Chronic iodine intake excess damages the structure of articular cartilage and epiphyseal growth plate

doi:10.21203/rs.3.rs-3585000/v1

Download PDF

Research Article

Chronic iodine intake excess damages the structure of articular cartilage and epiphyseal growth plate

https://doi.org/10.21203/rs.3.rs-3585000/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 07 Dec, 2023

Read the published version in Biological Trace Element Research →

You are reading this latest preprint version

This study aimed to explore the influence of excess iodine on the articularcartilage and epiphyseal growth plate in rats. Wistar rats (n=200) were randomly divided into five groups with 40 rats in each: normal iodine (NI), 5-fold high iodine group (5HI), 10-fold high iodine group (10HI),50-fold high iodine group (50HI), 100-fold high iodine group (100HI). The rats were executed in 6 and 12 months. 24-hour urinary iodine concentration (UIC) was monitored by arsenic-cerium catalytic spectrophotometry. The chemiluminescence method was used to determine the thyroid function. The pathological changes in the epiphyseal plate, articular cartilage, and thickness of the epiphyseal plate were observed. The mRNA expression of Collagen II (ColII), Collagen X, matrix metalloproteinase-13 (MMP-13), and fibroblast growth factor receptor 1 in articular chondrocytes was detected by RT-PCR. 24-h UIC increased as iodine intake increased. In the 12th month, there were a significant increase in serum sTSH and a decrease in serum FT4 in HI groups, compared to the NI group. There was a decrease in the number of proliferating cells in the epiphyseal plate and an increase in the number of mast cell layers. The chondrocytes appeared disorganized and the tidal lines were disturbed or even broken. Growth plate thickness decreased with increasing iodine intake. Compared with the NI group, ColII and MMP-13 mRNA expression in chondrocytes in all HI groups significantly increased. Chronic iodine overdose increases the risk of hypothyroidism, which leads to abnormal morphology of epiphyseal growth plates and articular cartilage, increasing the risk of osteoarthritis.

iodine excess

rat

thyroid function

growth plate

articular cartilage

Iodine is one of the essential trace elements that participate in the synthesis of thyroid hormones and exert physiological effects in the form of hormones. Appropriate iodine intake is a prerequisite for maintaining normal thyroid function, brain and bone development [1]. Numerous previous studies have confirmed that apart from iodine deficiency, iodine excess can also escalate the susceptibility to thyroid ailments [2–4]. Patients with thyroid disease often present with varying degrees of abnormal bone metabolism. Clinical observations have revealed that abnormal thyroid hormone secretion in hyperthyroidism and hypothyroidism patients is associated with high conversion type and low conversion type osteoporosis, respectively [5, 6]. Even subclinical patients are susceptible to bone loss.

In addition, thyroid hormone also affects bone development. It has been reported that congenital hypothyroidism can lead to abnormal structure of the bone tissue cartilage growth plate[7]. Hypothyroidism is relatively common in childhood, leading to delayed skeletal development, growth retardation, and short stature with impaired bone maturation due to defects in endochondral ossification [5]. In hypothyroid rats, cartilage growth plate thickness, and growth plate proliferation chondrocyte ratio were found to decrease, and articular cartilage width and epiphyseal trabecular bone volume reduced significantly [8], while hypothyroid mice showed delayed bone maturation due to impaired chondrocyte maturation [9]. Therefore, thyroid function is one of the important factors affecting bone development and bone metabolism. Normal thyroid function depends mainly on iodine intake, and previous studies have shown that iodine deficiency not only causes thyroid dysfunction but also leads to delayed and smaller formation of secondary ossification centers, disorganization of the hierarchy chondrocyte regions in the epiphyseal growth plate, reduction in the number of reserve cells and the width of the proliferation zone compared to normal rats, causing skeletal development disorders [10].

So, if iodine excess is also similar to iodine deficiency, in addition to thyroid function, it can also have some effects on bone development. Therefore, we aimed to investigate the effects of long-term iodine excess on the epiphyseal growth plate and cartilage structure using an animal model of iodine excess in rats to provide a theoretical basis for exploring the mechanism of iodine-excess-induced cartilage development and metabolic abnormalities.

Experimental animal feeding and grouping

Two hundred SPF/VAF Wistar rats weighing 120–140 g (Beijing Huafukang Biotechnology Co., Ltd.), half male and half female, were selected; after one week of normal feeding and acclimatization, the rats were randomly divided into five groups according to weight: normal iodine (NI); 5-fold high iodine group (5HI); 10-fold high iodine group (10HI); 50-fold high iodine group (50HI); 100-fold high iodine group (100HI), with 40 rats in each group, 20 males and 20 females. The 5 groups of rats were fed rat food with appropriate levels of iodine (with an iodine content of 296.1µg/kg), purchased from Tianjin Huarong Animal Feed Co., Ltd. Each group of rats intervened by drinking deionized water with different concentrations of KI. The total iodine intake for the 5 groups of rats was 6.15µg/d (NI group), 30.75µg/d (5HI group), 61.5µg/d (10HI group), 307.5µg/d (50HI group), and 615µg/d (100HI group), respectively. Male and female rats were housed separately in stainless steel cages, with 3 rats per cage, and were kept in an animal room with a constant temperature and humidity. In each group, 20 rats (10 males and 10 females) were killed at month 6 and 12 of the intervention to collect tissue and blood. The animal breeding temperature was 20 ± 2 ℃, the humidity was 60 ± 20%, and the lighting time was 12 hours.

Determination of urinary iodine concentration in rats

At the 1st, 6th, and 12th months of the experiment, each group of rats was placed in a metabolic cage, and 24-h urine of rats was collected, then stored at -80 ℃. The 24-h urinary iodine concentration (UIC) was determined using arsenic-cerium catalytic spectrophotometry (WS/T 107.1—2016). All chemicals are purchased from Sinopharm Chemical Reagent Co.

The serum thyroid hormone levels in rats with different iodine intake

When the rats were fed for 6 months or 12 months, a certain amount of blood from the femoral artery of rats was retained and centrifuged to extract serum, then stored at -80 ℃. Serum FT3, FT4, and sTSH were determined by chemiluminescence method in rats. The ADVIA Centaur fully automated chemiluminescence immunoassay instrument (Siemens, GER) and supporting FT3, FT4, and sTSH reagent kits (Siemens, GER) were used for the determination.

Morphologic of the femoral articular cartilage and epiphyseal growth plate and the measurement of growth plate thickness of the femur in rats

In the 6th and 12th months of feeding, rats were euthanized by bleeding from the femoral artery, and the hind limbs were carefully dissected. The upper third of the femur was taken and fixed in 10% paraformaldehyde solution, routinely decalcified, embedded in paraffin, and cut into continuous sections with a thickness of about 5µm. Routine Hematoxylin-eosin (HE) staining (Solarbio, Beijing, CN) and observation of pathological morphological changes in the epiphyseal growth plate and articular cartilage were carried out using the Olympus FV1000 Viewer fluorescence microscope (Olympus, JPN). The thickness of the epiphyseal growth plate was measured at four points in the middle 1/3 of the inner and outer halves of the growth plate, while the vertical thickness of the growth plate was measured from the edge of the proliferative layer to the end of the hypertrophic chondrocyte layer, and the average of the measured data was the growth plate.

Determination of mRNA expression of related genes in articular cartilage tissue by Real-time quantitative polymerase chain reaction

After the rats were euthanized, the femurs were separated, and the articular cartilage of the femoral condyles and tibial plateaus on both sides was quickly scraped and placed in frozen tubes and stored in liquid nitrogen for later extraction of total mRNA from the articular cartilage. Total RNA was extracted from TRIzol Reagent (Invitrogen Life Technologies, USA), and cDNA was synthesized using a reverse transcription kit. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as the internal reference, and three replicate wells were set for each sample. Real-time quantitative polymerase chain reaction (PCR) was performed using primers (Table 1).

Table 1

Primer sequences of genes used in real-time quantitative polymerase chain reactions
Gene	Bidirectional primer sequences	Annealing temperature (℃)	Length of the product (bp)
ColII	F:5'GCGAGTCTTGCGTCTACCC3' R:5'ATTGGAGCCCTGGATGAGC3'	60	293
ColX	F:5'GGAATCGAACGGCCTCTAC3' R:5'ACATACCCACTATTGCTGCTCAC3'	60	252
FGFR1	F:5'GGCACCTGAGGCATTGTTTG3' R:5'GATACTGGGCTTGTCCATTCG3'	60	172
MMP13	F:5'GTGACCCAGCCCTATCCCT3' R:5'TAACCCTCCATAATGTCATACCC3'	60	247
GAPDH	F:5'GGAAAGCTGTGGCGTGAT3' R:5'AAGGTGGAAGAATGGGAGTT3'	60	308
ColII: Collagen II; ColX: Collagen X; MMP13: matrix metalloproteinase-13; FGFR1: fibroblast growth factor receptor 1; GAPDH: Glyceraldehyde 3-phosphate dehydrogenase;

Statistical method

Data processing was performed using SPSS 26.0 statistical software with a significance level of α = 0.05. For normally distributed data, the mean ± standard deviation (SD) was used to represent the data, an analysis of variance (ANOVA) was used for comparison between groups, and the q-test was used for pairwise comparison. Non-normal distribution data are represented by the median (interquartile range, IQR), non-normal distribution data are compared by the Kruskal-Wallis H test, and correlation analysis is performed by the rank correlation test.

24-h UIC in rats with different iodine intake

24-h UIC of rats fed for 1st, 6th, and 12th months showed that the UIC of the NI group rats was within the normal range (100 ~ 300µg/L), while as iodine intake increases, 24-h UIC increases in rats. Compared to the NI group, 24-h UIC in the HI groups was significantly increased in the 1st, 6th, and 12th months of intervention (all P < 0.001, Fig. 1). Moreover, the correlation analysis showed that there was a positive correlation between 24-h UIC and iodine intake in the 1st, 6th and 12th months of intervention (r = 0.967, P < 0.001; r = 0.947, P < 0.001; r = 0.901, P = 0.001, respectively).

The serum thyroid hormone levels in rats with different iodine intake

In the 6th month, there was no significant difference in serum FT3, FT4, and sTSH levels among each group of rats (P > 0.05). In the 12th month, no significant differences in FT3 level between the NI and HI groups (P > 0.05), but the results revealed that there were significant differences between the HI and NI groups in rats, which showed an increase in serum sTSH level and a decrease in serum FT4 level, compared to NI group (all P < 0.05, Fig. 2).

The effect of iodine intake on the structure of epiphyseal growth plates in rats

The results of HE staining in the 6th month showed that the chondrocytes in the cartilage of the epiphyseal growth plate of the NI group were regularly arranged, and the proliferating cells started to form chondrocyte columns and proliferative zones, and the cells below the proliferative zones lost their differentiation ability and started to become hypertrophic and transitioned to hypertrophic chondrocytes, and the hypertrophic chondrocytes started to calcify to form calcified zones of cartilage matrix.

In contrast, the proliferative zone of the epiphyseal growth plate in the 10HI, 50HI, and 100HI groups showed abnormalities, manifesting as shortened chondrocyte columns, reduced proliferative cells, decreased cell volume, and significantly increased gaps between chondrocyte columns, suggesting that the differentiation from reserve cells to proliferative cells in the cartilage growth plate of rats with excess iodine was impaired; the mast layer showed abnormalities, manifesting as increased levels of mast cells, mast cell storage, and poor cartilage calcification. The obvious changes in the epiphyseal growth plate of rats were observed in the 100HI group, where the proliferating cells were barely observed.

From the 6th month to the 12th month of intervention, the growth plate of the femur in the NI group showed degenerative change, showing a drastically lower number of cells and a tendency for the growth plate to close, but the columnar structure of the cells could still exist. However, in the 5HI group, we observed that the number of cells and the thickness of the growth plate decreased significantly, indicating that excessive iodine aggravated the degeneration. With the increase in iodine intake, the damage of the epiphyseal growth plate of the femur became more serious, which was manifested by the disorganization of the chondrocyte regional hierarchy and the decrease in cell number. In the 100HI group, the growth plate of the femur basically disappeared (Fig. 3).

The effect of iodine intake on the thickness of growth plates in rats

In the 6th and 12th months, the growth plate thickness of the femoral epiphysis of rats with different iodine intake was measured. The results showed that the epiphyseal growth plate thickness of rats in the 5HI, 10HI, 50HI, and 100HI groups was significantly reduced compared with the NI group in the 6th month (all P < 0.05). In the 12th month, the growth plate thickness of rats in the 50HI and 100HI groups was significantly decreased compared with that of the NI group (all P < 0.05) (Fig. 4).

The results showed that iodine intake was negatively correlated with epiphyseal growth plate thickness in the 6th and 12th months (r=-0.721, P < 0.001; r=-0.688, P < 0.001, respectively). The correlation analysis showed that epiphyseal growth plate thickness was negatively correlated with sTSH in the 6th month(r=-0.343, P < 0.05), while no correlation was found between epiphyseal growth plate thickness and sTSH in the 12th month (P > 0.05). There was no correlation between serum FT3, FT4, and epiphyseal growth plate thickness in rats in the 6th and 12th months (P > 0.05).

The effect of iodine intake on the structure of rat articular cartilage

HE staining of the articular cartilage in the NI group showed a smooth surface, clear tide lines in the femoral cartilage, and a certain level and direction of cell arrangement between layers in the 6th month of intervention. The articular cartilage of the rats in the 10HI group showed fractures, unclear tide lines, reduced volume of proliferating cells in the proliferating area, and disorganized arrangement of cells in each layer, especially the significant changes in the 100HI group.

In the 12th month of intervention, degenerative changes of cartilage were observed in the NI group. In addition, with the increase in iodine intake, cartilage damage was aggravated. Compared with the NI group, the cartilage injury in the 100HI group is more obvious, showing disorder of cell area, unclear tidal line fracture, and narrower proliferation zone width. The number and volume of cells decreased, and mast cells were stored, resulting in poor calcification (Fig. 5).

The mRNA expression of Collagen II, Collagen X, MMP-13, and FGFR1 in rat articular chondrocytes

In the 12th month of the intervention, the mRNA expression of Collagen II (ColII), Collagen X (ColX), matrix metalloproteinase-13 (MMP-13), and fibroblast growth factor receptor 1 (FGFR1) in rat articular chondrocytes was measured by RT-PCR. The results showed that the mRNA expression levels of ColII in the chondrocytes of each group were statistically different (P = 0.011), and HI groups were higher than the NI group. The mRNA expression levels of ColX of each group were statistically different (P = 0.011), and the 10HI, 50HI, and 100HI groups showed a decreasing trend compared with the NI group. Chondrocyte FGFR1 mRNA expression only in the 5HI group was higher than that in the NI group (P < 0.05). Chondrocyte MMP-13 mRNA expression in each HI group showed an increasing trend compared with the NI group (P < 0.05, Fig. 6).

This experiment constructed an iodine-excess rat model using the iodine drinking water intervention method to form rats with different levels of iodine intake. We found that the 24-h urine iodine concentration increased significantly with the increase in iodine intake. Moreover, in the 12th month of intervention, compared with the NI group, the serum sTSH level in all HI groups increased significantly, while the FT4 level decreased, indicating that rats had hypothyroidism.

The epiphyseal growth plate is the basis for longitudinal bone growth and bone formation. It was divided into three distinct zones: the resting zone, the proliferative zone, and the hypertrophic zone [11], and the hypertrophic zone promotes the formation of columnar chondrocytes while maintaining the growth plate structure [12]. Thyroid hormone deficiency can cause damage to the growth plate. Some studies [13–15] showed that thyroid hormone promotes the conversion of cells in the resting layer to cells in the proliferative layer, the proliferation of cells in the proliferative layer, and the maturation of mast cells. In the present study, in the 6th month of the intervention, the femoral growth plate proliferating cells were reduced and the thickness of the growth plate decreased in the HI groups. In the 12th month of the intervention, the damage to the growth plate also increased with the increase in iodine intake and duration. especially the disappearance of the growth plate in the 100HI group was observed. Correlation analysis showed a negative correlation between serum TSH and growth plate thickness in rats during the 6th month of intervention. Therefore, the decrease in growth plate thickness in the rats of the HI groups might be related to the increase in serum TSH levels. A study by Shaikh MA et al [16] on rats also showed a decrease in the number of growth plate cell layers and growth plate thickness during hypothyroidism. This result is supported by the study of Endo TD et al [17]. The research from Haruzo I group showed that the long bone growth was in a rapid growth stage from 6 to 12 months in rats, and the long bone growth was at relative peak stage at 12-month of age [18]. In our present study, we found that there was no correlation between epiphyseal growth plate thickness and sTSH in 12th month of the intervention. We speculate that the skeletal development in rats was at a growth peak at 12 months of age, a physiological phenomenon that may cover the effects of TSH on the epiphyseal growth plate thickness.

Articular cartilage is composed of the chondrocytes and extracellular matrix and it is difficult to repair itself after injury [19]. The results of HE-stained histological images of articular cartilage showed that excessive iodine intake caused degenerative changes in articular cartilage, which worsened with increasing iodine intake. The cartilage proliferation zone of rats in the HI groups was significantly narrowed and the number of cells was reduced. The articular surface of cartilage was uneven and even ruptured in the 100 HI group, indicating that excessive iodine can affect articular cartilage and increase the risk of osteoarticular disease. Williams GR et al. suggested that thyroid disease can adversely affect the growth and development of bone and cartilage, especially on the articular cartilage surface [20], which is consistent with our findings. A possible explanation for this result is that there are thyroid hormone receptors on cartilage. We hypothesize that chronic excess iodine intake leads to hypothyroidism, which affects the binding of thyroid hormones to their receptors in cartilage and induces abnormal changes in articular cartilage.

In general, articular chondrocytes are in a relatively quiescent state with a slow metabolism. Collagen II is the material basis for the central role in maintaining chondrocyte homeostasis [21], and its synthesis and degradation are slow [22]. In osteoarthritic cartilage caused by mild injury, chondrocytes are metabolically active and collagen II synthesis is increased, whereas in severe osteoarthritis, collagen II expression is significantly reduced. Recent studies have shown that the expression of collagen II in articular cartilage is directly related to cartilage homeostasis and joint health [23, 24]. The RT-PCR results of this study showed that collagen II mRNA expression was significantly higher in the HI groups than in the NI group. We speculated that excessive iodine intake increases collagen II expression to compensate for the lost collagen in mild arthritis [25]. In addition, collagen X is a marker of hypertrophic chondrocytes and severe osteoarthritis [26]. In our study, there was no difference in collagen X mRNA expression between each HI group and the NI group, which may be only an increased risk of mild osteoarthritis occurring with excessive iodine intake rather than causing severe arthritis. Matrix metalloproteinases (MMPs), protein hydrolases that hydrolyze the matrix within articular cartilage, play an important role in the degeneration of articular cartilage. MMP − 13 is the main metalloenzyme protein responsible for the degradation of collagen II matrix components in cartilage. Many studies have shown that the expression level of MMP-13 is increased in osteoarthritis, and the higher the expression of MMP-13, the more severe the articular cartilage damage in osteoarthritis of the knee [27, 28]. In the present study, MMP-13 mRNA expression levels were significantly increased in the HI groups compared to the NI group, suggesting enhanced degradation of the cartilage matrix by metalloproteinases, thereby increasing the risk of osteoarthritis in rats on iodine intake excess.

In addition, the fibroblast growth factor (FGF) signaling pathway plays a key role in the development of osteoarticular disease [29, 30]. Knockdown of FGFR1 in chondrocytes inhibits the degeneration of articular cartilage [31]. Meanwhile, there are multiple thyroid hormone receptors (TRα) in bone tissue, of which TRα1 binds to thyroid hormones [32], regulating the expression of the FGF receptor (FGFR1) gene in the FGF signaling system, thus exerting a regulatory effect on bone metabolism [33]. Therefore, we proposed that iodine intake excess affects thyroid hormone levels, which regulate FGFR1 transcription, leading to abnormal chondrocyte metabolism and ultimately increasing the risk of osteoarthritis. Clinical studies have also found poorer outcomes in patients with rheumatoid arthritis associated with hypothyroidism, suggesting that thyroid disease may play a regulatory role in the development and progression of arthritis. Thus, abnormal thyroid function caused by iodine intake excess can lead to abnormal morphology of articular cartilage and abnormal gene expression in articular chondrocytes, increasing the risk of osteoarthritis.

In summary, chronic iodine excess can lead to an increased risk of hypothyroidism and cause morphological and metabolic abnormalities in articular cartilage and growth plates. This reminds us that we should not only pay attention to the influence of iodine excess on thyroid function but also focus on bone health. For people with excess iodine nutrition, it is important to reduce the intake of highly iodized foods to ensure proper iodine intake to prevent the effects of excess iodine on growth plates and articular cartilage metabolism.

In conclusion, excess iodine intake causes morphological abnormalities in articular cartilage, reduced epiphyseal plate thickness, and metabolic abnormalities in gene expression in articular chondrocytes, increasing the risk of osteoarthritis. This damage becomes more obvious with increasing dose and duration of iodine intake. This suggests that the role of iodine in osteoarthritis needs to be taken into account when monitoring the nutritional status of iodine in the population.

Funding

This study was supported by the National Science Fund for Distinguished Young Scholars (Grant No.81202201) and Projects of International Cooperation and Exchanges NSFC (Grant No.81920108031).

Competing Interests

The authors declare that they have no conflict of interest. The authors have no relevant financial or non-financial interests to disclose.

Acknowledgments

The authors especially thank Tianjin Medical University and Tianjin Nankai Hospital for their contribution and support. We also thank Tianjin Key Laboratory of Environment, Nutrition and Public Health and the Center for International Cooperation and Research on Environment, Nutrition and Public Health for providing the experimental platform for this research.

Author Contribution

ZNS and YZ designed the original research idea. Animal husbandry and material preparation was done by XZ. Laboratory measurements and analysis were done by YZ and LS. The data collection was done by ML, ZXZ, XBZ, ZSW, HHM, and YS. The manuscript was drafted by YZ and LS. WQZ and ZNS reviewed the paper. All authors contributed to reviewing the paper critically and approved the final version submitted for publication.

Data Availability

The data that support the findings are available from the corresponding author upon reasonable request.

Ethics approval

This study was conducted in accordance with the Animal Research Committee of Tianjin Hospital of ITCWM Nankai Hospital (NKYY-DWLL-2021-048).

Zimmermann MB (2011) The role of iodine in human growth and development. Semin Cell Dev Biol 22(6):645-652. http://doi.org/10.1016/j.semcdb.2011.07.009
Teng W, Shan Z, Teng X, Guan H, Li Y, Teng D, Jin Y, Yu X, Fan C, Chong W, Yang F, Dai H, Yu Y, Li J, Chen Y, Zhao D, Shi X, Hu F, Mao J, Gu X, Yang R, Tong Y, Wang W, Gao T, Li C (2006) Effect of iodine intake on thyroid diseases in China. N Engl J Med 354(26):2783-2793. http://doi.org/10.1056/NEJMoa054022
Blomberg M, Feldt-Rasmussen U, Andersen KK, Kjaer SK (2012) Thyroid cancer in Denmark 1943-2008, before and after iodine supplementation. Int J Cancer 131(10):2360-2366. http://doi.org/10.1002/ijc.27497
Zimmermann MB, Boelaert K (2015) Iodine deficiency and thyroid disorders. Lancet Diabetes Endocrinol 3(4):286-295. http://doi.org/10.1016/s2213-8587(14)70225-6
Williams GR, Bassett JHD (2018) Thyroid diseases and bone health. J Endocrinol Invest 41(1):99-109. http://doi.org/10.1007/s40618-017-0753-4
Kosińska A, Syrenicz A, Kosiński B, Garanty-Bogacka B, Syrenicz M, Gromniak E (2005) Osteoporosis in thyroid diseases. Endokrynol Pol 56(2):185-193.
Gutch M, Philip R, Philip R, Toms A, Saran S, Gupta KK (2013) Skeletal manifestations of juvenile hypothyroidism and the impact of treatment on skeletal system. Indian J Endocrinol Metab 17(Suppl 1):S181-183. http://doi.org/10.4103/2230-8210.119565
Marino R, Hegde A, Barnes KM, Schrier L, Emons JA, Nilsson O, Baron J (2008) Catch-up growth after hypothyroidism is caused by delayed growth plate senescence. Endocrinology 149(4):1820-1828. http://doi.org/10.1210/en.2007-0993
Gomez GA, Aghajanian P, Pourteymoor S, Larkin D, Mohan S (2022) Differences in pathways contributing to thyroid hormone effects on postnatal cartilage calcification versus secondary ossification center development. Elife 11:e76730. http://doi.org/10.7554/eLife.76730
Ren FL, Guo X, Zhang RJ, Wang Sh J, Zuo H, Zhang ZT, Geng D, Yu Y, Su M (2007) Effects of selenium and iodine deficiency on bone, cartilage growth plate and chondrocyte differentiation in two generations of rats. Osteoarthritis Cartilage 15(10):1171-1177. http://doi.org/10.1016/j.joca.2007.03.013
Marino R (2011) Growth plate biology: new insights. Curr Opin Endocrinol Diabetes Obes 18(1):9-13. http://doi.org/10.1097/MED.0b013e3283423df9
Hall BK, Miyake T (2000) All for one and one for all: condensations and the initiation of skeletal development. Bioessays 22(2):138-147. http://doi.org/10.1002/(SICI)1521-1878(200002)22:2<138::AID-BIES5>3.0.CO;2-4
Wang L, Shao YY, Ballock RT (2010) Thyroid hormone-mediated growth and differentiation of growth plate chondrocytes involves IGF-1 modulation of beta-catenin signaling. J Bone Miner Res 25(5):1138-1146. http://doi.org/10.1002/jbmr.5
Robson H, Siebler T, Stevens DA, Shalet SM, Williams GR (2000) Thyroid hormone acts directly on growth plate chondrocytes to promote hypertrophic differentiation and inhibit clonal expansion and cell proliferation. Endocrinology 141(10):3887-3897. http://doi.org/10.1210/endo.141.10.7733
Stevens DA, Hasserjian RP, Robson H, Siebler T, Shalet SM, Williams GR (2000) Thyroid hormones regulate hypertrophic chondrocyte differentiation and expression of parathyroid hormone-related peptide and its receptor during endochondral bone formation. J Bone Miner Res 15(12):2431-2442. http://doi.org/10.1359/jbmr.2000.15.12.2431
Shaikh MA, Naeem Z, Alshahat AA, Shaikh FA, Arif S (2013) Growth plate changes associated with Hypothyroidism amongst the pre and postnatal rats. Int J Health Sci (Qassim) 7(1):31-43. http://doi.org/10.12816/0006018
Endo T, Kobayashi T (2013) Excess TSH causes abnormal skeletal development in young mice with hypothyroidism via suppressive effects on the growth plate. Am J Physiol Endocrinol Metab 305(5):E660-666. http://doi.org/10.1152/ajpendo.00067.2013
Iida H, Fukuda S (2002) Age-related changes in bone mineral density, cross-sectional area and strength at different skeletal sites in male rats. J Vet Med Sci 64(1):29-34. http://doi.org/10.1292/jvms.64.29
Takahata Y, Hagino H, Kimura A, Urushizaki M, Yamamoto S, Wakamori K, Murakami T, Hata K, Nishimura R (2022) Regulatory Mechanisms of Prg4 and Gdf5 Expression in Articular Cartilage and Functions in Osteoarthritis. Int J Mol Sci 23(9). http://doi.org/10.3390/ijms23094672
Williams GR (2013) Thyroid hormone actions in cartilage and bone. Eur Thyroid J 2(1):3-13. http://doi.org/10.1159/000345548
Tiku ML, Madhan B (2016) Preserving the longevity of long-lived type II collagen and its implication for cartilage therapeutics. Ageing Res Rev 28:62-71. http://doi.org/10.1016/j.arr.2016.04.011
Newman B, Wallis GA (2002) Is osteoarthritis a genetic disease? Clin Invest Med 25(4):139-149.
Bay-Jensen AC, Mobasheri A, Thudium CS, Kraus VB, Karsdal MA (2022) Blood and urine biomarkers in osteoarthritis - an update on cartilage associated type II collagen and aggrecan markers. Curr Opin Rheumatol 34(1):54-60. http://doi.org/10.1097/bor.0000000000000845
Buckwalter JA, Mankin HJ (1998) Articular cartilage: tissue design and chondrocyte-matrix interactions. Instr Course Lect 47:477-486.
von der Mark K, Kirsch T, Nerlich A, Kuss A, Weseloh G, Glückert K, Stöss H (1992) Type X collagen synthesis in human osteoarthritic cartilage. Indication of chondrocyte hypertrophy. Arthritis Rheum 35(7):806-811. http://doi.org/10.1002/art.1780350715
He Y, Manon-Jensen T, Arendt-Nielsen L, Petersen KK, Christiansen T, Samuels J, Abramson S, Karsdal MA, Attur M, Bay-Jensen AC (2019) Potential diagnostic value of a type X collagen neo-epitope biomarker for knee osteoarthritis. Osteoarthritis Cartilage 27(4):611-620. http://doi.org/10.1016/j.joca.2019.01.001
Mwale F, Yao G, Ouellet JA, Petit A, Antoniou J (2010) Effect of parathyroid hormone on type X and type II collagen expression in mesenchymal stem cells from osteoarthritic patients. Tissue Eng Part A 16(11):3449-3455. http://doi.org/10.1089/ten.TEA.2010.0091
Hu Q, Ecker M (2021) Overview of MMP-13 as a Promising Target for the Treatment of Osteoarthritis. Int J Mol Sci 22(4). http://doi.org/10.3390/ijms22041742
Guo J, QJ L (2009) Expression of MMP-13 mRNA, TGF-β1mRNA and proteins in osteoarthritis. Journal of the fourth military medical university 030(022):2626-2630.
Yan D, Chen D, Cool SM, van Wijnen AJ, Mikecz K, Murphy G, Im HJ (2011) Fibroblast growth factor receptor 1 is principally responsible for fibroblast growth factor 2-induced catabolic activities in human articular chondrocytes. Arthritis Res Ther 13(4):R130. http://doi.org/10.1186/ar3441
Vincent TL (2011) Fibroblast growth factor 2: good or bad guy in the joint? Arthritis Res Ther 13(5):127. http://doi.org/10.1186/ar3447
Weng T, Yi L, Huang J, Luo F, Wen X, Du X, Chen Q, Deng C, Chen D, Chen L (2012) Genetic inhibition of fibroblast growth factor receptor 1 in knee cartilage attenuates the degeneration of articular cartilage in adult mice. Arthritis Rheum 64(12):3982-3992. http://doi.org/10.1002/art.34645
Ornitz DM (2005) FGF signaling in the developing endochondral skeleton. Cytokine Growth Factor Rev 16(2):205-213. http://doi.org/10.1016/j.cytogfr.2005.02.003

No competing interests reported.

Download PDF

Journal Publication

published 07 Dec, 2023

Read the published version in Biological Trace Element Research →

Editorial decision: Revision requested
17 Nov, 2023
Reviews received at journal
16 Nov, 2023
Reviewers agreed at journal
10 Nov, 2023
Reviewers invited by journal
10 Nov, 2023
Editor assigned by journal
10 Nov, 2023
Submission checks completed at journal
10 Nov, 2023
First submitted to journal
09 Nov, 2023

You are reading this latest preprint version

Chronic iodine intake excess damages the structure of articular cartilage and epiphyseal growth plate

Status:

Journal Publication

Version 1

Abstract

Figures

Introduction

Materials and methods

Experimental animal feeding and grouping

Determination of urinary iodine concentration in rats

The serum thyroid hormone levels in rats with different iodine intake

Statistical method

Results

24-h UIC in rats with different iodine intake

The serum thyroid hormone levels in rats with different iodine intake

The effect of iodine intake on the structure of epiphyseal growth plates in rats

The effect of iodine intake on the thickness of growth plates in rats

The effect of iodine intake on the structure of rat articular cartilage

The mRNA expression of Collagen II, Collagen X, MMP-13, and FGFR1 in rat articular chondrocytes

Discussion

Conclusion

Declarations

References

Additional Declarations

Status:

Journal Publication

Version 1