016/j.pestbp.2006.11.002
Aly N, Kawther E-G, Mahmoud F, El-Sebae AK (2010) Protective effect of vitamin C against chlorpyrifos oxidative stress in male mice. Pestic Biochem Physiol.97(1):7-12.https://doi.org/10.1016/j.pestbp.2009.11.007
Abbasalipourkabir R, Moradi H, Zarei S, Asadi S, Salehzadeh A, Ghafourikhosroshahi A, et al. (2015) Toxicity of zinc oxide nanoparticles on adult male Wistar rats. Food Chem Toxicol.84:154-60.https://doi.org/10.1016/j.fct.2015.08.019
Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem.72(1-2):248-54.https://doi.org/10.1016/0003-2697(76)90527-3
Benzie IF, Strain J. [2] Ferric reducing/antioxidant power assay: direct measure of total antioxidant activity of biological fluids and modified version for simultaneous measurement of total antioxidant power and ascorbic acid concentration. Methods Enzymol. 299: Elsevier; 1999. p. 15-27.
Erel O (2005) A new automated colorimetric method for measuring total oxidant status. Clin Biochem.38(12):1103-11.https://doi.org/10.1016/j.clinbiochem.2005.08.008
Hadwan MH, Abed HN (2016) Data supporting the spectrophotometric method for the estimation of catalase activity. Data Brief.6:194-9.https://doi.org/10.1016/j.dib.2015.12.012
Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2− ΔΔCT method. methods.25(4):402-8.https://doi.org/10.1006/meth.2001.1262
Feldman AT, Wolfe D. Tissue processing and hematoxylin and eosin staining. Histopathology: Springer; 2014. p. 31-43.
Bajpai VK, Alam MB, Quan KT, Kwon K-R, Ju M-K, Choi H-J, et al. (2017) Antioxidant efficacy and the upregulation of Nrf2-mediated HO-1 expression by (+)-lariciresinol, a lignan isolated from Rubia philippinensis, through the activation of p38. Sci Rep.7(1):46035.https://doi.org/10.1038/srep46035
Heidai-Moghadam A, Khorsandi L, Jozi Z (2019) Curcumin attenuates nephrotoxicity induced by zinc oxide nanoparticles in rats. Environ Sci Pollut Res Int.26(1):179-87.https://doi.org/10.1007/s11356-018-3514-9
Yousef MI, Mutar TF, Kamel MAE-N (2019) Hepato-renal toxicity of oral sub-chronic exposure to aluminum oxide and/or zinc oxide nanoparticles in rats. Nanoscale Res Lett.6:336-46.https://doi.org/10.1016/j.toxrep.2019.04.003
Bahmani M, Ziamajidi N, Hashemnia M, Abbasalipourkabir R, Salehzadeh A (2020) Human umbilical cord blood mesenchymal stem cell conditioned medium (hMSC-CM) improves antioxidant status in carbon tetrachloride-induced oxidative damage in rat. Iranian journal of science and technology, transactions A: science.44(5):1327-35.https://doi.org/10.1007/s40995-020-00944-x
Grotto D, Maria LS, Valentini J, Paniz C, Schmitt G, Garcia SC, et al. (2009) Importance of the lipid peroxidation biomarkers and methodological aspects for malondialdehyde quantification. Quim Nova.32:169-74.https://doi.org/10.1590/S0100-40422009000100032
Yucel C, Erdogan Yucel E, Arslan FD, Ekmekci S, Kisa E, Ulker V, et al. (2019) All-trans retinoic acid prevents cisplatin-induced nephrotoxicity in rats. Naunyn Schmiedebergs Arch Pharmacol.392(2):159-64.https://doi.org/10.1007/s00210-018-01603-0
Galli F, Bonomini M, Bartolini D, Zatini L, Reboldi G, Marcantonini G, et al. (2022) Vitamin E (Alpha-Tocopherol) Metabolism and Nutrition in Chronic Kidney Disease. Antioxidants.11(5):989.https://doi.org/10.3390/antiox11050989
Rahimi G, Mohammad KS, Zarei M, Shokoohi M, Oskoueian E, Poorbagher MRM, et al. (2022) Zinc oxide nanoparticles synthesized using Hyssopus Officinalis L. Extract Induced oxidative stress and changes the expression of key genes involved in inflammatory and antioxidant Systems. Biol Res 55(1):1-10. https://doi.org/10.1111/and.13450
Martemucci G, Costagliola C, Mariano M, D’andrea L, Napolitano P, D’Alessandro AG (2022) Free radical properties, source and targets, antioxidant consumption and health. Oxygen.2(2):48-78.https://doi.org/10.1007/s12291-014-0446-0
Xiao L, Zhu X, Yang S, Liu F, Zhou Z, Zhan M, et al. (2014) Rap1 ameliorates renal tubular injury in diabetic nephropathy. Diabetes.63(4):1366-80.https://doi.org/10.2337/db13-1412
Yuan S, Liu X, Zhu X, Qu Z, Gong Z, Li J, et al. (2018) The role of TLR4 on PGC-1α-mediated oxidative stress in tubular cell in diabetic kidney disease. Oxid Med Cell Longev.2018. https://doi.org/10.1155/2018/6296802
Elsayed AM, Abdelghany TM, Akool E-S, Abdel-Aziz A-AH, Abdel-Bakky MS (2016) All-trans retinoic acid potentiates cisplatin-induced kidney injury in rats: impact of retinoic acid signaling pathway. Naunyn Schmiedebergs Arch Pharmacol 389(3):327-37.https://doi.org/10.1007/s00210-015-1193-3
Kongkham S, Sriwong S, Tasanarong A (2013) Protective effect of alpha tocopherol on contrast-induced nephropathy in rats. Nefrologia.33(1):116-23.https://doi.org/10.3265/Nefrologia.pre2012.Nov.11736
Afshari-Kaveh M, Abbasalipourkabir R, Nourian A, Ziamajidi N (2021) The protective effects of vitamins A and E on titanium dioxide nanoparticles (nTiO2)-induced oxidative stress in the spleen tissues of male Wistar rats. Biol Trace Elem Res.199(10):3677-87.https://doi.org/10.1007/s12011-020-02487-z
Korkmaz A, Kolankaya D (2010) Protective effect of rutin on the ischemia/reperfusion induced damage in rat kidney. J Surg Res.164(2):309-15.https://doi.org/10.1016/j.jss.2009.03.022
Yan G, Huang Y, Bu Q, Lv L, Deng P, Zhou J, et al. (2012) Zinc oxide nanoparticles cause nephrotoxicity and kidney metabolism alterations in rats. J Environ Sci Health A Tox Hazard Subst Environ Eng.47(4):577-88.https://doi.org/10.1080/10934529.2012.650576
Fattah H, Layton A, Vallon V (2019) How do kidneys adapt to a deficit or loss in nephron number? Physiology.34(3):189-97.https://doi.org/10.1152/physiol.00052.2018

No competing interests reported.

Download PDF

Journal Publication

published 12 Feb, 2024

Read the published version in BioNanoScience →

Editorial decision: Revision requested
27 Dec, 2023
Reviews received at journal
27 Nov, 2023
Reviewers agreed at journal
14 Nov, 2023
Reviewers invited by journal
14 Nov, 2023
Editor assigned by journal
14 Nov, 2023
Submission checks completed at journal
13 Nov, 2023
First submitted to journal
08 Nov, 2023

You are reading this latest preprint version

Protective effect of vitamins A, E and C on the Zinc oxide nanoparticles induced oxidative stress status in Kidney of male Wistar rats

Status:

Journal Publication

Version 1

Abstract

Introduction:

Material and methods

Results

Conclusion

Figures

1. Introduction

2. Material and methods

2.1. Experimental design

2.1.1. Animals

2.1.2. Experimental procedure and animals grouping

2.2. Preparation of 24 hour urine samples

2.3. Preparation of plasma and tissue samples

2.4. Biochemical measurements

2.5. Glomerular filtration rate (GFR) calculation

2.6. Preparation of kidney lysates

2.7. Measurement of oxidative stress-related factor

2.8. Measurement of antioxidant enzymes activity

2.9. Evaluation of gene expression by quantitative Real time-PCR

2.10. Histopathological evaluation

2.11. Statistical analysis

3. Result

3.2. The effects of All-trans retinoic acid, vitamin C and Alpha-tocopherol on biochemical variables

3.3. The effects of All-trans retinoic acid, vitamin C and Alpha-tocopherol on the oxidative stress-related factor

3.6. The effects of All-trans retinoic acid, vitamin C and Alpha-tocopherol on ZnO-NP-induced tissue damage

4. Discussion

5. Conclusion

Declarations

References

Additional Declarations

Status:

Journal Publication

Version 1