IGFBP4 suppresses EndMT to maintain corneal endothelial cell characteristics through down-regulating WNT2 to inhibit Wnt2/β-catenin signaling pathway

doi:10.21203/rs.3.rs-3586190/v1

Download PDF

Article

IGFBP4 suppresses EndMT to maintain corneal endothelial cell characteristics through down-regulating WNT2 to inhibit Wnt2/β-catenin signaling pathway

https://doi.org/10.21203/rs.3.rs-3586190/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Objective: It is aimed to investigate the mechanism of endothelial-mesenchymal transition (EndMT), which is a significant limiting factor in the culture of corneal endothelial cells (CECs).

Methods: The primary rabbits corneal endothelial cells (RCECs) at passage 0 (P0) and passage 3 (P3) were subjected to Illumina high-throughput RNA sequencing, leading to the identification of EndMT-related genes and signaling pathways. Target genes IGFBP4 and WNT2 were selected for validation, with observation indicators including EndMT markers, α-Smooth muscle actin（α-SMA) and vimentin, tight junction protein ZO-1(ZO-1) and aquaporin-1(AQP-1), as well as molecules related to Wnt2/β-catenin signaling pathway.

Results: The results of high-throughput RNA sequencing suggest a potential association between the Wnt pathway and EndMT. Overexpression of IGFBP4 or knockdown of WNT2 in RCECs, the levels of α-SMA, vimentin, ZO-1 and AQP-1 were significantly reduced, as well as molecules related to Wnt2/β-catenin signaling pathway, such as Frizzled, Dvl, and p-β-catenin and p-TCF-4. On the contrary, when IGFBP4 is knocked down or WNT2 is overexpressed, the opposite results are obtained. Moreover, the IP experimental results provide evidence of the interaction between WNT2 and IGFBP4.

Conclusion: In the in vitro culture of RCECs, the downregulation of IGFBP4 could activate Wnt/β- catenin signaling pathway and induce the occurrence of EndMT.

Corneal endothelial cells

IGFBP4

WNT2

EndMT

corneal endothelial cells (CECs) play a crucial role in maintaining corneal transparency and are essential for the visual system [1]. They form a layer of hexagonal cells that separate the corneal stroma from the aqueous humor, actively regulating the hydration of the matrix to prevent corneal edema. In humans, CECs lose their proliferative capacity during fetal development [2]. However, after birth, the human corneal endothelial cells (HCECs) cannot regenerate. The losses experienced by HCECs due to injury, inflammation, and ophthalmic surgery can be compensated for through various mechanisms such as increasing the volume of adjacent cells, reducing cell density[3], or transforming into fibroblast-like cells[4].

Currently, the primary methods for restoring vision after endothelial decompensation are penetrating corneal transplantation or endothelial corneal transplantation. Unfortunately, the scarcity of corneal donors on a global scale has severely hindered the advancement of corneal transplantation techniques. In the field of ophthalmology research, there has been a growing interest in the engineering of corneal tissue regeneration. Recently, researchers have turned to the use of cultured CECs as a potential alternative for replacing damaged corneal endothelium. Despite being in a non-proliferative state in their natural environment, CECs possess regenerative capabilities and can be amplified in laboratory settings[5].However, the process of culturing CECs can lead to a transformation in their phenotype, causing them to adopt a fibroblast-like morphology[6]. This transformation, known as EndMT, is the primary factor that hinders the expansion of CECs in vitro. This study employed transcriptome sequencing to analyze primary and passaged CECs cultured in vitro, with the objective of identifying crucial genes associated with endothelial-mesenchymal transition (EndMT). The aim of this study was to modulate the expression of these key genes in order to mitigate the incidence and progression of EndMT, while also offering an alternative approach for cultivating seed cells in corneal endothelial regenerative medicine.

2.1 Primary cell culture

New Zealand rabbits weighing 1.5-2 kg were provided by the experimental animal center of Yunnan University (Kunming, China), and housed under specific pathogen-free conditions. All animal studies followed the ARRIVE guidelines and were conducted strictly according to the Institutional Animal Care and Use Committee guidelines ,Yunnan University(IACUC,YUC), and approved by the Committee on Animal Research and Ethics of Yunnan University.

New Zealand rabbits were used to obtain the corneal endothelium by tearing off the Descemet’s membrane and corneal endothelial layer, which were digested at 37°C for 5 to 7 minutes with 1 mg/mL collagenase I (Solarbio,China). Then RCECs were inoculated into a six hole plate coated with coating mix (Molecular Dimensions, China) and cultured with an equal volume of M199 (Vivacell, China) and Ham’s F12 (Gbico, USA), which were supplemented with 10% Fetal bovine serum (FBS) (Vivacell, China), 1X Insulin-Transferrin-Sodium Selenite Supplement (ITS) (Biological Industries, Israel) and 1% penicillin and streptomycin (Gbico,USA). Finally, the cells were put into a 37℃ incubator(Thermo, USA) containing 5% CO₂ for culture. The solution was changed every other day.

2.2 Immunofluorescence

RCECs were incubated at room temperature in a 4% PFA solution for 30 minutes and fixed with 4% paraformaldehyde for 15 minutes. Then, the samples were sealed in PBS containing 2% Triton X-100 (PBST) and 5% goat serum for 1 hour. They were incubated overnight at 4℃ with the following primary antibody: Vimentin (bs-8533R, bioss) and α-SMA (bs-10196R, bios). After that, the cells were labeled with 488 goat-anti-rabbit IgG (GB25303, Xavier) and Goat PAb to Rb IgG Alexa Fluor® Incubate 555 (Ab150078, abcam) at 37℃ for 1 hour. Finally, cells were imaged and analyzed under fluorescence microscope.

2.3 Transcriptome analysis

Transcriptome sequencing was performed on P0 and P3 RCECs, and the differential genes between them were analyzed. The results showed that there were 473 upregulated genes (log2FC > = 1&q < 0.05) and 1130 downregulated genes (log2FC<=-1&q < 0.05), in which the genes related to cell proliferation and differentiation were selected for RT-PCR validation.

2.4 RT-PCR assays

RCECs of P0 and P3 passages were collected for extraction of RNA to perform reverse transcription reaction, and then complete RT-PCR reaction using 2x Universal Blue SYBR Green RT-PCR Master Mix kit. The reaction procedure is pre-denaturation at 95℃ for 1 minute; 95℃ denaturation for 20 seconds, 55℃ annealing for 20 seconds, and 72℃ extension for 30 seconds.The primer sequence is shown in Table 1.

Table 1

Primer sequences for gene expression analysis.
Gene	Sequence(5’-3’)
Rabbit-GAPDH F	GGGCGGAGCCAAAAGG
Rabbit-GAPDH R	GGGTGGGCACACGGAA
Rabbit-Frizzled F	TGACCAAGATGCCCAACC
Rabbit-Frizzled R	GACTCTCCGGCCACGAGT
Rabbit-GSK-3β F	CTCAGGAGTGCGGGTCTT
Rabbit-GSK-3β R	CTGTGGCATTTGTAGGGG
Rabbit-β-catenin F	CGTTCTCCTCAGATGGTGT
Rabbit-β-catenin R	CGATGATGGGAAAGGTTGT
Rabbit-c-Myc F	CCTCGGACTCTCTGCTCT
Rabbit-c-Myc R	GTGGTGGCGGTGTCTCTT
Rabbit-TCF-4 F	GGTTTGCCGTCTTCAGTC
Rabbit-TCF-4 R	CCCCGCTTCCTCTATTTG
Rabbit-Dvl F	AGAAGCGGAAGTTGAAAAAG
Rabbit-Dvl R	TCATCACCTGGGGAAAGAAG

2.5 Construction of lentivirus vector

Both IGFBP4 and WNT2 interference and overexpression plasmids were purchased from HonorGene(Changsha, China). Plasmid sequences are as follows:

ocIGFBP4-sh1: GCACCCACGAGGACCTCTTCACTCGAGTGAAGAGGTCCTCGTGGGTGCTTTTTT;ocIGFBP4-sh2: GGAGCTGGACTGCCACCAACTCTCGAGAGTTGGTGGCAGTCCAGCTCCTTTTTT༛ocIGFBP4-sh3: GGTATCCTTTGGCTTGGTTTCCTCGAGGAAACCAAGCCAAAGGATACCTTTTTT; ocWNT2-sh1: GCAGTGATAACATTGACTATGCTCGAGCATAGTCAATGTTATCACTGCTTTTTT; ocWNT2-sh2: GGAAGGCTGTAAAGCGGTTCTCTCGAGAGAACCGCTTTACAGCCTTCCTTTTTT; ocWNT2-sh3: GCTGTTCCCTCCATGTAAAGACTCGAGTCTTTACATGGAGGGAACAGCTTTTTT. The NCBI Sequence of pCDH-ocIGFBP4-flag NCBI is XM_002719357. The NCBI Sequence of pCDH-ocWNT2-flag is NM_001171042.

2.6 Construction of stable transgenic cell Lines

2 ul extracted plasmid was added to 100 ul competent E.coli cells, a single colony of which was cultured in 20 ml of liquid culture medium on a shaker at 37℃ overnight at a speed of 200 r/min. The plasmid was extracted to screen the optimal interfering vector by RT-PCR, and the vector packaging was obtained by transfection of 293T cells. After 48 hours of transfection, supernatants were collected from cell cultures and centrifuged at 500 g for 10 min to remove cell debris and nuclei. Lentivirus stock solution was collected, concentrated by ultracentrifugation, and virus titers were determined.Finally, Endothelial cells were transfected with Lipofectamine® 2000 transfection reagent (Invitrogen, USA) according to the manufacturers recommendations. Finally, primary cultures of RCECs were transfected with concentrated virus.

2.7 Westen blotting(WB)

RIPA lysis buffer was used to extract the total protein from the cells. Then, the protein lysates were separated on an SDS PAGE. Upon resolution, PVDF membranes were used to transfer the proteins and were then blocked in 5% non-fat milk TBST buffer for 2 hours at room temperature. After that, the membranes were incubated at 4℃ overnight with the following primary antibodies: IGFBP4(BA2163-1, Boster Biological), WNT2(sc-514382,

Santa), Frizzled(DF13439, Affinity),α-SMA(bs10196R, Bioss), β-catenin(AF6266, Affinity), p-β-catenin(ab75777, abcam), TCF-4(DF6275, Affinity), GSK-3β(AF7814, Affinity), Dvl(SAB2100527, SAB) and β-actin(66009-1-Ig, Proteintech). Protein bands were visualized using an enhanced chemiluminescence system and imaged using a gel imaging system.

2.8 Immunohistochemistry (IHC)

The cells were clearly fixed by 4% paraformald, and the antigen was repaired by boiling in citric acid buffer for 3 minutes. Then, they were incubated in 3% H₂O₂ at room temperature for 20 minutes, sealed at 37℃ for 30 minutes by 5% bovine serum albumin V, and incubated overnight in 4℃ refrigerator. After that, they were incubated at 37℃ for 20 minutes with secondary antibodies, and then stained by DAB and hematoxylin. Finally, microscopic observation was conducted. Five visual fields were selected randomly for taking pictures to calculate the positive rate.

2.9 Immunoprecipitation(IP)

RIPA lysis buffer was used to extract the total protein from the rabbit corneal endothelium, 1 µg WNT2 antibody and 10–50 µl protein G-beads were added in the total protein to complete immunoprecipitation reaction. Protein G-beads were washed with 1ml lysis buffer for three times after centrifugation and denaturated by boiling for ten minutes. Finally, SDS-PAGE electrophoresis was performed.

2.10 Statistical analysis

Statistical analysis was performed with GraphPad Prism 6.0 software (GraphPad, La Jolla, CA, USA) and the SPSS 26.0 computer program (SPSS Inc., Chicago, IL, USA). The experimental data are presented in the form of mean ± standard error (Mean ± SEM). Comparisons of other parameters were made among the groups using one-way analysis of variance. The unpaired two-tailed student test was adopted to compare two groups. Differences were considered significant at P < 0.05,

3.1 RCECs are prone to undergo EndMT during in vitro culture

The use of M-199/F12 culture medium can effectively maintain the growth status and proliferation of primary RCECs. The primary RCECs grow rapidly and are arranged tightly in a hexagonal structure. After passage, the proliferation of cells slows down and their volume gradually increases, appearing polygonal or irregular in shape, and exhibiting mesenchymal cell characteristics, as shown in Fig. 1A.

CECs originate from neural crest, so neural specific enolase (NSE) staining is positive. In this study, the NSE positive rate of P0 and P3 generations of RCECs cultured in vitro is above 90%. Aquaporin 1 (AQP-1) is the basis of the pumping function of CECs to maintain corneal transparency, and are considered to be the functional protein of CECs. The P0 and P3 generations of cultured RCECs in this study were able to maintain AQP-1 positivity rates above 70–80%, as shown in Fig. 1B.

In the process of RCECs culture, there are more and more large volume cells, and the cell shape becomes increasingly irregular after generations. Immunofluorescence staining of α-SMA and vimentin, markers of the EndMT, were performed and the results showed that α- SMA positive cells and vimentin positive cells in P3 generation significantly increased compared to that of P0 generation, indicating that P3 generation cells undergo EndMT, as shown in Fig. 1C-F.

3.2 Transcriptome sequencing of RCECs of P0 and P3 generation

To further study the difference between P0 and P3 generation RCECs, we conducted mRNA transcriptome sequencing on them, and the differential genes are presented in the form of volcanic maps, as shown in Fig. 2A. At the same time, differential gene clustering heatmap analysis was performed on differentially expressed genes in the form shown in Fig. 2B, GO enrichment analysis was performed on differentially expressed genes in the form of a GO enrichment classification bar chart in Fig. 2C. The basic unit for KEGG analysis on differences was the pathway, and KEGG enrichment bubble chart was presented in Fig. 2D.

The differential genes are mainly enriched in key signal pathways such as cancer pathway signaling pathway, microprotein signaling pathway in cancer, axon guidance signaling pathway and cellular senescence signaling pathway, indicating that with the increase in the number of generations, cellular senescence may be accompanied with decreased cell activity, which may lead to various changes in cell function. Therefore, we focus on the differential genes MCM5, PLK1, BUB1, LMNB1, FMNL3, IGFBP4, WNT2, BMP6 and IL1A related to cell proliferation for research, the expression results expressed as log2(fold change) of which were showed in bar chart in Fig. 2E. The RT-PCR results (Fig. 2F) showed that all the above genes were in line with the expectant trend. Considering that IGFBP4 can serve as an antagonist of WNT and regulate WNT/β-Catenin pathway, and WNT/ β-Catenin pathway is closely related to EndMT, we chose IGFBP4 and WNT2 as our research subjects in the following study.

3.3 Construction of stable transgenic cells of IGFBP4 and WNT2 overexpression and interference in P3 generation

Firstly, we validated the protein expression levels of IGFBP4 and WNT2 in P0 and P3 RCECs using WB experiments (Fig. 3A), the results of which were consistent with RT-PCR results (Figs. 3B and 3C). The expression of IGFBP4 in P3 generation cells was significantly reduced compared to that of P0 generation cells, while the expression of WNT2 was increased in P3 generation cells compared to that of P0 generation cells. To further verify the effects of IGFBP4 and WNT2 on the function of P3 generation cells, we transfected lentivirus vectors to RCECs and constructed IGFBP4 and WNT2 overexpressing and interfering stable transfection cells. The results of WB showed that the optimal interference sequences for IGFBP4 and WNT2 were sh-IGFBP4-003 and sh-WNT2-002 (Figs. 3D, 3E, 3H, and 3I). The overexpression vector was also successfully constructed (Fig. 3F, 3G, 3J, and 3K).

3.4 IGFBP4 suppresses Wnt/β-Catenin pathway and restrains EndMT in RCECs

To investigate the effect of IGFBP4 on RCECs functional protein, we detected the expression levels of markers related to EndMT, such as α-SMA and vimentin after IGFBP4 overexpression and downexpression. The results showed that the expression of α-SMA and vimentin in RCECs decreased when IGFBP4 was overexpressed, and increased when IGFBP4 was downexpressed (Fig. 4A-D). Next, we also tested the expression levels of ZO-1 and AQP-1. As a tight junction protein, ZO-1 plays an important role in the junctions between CECs. AQP-1 is a kind of water regulatory protein in CECs, which has the function of promoting transmembrane water transport and cell migration. The expression of ZO-1 and AQP-1 in RCECs raised after IGFBP4 overexpression, and declined after IGFBP4 downexpression (Fig. 4E-H).

In addition, RT-PCR and WB were applied to evaluate the expression of IGFBP4, Wnt2, Frizzled, Dvl, GSK-3β, β-catenin and TCF-4. When IGFBP4 was downexpressed, the expression of Wnt2, Frizzled, Dvl, GSK-3β, β-catenin and TCF-4 were increased. When IGFBP4 was overexpressed, the expression of them were decreased; Meanwhile, GSK-3β expression showed an opposite changes (Fig. 4I-K).

All of above results indicate that IGFBP4 suppresses EndMT to maintain CECs characteristics through inhibiting WNT2/β-catenin signaling pathway in RCECs.

3.5 WNT2 activates WNT/β-catenin pathway and promotes EndMT in RCECs

To investigate the effects of WNT2 on RCECs functional protein, α-SMA and vimentin were tested after WNT2 overexpression and interference. The α-SMA and vimentin expression in RCECs increased when WNT2 was overexpressed, and decreased when WNT2 was downexpressed (Fig. 5A-D). As far as the functional protein was concerned, the expression of ZO-1 and AQP-1 in RCECs declined after WNT2 overexpression, and raised after WNT2 downexpression (Fig. 5E-H).

Besides, RT-PCR and WB were also applied to evaluate the expression of IGFBP4, Wnt2, Frizzled, Dvl, GSK-3β, β-catenin and TCF-4. Compared to the control group, the expression of them were increased in OE-WNT2 group, and decreased in sh-WNT2 group. Correspondingly, GSK-3β expression showed an opposite changes (Fig. 5I-K). The above results indicate that WNT2 induces EndMT through activating WNT2/β-catenin signaling pathway in RCECs. In additon, the results also showed that IGFBP4 can positively regulate the expression of WNT2 (Fig. 5L-M).

To verify the regulatory effect between IGFBP4 and WNT2, immunoprecipitation was also used, and the results showed that there was direct interaction between them. All in all, we can draw a conclusion that IGFBP4 is an inhibitor of WNT2.

The cornea is the outermost layer of transparent and vascular free tissue of the eye, and its transparency determines the quality of vision and ultimately the quality of life[7]. Corneal endothelial cell dysfunction is one of the main factors leading to corneal blindness[8]. So far, the only way to restore vision after endothelial decompensation is penetrating corneal transplantation and corneal endothelial transplantation. However, the current global shortage of corneal donors is greatly limited the development of corneal transplantation technology. As a result, corneal tissue regeneration engineering has become a hot topic in the field of ophthalmic research. In recent years, researchers have shifted to using cultured CECs as an alternative replacer of corneal endothelium. Although CECs are in a non proliferative state in vivo, they still have regenerative ability and can be amplified in vitro[5]. However, cell culture of CECs in vitro can lead to phenotype transformation, transforming its morphology from endothelial cells to fibroblasts, and resulting in EndMT. EndMT is the main factor that restricts the expansion of corneal endothelial cells in vitro. In this study, transcriptome sequencing was performed on primary and passaged RCECs cultured in vitro to find the key genes that lead to EndMT in the process of CECs culture in vitro. It is expected to reduce the occurrence and [9]development of EndMT by changing the expression of key genes, and provide an alternative seed cell culture method for corneal endothelial regenerative medicine.

EndMT is a complex biological process that produces cells with multiple potentials. Recent reports have emphasized the potential of EndMT in tissue engineering and regeneration applications by regulating the differentiation status of cells. EndMT refers to the transformation of endothelial cell morphology to mesenchymal cell morphology, accompanied by a decrease in endothelial function and an enhancement of mesenchymal function[10]. EndMT is characterized by the key events including the decomposition of cell junction, the loss of top base polarity, the reorganization of actin cytoskeleton, the change of cell shape, the increase of cell mobility, the increase of extracellular viral matrix protein production and the change of gene expression[11]. During the EndMT process, endothelial cells lose their typical phenotype to obtain mesenchymal features[6], characterized by the development of invasion and migration abilities, as well as the expression of typical mesenchymal products, such as α-smooth muscle actin and collagen I[6]. EndMT has greatly limited the development of corneal endothelial regenerative medicine. Therefore, researchers continue to study the mechanism of EndMT and try to find solutions.

Transforming growth factor β(TGF-β) signaling pathway is currently a widely studied pathway related to EndMT[12], and the Notch signaling pathway has also been found to be involved in EndMT[13, 14]. Li found that EndMT induced by TGF-β can be completely be blocked by the notch signaling pathway inhibitor DAPT, when culturing rat CECs in vitro[15]. However, EndMT is an extremely complex process that is not dominated by a single signal pathway, but rather involves the interaction and influence of various signal pathways. Many studies have also found that Wnt/β-catenin signaling pathway is also involved in EndMT. Tseng[16]proved that the mitosis arrest of HCEC monolayer was caused by the selective activation of classical Wnt signals, and EDTA bFGF caused β-Nuclear translocation. Bisides, Huang et al[17] found that the Wnt inhibitor XAV939 eliminated BrdU labeling, cytoplasmic and nuclear staining of a-SMA in the cytoplasm, while retaining the binding staining of N-cadherin, ZO-1 and Na⁺/K⁺ATPase. The above findings indicate that the typical Wnt signaling pathway is involved in EndMT.

In this study, the result of transcriptome sequencing found that the expression of IGFBP4 was significantly down regulated and the expression of WNT2 was significantly up regulated in P3 generation RCECs, which were double verificated by RT-PCR and WB. The enrichment analysis of KEGG pathway revealed that the Wnt signaling pathway may be involved in the EndMT process of RCECs. Recently, there have been reports that IGFBP4 is a typical inhibitor of Wnt signaling during cardiac development[18]. Due to IGFBP4 being secreted and inhibiting the binding of Wnt3A to Frz8 and LRP6, the Wnt/β-catenin signaling pathway is regulated by IGFBP4. In most cancers, Wnt/β-catenin signaling pathway is inactivated by Wnt antagonists, while IGFBP4 is the antagonists of the catenin signaling pathway[19, 20]. Therefore, we speculate that IGFBP4 may be involved in the EndMT process of CECs.

So, our research observed EndMT markers (ɑ-SMA and vimentin), checked functional proteins(ZO-1 and AQP-1), and detected mRNA and proteins related to Wnt/β-catenin signaling pathway by RT-PCR and WB in passaged RCECs by knocking down and overexpressing IGFBP4 and WNT2 genes. The results found that when IGFBP4 was knocked down or WNT2 was overexpressed, the expression of EndMT markers increased, while the expression of functional proteins decreased and Wnt/β-catenin signaling pathway was activated. By contrast, when IGFBP4 was overexpressed or WNT2 was knocked down, the outcome were opposite to above results. At the same time, immunoprecipitation experiments have demonstrated the interaction between WNT2 and IGFBP4. All of above results showed that IGFBP4 suppresses EndMT of RCECs and maintains the morphology and function of it though inhibiting Wnt to inactivate WNT2/β-catenin signaling pathway.

IGFBP4, namely Insulin-like growth factor-binding protein 4, is a secreted protein that is expressed in a variety of normal tissues, but is low expressed in most tumors[21], such as colorectal cancer, lung cancer[22, 23] and breast cancer [24]. IGFBP4 can affect cell growth by regulating the Insulin-like growth factor system (IGFs) signaling system and other signaling systems[25]. IGFBP4 can also regulate other different signaling pathways independently of the IGFs signaling system[18], affecting cell growth, migration, and apoptosis, but its mechanism is still unclear and has become a hot research topic. Studies have found that IGFBP4 can competitively bind to the Wnt receptor Frizzled8 (Frz8), inhibiting the binding activity of Wnt with its receptor, thereby inactivating the classical Wnt/β-catenin signaling pathway[18].

Wnt/β-catenin signaling pathway regulates cell proliferation, survival, behavior, and fate in embryos and adults[26].β-catenin is the downstream effector of the catenin pathway, and can be inhibited by glycogen synthase kinase 3β(GSK-3β) though β-catenin phosphorylation[27]. Numerous studies have shown that activation of the Wnt/β-catenin signaling pathway can induce EndMT[9, 19, 28–31]. Wnt/β-catenin pathway is also involved in and regulates the EndMT process of CECs. Okumura and his colleague[32] found that spindin1 induced a significant increase in CECs density in rabbit and human corneal tissues, promoting the nuclear input of β-catenin, followed by upregulation of cyclin D and downregulation of p27, leading to G1/S progression; Besides, Wnt/β-catenin pathway plays a crucial role in maintaining corneal endothelial homeostasis. Zhu[16]found that the EndMT of HCECs is mediated by the activation of classical Wnt signals during the proliferative phase, but by the activation of classical TGF signals during the irreversible non proliferative phase. Liu[26]found that the microenvironment of human amniotic epithelial cells can promote the proliferation of HCECs, which may be related to Wnt/β-catenin pathway regulates telomerase activity and epithelial mesenchymal transition (EMT). Hirata[33]have shown that sustained expression of G protein coupled receptor 5 (LGR5) rich in leucine repeat sequences can maintain endothelial cell phenotype and inhibit EndMT through the Wnt pathway. In our study, we found that in primary RCECs, Wnt/β-catenin pathway is in an inactive or extremely low activity state, with low expression levels of Wnt2, Frizzled receptor, and Disheveled (Dvl), and the mRNA and protein expression levels of P-β-catenin and P-TCF4 are very low. When RCECs are passaged, Wnt/β-catenin pathway is activated, and the expression levels of Wnt2, Frizzled receptor, and Disheveled (Dvl) are significantly increased, the phosphorylation levels of β-catenin and TCF4 increase, the deformation volume of RCECs increases, tight junction proteins and aquaporins decrease, and EndMT markers ɑ-SMA and vimentin are expressed. All of above indicate that after RCECs passage, the corneal endothelium loses its normal morphology, the pumping function decreases, and EndMT occurs. However, after overexpressing IGFBP4 or knocking down WNT2, the aforementioned EndMT process was alleviated .From PCR and WB results, it was found that overexpression of IGFBP4 resulted in a decrease in WNT2 expression, while knockdown of IGFBP4 resulted in an increase in WNT2 expression. However, overexpression or knockdown of WNT2 did not show significant changes in IGFBP4, and IP experiments demonstrated an interaction between IGFBP4 and WNT2. The above results demonstrate that IGFBP4 can negatively regulate WNT2.

In summary, primary RCECs were successfully cultivated in this study, and it can be passaged to the third generation or above in vitro. However, after subculture, RCECs gradually undergo EndMT, losing the structure and function of normal CECs. IGFBP4 can regulate Wnt2/β-catenin signaling pathway through Wnt, and further inhibits the occurrence of EndMT in CECs, maintaining their morphology and function (Fig. 6). Here, for the first time, we show the role of IGFBP4 in EndMT of CECs, which is expected to provide a novel idea for corneal endothelial regeneration engineering.

EndMT, Endothelial-mesenchymal transition;

CECs, corneal endothelial cells;

RCECs, rabbit corneal endothelial cells;

α-SMA, alpha-smooth muscle actin;

AQP-1, aquaporin-1;

IGFBP4, Insulin-like growth factor-binding protein 4;

RT-PCR,reverse transcription-polymerase chain reaction;

WB,western blot;

ELISA,enzyme linked immunosorbent assay;

IHC, Immunohistochemistry;

IP, Immunoprecipitation;

ITS, Insulin-Transferrin-Sodium Selenite Supplement;

FBS, Fetal bovine serum.

Acknowledgements

The authors would like to thank the kind help with Yunzhang Hu from Yunnan Provincial Key Laboratory of Vector-borne Diseases Control and Research, Institute

of Medical Biology, Chinese Academy of Medical Sciences and Peking Union Medical College, Kunming,China.

Funding

This study was supported by the Joint Project of Applied Basic Research of Kunming Medical University, Science and Technology Department of Yunnan Province (No.202101AY070001-291) ,and Joint Special Fund for Applied Basic Research of Kunming Medical University, Science and Technology Department of Yunnan Province[2018FE001 (-010)]

Authors’ contributions

HQK, HL and LL designed and supervised work. HQK, JJL, QC, YL and EMT conducted the research; HL provided essential research tools; HQK and QC analysed data. HQK drafted manuscript. LL and HL reviewed manuscript. All authors read and approved the final manuscript.

Ethics approval and consent to participate

All animal procedures related to the animals were conducted strictly according to the Institutional Animal Care and Use Committee guidelines, Yunnan University (IACUC,YUC), and approved by the Committee on Animal Research and Ethics of Yunnan University. Besides, all the experimental operations were according to the International Association for Animal Research on the management and protection of experimental animals.

Consent for publication

All of the authors have approved the contents of this paper.

Competing interests

The authors declare that they have no conficts of interests with the contents

of this article.

Author details

¹ Department of Ophthalmology, Affiliated Calmette Hospital of Kunming Medical University, Kunming city, Yunan Province, 650100, China

² Department of Ophthalmology, Affiliated Hospital of Yunnan University, No. 167 Qingnian Road, Kunming City, Yunnan Province,650021, China

Availability of data and materials

The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.

Stocker FW. The Endothelium of the Cornea and its Clinical Implications. Transactions of the American Ophthalmological Society 1953;51:669-786.
Ko M, Park WK, Lee JH, Chi JG. A Histomorphometric Study of Corneal Endothelial Cells in Normal Human Fetuses. Exp Eye Res 2001;72:403-409.
Laing RA, Sandstrom MM, Berrospi AR, Leibowitz HM. Changes in the Corneal Endothelium as a Function of Age. Exp Eye Res 1976;22:587-594.
Singh JS, Haroldson TA, Patel SP. Characteristics of the Low Density Corneal Endothelial Monolayer. Exp Eye Res 2013;115:239-245.
Joyce NC, Zhu CC. Human Corneal Endothelial Cell Proliferation. Cornea 2004;23:S8-S19.
Okumura N, Kay EP, Nakahara M, Hamuro J, Kinoshita S, Koizumi N. Inhibition of Tgf-Beta Signaling Enables Human Corneal Endothelial Cell Expansion in Vitro for Use in Regenerative Medicine. Plos One 2013;8:e58000.
Wongvisavavit R, Parekh M, Ahmad S, Daniels JT. Challenges in Corneal Endothelial Cell Culture. Regen Med 2021;16:871-891.
Yamashita K, Inagaki E, Hatou S, et al. Corneal Endothelial Regeneration Using Mesenchymal Stem Cells Derived From Human Umbilical Cord. Stem Cells Dev 2018;27:1097-1108.
Wang Z, Wang Z, Gao L, et al. Mir-222 Inhibits Cardiac Fibrosis in Diabetic Mice Heart Via Regulating Wnt/Β-Catenin-Mediated Endothelium to Mesenchymal Transition. J Cell Physiol 2020;235:2149-2160.
Zhen J, Jiao K, Yang K, et al. The 14-3-3Η/Gsk-3Β/Β-Catenin Complex Regulates Endmt Induced by 27-Hydroxycholesterol in Huvecs and Promotes the Migration of Breast Cancer Cells. Cell Biol Toxicol 2021;37:515-529.
Lamouille S, Xu J, Derynck R. Molecular Mechanisms of Epithelial-Mesenchymal Transition. Nat Rev Mol Cell Bio 2014;15:178-196.
Cooley BC, Nevado J, Mellad J, et al. Tgf-Β Signaling Mediates Endothelial-to-Mesenchymal Transition (Endmt) During Vein Graft Remodeling. Sci Transl Med 2014;6:227r-234r.
Pandya Thakkar N, Pereira BMV, Katakia YT, et al. Elevated H3K4Me3 through Mll2-Wdr82 upon Hyperglycemia Causes Jagged Ligand Dependent Notch Activation to Interplay with Differentiation State of Endothelial Cells. Front Cell Dev Biol 2022;10:839109.
Gonzalez DM, Medici D. Signaling Mechanisms of the Epithelial-Mesenchymal Transition. Sci Signal 2014;7:e8.
Li C, Dong F, Jia Y, et al. Notch Signal Regulates Corneal Endothelial-to-Mesenchymal Transition. Am J Pathol 2013;183:786-795.
Zhu YT, Chen HC, Chen SY, Tseng SC. Nuclear P120 Catenin Unlocks Mitotic Block of Contact-Inhibited Human Corneal Endothelial Monolayers without Disrupting Adherent Junctions. J Cell Sci 2012;125:3636-3648.
Huang SM, Mishina YM, Liu S, et al. Tankyrase Inhibition Stabilizes Axin and Antagonizes Wnt Signalling. Nature 2009;461:614-620.
Zhu W, Shiojima I, Ito Y, et al. Igfbp-4 is an Inhibitor of Canonical Wnt Signalling Required for Cardiogenesis. Nature 2008;454:345-349.
Lee JM, Dedhar S, Kalluri R, Thompson EW. The Epithelial-Mesenchymal Transition: New Insights in Signaling, Development, and Disease. J Cell Biol 2006;172:973-981.
Ueno K, Hirata H, Majid S, Tabatabai ZL, Hinoda Y, Dahiya R. Igfbp-4 Activates the Wnt/Beta-Catenin Signaling Pathway and Induces M-Cam Expression in Human Renal Cell Carcinoma. Int J Cancer 2011;129:2360-2369.
Praveen KV, Sehgal P, Thota B, Patil S, Santosh V, Kondaiah P. Insulin Like Growth Factor Binding Protein 4 Promotes Gbm Progression and Regulates Key Factors Involved in Emt and Invasion. J Neuro-Oncol 2014;116:455-464.
Xiao Y, Zhu S, Yin W, Liu X, Hu Y. Igfbp-4 Expression is Adversely Associated with Lung Cancer Prognosis. Oncol Lett 2017;14:6876-6880.
Yang B, Zhang L, Cao Y, et al. Overexpression of Lncrna Igfbp4–1 Reprograms Energy Metabolism to Promote Lung Cancer Progression. Mol Cancer 2017;16:154.
Chen W, Hu L, Lu X, et al. The Rna Binding Protein Mex3a Promotes Tumor Progression of Breast Cancer by Post-Transcriptional Regulation of Igfbp4. Breast Cancer Res Tr 2023;201:353-366.
DiPrisco B, Kumar A, Kalra B, et al. Placental Proteases Papp-a and Papp-a2, the Binding Proteins they Cleave (Igfbp-4 and -5), and Igf-I and Igf-Ii: Levels in Umbilical Cord Blood and Associations with Birth Weight and Length. Metabolism 2019;100:153959.
Liu J, Wen Y, Luo W, Liu Y, Sha X. Human Amniotic Epithelial Cells Promote the Proliferation of Human Corneal Endothelial Cells by Regulating Telomerase Activity Via the Wnt/Beta-Catenin Pathway. Curr Eye Res 2021;46:159-167.
Zhang C, Liu H, Zhao W, Zhao W, Zhou H, Shao R. G3Bp1 Promotes Human Breast Cancer Cell Proliferation through Coordinating with Gsk-3Β and Stabilizing Β-Catenin. Acta Pharmacol Sin 2021;42:1900-1912.
Guo Y, Xiao L, Sun L, Liu F. Wnt/Beta-Catenin Signaling: A Promising New Target for Fibrosis Diseases. Physiol Res 2012;61:337-346.
Li HR, Zhao QF, Chang LP, et al. Lncrna Malat1 Modulates Ox-Ldl Induced Endmt through the Wnt/Β-Catenin Signaling Pathway. Lipids Health Dis 2019;18:62.
Hu Z, Wang J, Pan T, et al. The Exosome-Transmitted Lncrna Loc100132249 Induces Endothelial Dysfunction in Diabetic Retinopathy. Diabetes 2023;72:1307-1319.
Zhang Z, Zhai C, Yang X, Li H, Wu L, Li L. Knockdown of Cd146 Promotes Endothelial-to-Mesenchymal Transition Via Wnt/Β-Catenin Pathway. Plos One 2022;17:e273542.
Okumura N, Nakamura T, Kay EP, Nakahara M, Kinoshita S, Koizumi N. R-Spondin1 Regulates Cell Proliferation of Corneal Endothelial Cells Via the Wnt3a/Beta-Catenin Pathway. Invest Ophth Vis Sci 2014;55:6861-6869.
Hirata-Tominaga K, Nakamura T, Okumura N, et al. Corneal Endothelial Cell Fate is Maintained by Lgr5 through the Regulation of Hedgehog and Wnt Pathway. Stem Cells 2013;31:1396-1407.

No competing interests reported.

WB.rar

Download PDF

Version 1

posted

You are reading this latest preprint version

IGFBP4 suppresses EndMT to maintain corneal endothelial cell characteristics through down-regulating WNT2 to inhibit Wnt2/β-catenin signaling pathway

Status:

Version 1

Abstract

Figures

1. Introduction

2. Methods

2.1 Primary cell culture

2.2 Immunofluorescence

2.3 Transcriptome analysis

2.4 RT-PCR assays

2.5 Construction of lentivirus vector

2.6 Construction of stable transgenic cell Lines

2.7 Westen blotting(WB)

2.8 Immunohistochemistry (IHC)

2.9 Immunoprecipitation(IP)

2.10 Statistical analysis

3. Results

3.1 RCECs are prone to undergo EndMT during in vitro culture

3.2 Transcriptome sequencing of RCECs of P0 and P3 generation

3.3 Construction of stable transgenic cells of IGFBP4 and WNT2 overexpression and interference in P3 generation

3.4 IGFBP4 suppresses Wnt/β-Catenin pathway and restrains EndMT in RCECs

3.5 WNT2 activates WNT/β-catenin pathway and promotes EndMT in RCECs

4. Discussion

Abbreviations

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1