Transcriptome Analysis of Sexual Dimorphism in Dorsal Down Coloration in Goslings

doi:10.21203/rs.3.rs-3589555/v1

Download PDF

Research Article

Transcriptome Analysis of Sexual Dimorphism in Dorsal Down Coloration in Goslings

https://doi.org/10.21203/rs.3.rs-3589555/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Background

Distinctive sexual dimorphism in dorsal down coloration is apparent in day-old Hungarian white goose goslings, characterized by darker dorsal plumage in females and lighter plumage in males. The ability to autosex day-old goslings based on their dorsal down coloration is crucial for efficient management and nutrition strategies in the poultry industry. The objective of this research was to gain a deeper understanding of the potential biological and genetic mechanisms governing sexually dimorphic down coloration in geese, utilizing tissue slice analysis, biochemical assays, transcriptomic profiling, and q-PCR analysis.

Results

The tissue slice and biochemical results revealed that female geese exhibited a higher density of melanin-containing feather follicles and a greater concentration of melanin within these follicles compared to male geese during embryonic development at 17 days and in day-old goslings. Both female and male individuals, in comparison to 17-day goose embryos, showed a significant decrease in melanin concentrations in the dorsal skin of day-old goslings. Through transcriptome analysis, we identified a set of differentially expressed genes (DEGs) (MC1R, TYR, TYRP1, DCT and MITF) associated with Melanogenesis pathways that exhibit substantial down-regulation or complete silencing specifically within the dorsal skin of day-old goslings when compared to 17-day embryos. This resulting in impaired melanin synthesis in the feather follicle. Additionally, sexual dimorphism in feather coloration is associated with two key DEGs (MC1R and MITF). Female geese exhibited higher expression levels of MC1R and MITF, positively correlated with increased melanin synthesis and deposition, resulting in a more pronounced plumage phenotype characterized by darker coloration.

Conclusions

Melanin synthesis in goose feather follicles was determined by the expression of multiple melanogenesis genes. Sexual dimorphism in dorsal down coloration of day-old Hungarian white goose goslings was contingent upon two essential MC1R and MITF genes. Our research lays the essential foundation for advancing the breeding in autosexing geese, promising substantial benefits to breeders and producers.

Sexual Dimorphism

Autosexing

Transcriptome Analysis

Goose

Sexual dimorphism in plumage coloration is a common and fascinating trait in avian species [1]. Among Hungarian white geese, this dimorphism manifests as different dorsal down coloration among newborn goslings, with females having dark grey plumage and males displaying lighter shades of grey or light yellow. Sex determination of day-old goslings can be largely achieved by observing differences in dorsal down characteristics between males and females, although this method may not yield 100% accuracy [2]. As we all know, utilizing the differences in feather phenotypes for automatic gender identification is a cost-effective and efficient method compared to vent sexing, with significantly faster results. Almost all commercial egg–laying strains are sexable by their wing feathers at day-old stage. Unfortunately, color sexing can’t be applied in predominantly goose (both females and males are born with yellow fluff) except Hungarian white goose. Therefore, the Hungarian white goose is one of the ideal models for studying sexual dimorphism in goose plumage coloration, and could be the indispensable breeding material to create more auto-sexing strains based on feather phenotypes.

Animal coloration is primarily determined by pigments, playing a crucial role in the vast array of coloration seen in the animal kingdom. Numerous studies have consistently demonstrates that color morphs in a wide range of bird species are primarily attributed to melanins and carotenoids, with melanins being more prevalent than carotenoids [3, 4]. While the genetic mechanisms underlying carotenoid-based coloration remain largely unexplored, melanin-based color traits offer a valuable model system for investigating the genetic basis of phenotypic diversity [5]. Melanin, the most prevalent pigment in animal coloration, contributes to the vibrant feather colors observed in birds. Notably, avian melanin pigmentation shows widespread sexual dimorphism [6]. Therefore, our study focused on investigating the sexual dimorphism of melanin-based plumage coloration in goslings.

Bird plumage encompasses two distinct chemical forms of melanin: eumelanin, which is accountable for generating dark black, brown, or grey colorations, and pheomelanin, producing lighter yellowish to reddish hues [7]. Typically, avian feather melanins are a blend of eumelanin and pheomelanin. Variations in melanin-based color traits primarily arise from differences in the quantity, proportion, and distribution of eumelanin and pheomelanin, as well as through processes such as melanoblast migration, differentiation, and melanosome structure and transport [5]. The eumelanin content in male duck head skin higher than that of females; however, no significant differences were observed in the pheomelanin content, suggesting that eumelanin predominantly contributes to the green head coloration in ducks [8]. On the other hand, white and yellow plumage lack detectable levels of eumelanin due to the absence of eumelanosomes required for its synthesis [9]. These findings demonstrate that the chemical composition and concentration of melanin significantly contribute to the sexual dimorphism in avian plumage coloration. Here, day-old goslings exhibit three distinct colors, namely pale yellow, light gray, and black, along with apparent sexual dimorphism. The underlying mechanisms responsible for the development of sexually dimorphic plumage coloration remain poorly understood and necessitate further investigation into the interplay between eumelanin and pheomelanin production in goslings.

Melanin synthesis is mediated by melanosomes located within melanocytes, and this process is influenced by a diverse range of extracellular factors, encompassing specific enzymes as well as other crucial regulatory and structural proteins. Tyrosinase and dopachrome tautomerase are the two most extensively investigated enzymes involved in melanogenesis. Tyrosinase, often considered as the rate-limiting enzyme, is indispensable for melanin biosynthesis within melanocytes [5]. The genetic regulation of avian melanin biosynthesis involves the expression of key enzymes responsible for melanin synthesis, in addition to other vital regulatory factors [7]. Existing research has sought to elucidate associations between variations in genotype and gene expression levels with phenotypic differences in melanin-based coloration. Consequently, more than 50 genes linked to plumage coloration have been identified in avian species [9]. Notably, several of these genes, including melanocortin receptor 1 (MC1R) gene [10–12], tyrosinase (TYR) gene [12, 13], tyrosinase-related protein 1(TYRP1) gene [14], Endothelin Receptor B2 (EDNRB2) gene [15], Dopachrome tautomerase (DCT) gene [16], Microphthalmia-associated transcription factor (MITF) [17] gene, among others, have been extensively investigated for their role in modulating melanogenesis, melanoblast migration, and melanocyte differentiation, thus influencing melanin-based plumage coloration. Moreover, comprehensive studies have probed the interactions between polymorphic sites within these candidate genes and feather color across different duck populations and breeds [18–23]. Additionally, MITF serves as a pivotal switch gene that regulates the majority of downstream genes involved in the melanogenesis pathway [17]. The Wnt, cAMP, and MAPK signaling pathways play widespread roles in melanocyte cycle regulation, hair follicle development and maintenance, melanin synthesis and transport, and hair and skin pigmentation. MITF serves as the central axis in these intricate processes. Despite extensive research on the synthesis mechanism of melanin deposition in various feather color types, there remains a dearth of understanding regarding the molecular mechanisms underlying sexually dimorphic plumage coloration between male and female geese. The objective of this study was to investigate and compare the fluctuations in melanin content within the dorsal skin of male and female geese, examine melanin distribution within feather follicles, and perform transcriptome analysis to pinpoint molecular networks, key candidate genes, and genetic polymorphisms associated with sexually dimorphic plumage coloration based on melanin. The results are anticipated to advance our understanding of the mechanisms governing sexual dimorphism in gosling plumage formation. Moreover, it offers a theoretical foundation for breeding programs focused on accurately identifying sex through dimorphism, thereby offering significant benefits to breeders and producers.

2.1 Animal ethics

The animals used in this study were approved and comply with the 'Regulations on the Administration of Laboratory Animals' promulgated by the State Council of the People's Republic of China in 2017. This study was authorized by the Animal Ethics Committee of Shanghai Academy of Agricultural Sciences (Shanghai, China) under approval number (SAASPZ0522046). And this research was conducted in accordance with the ARRIVE guidelines (https://arriveguidelines.org). All methods were carried out in accordance with relevant guidelines and regulations.

2.2 Animals and Sample Collection

All skin tissue samples were collected in strict adherence to the animal welfare regulations. The goslings selected for the experiment were euthanized by administering carbon dioxide via inhalation, followed by performing cervical dislocation, executed by proficient individuals who have received training in the appropriate technique. The samples from E17 (embryos at 17 days of age)(n = 12, 6 females and 6 males) and D0 (newly hatched goslings)(n = 12, 6 females and 6 males) were obtained exclusively from the Zhuanghang Research Farm, affiliated with the Shanghai Academy of Agricultural Sciences, Shanghai, China. The dorsal down coloration of goslings at the 17-day embryo and day-old stages is depicted in Fig. 1. After euthanasia, feathers were excised to preserve intact feather follicle tissue. The skin tissue, devoid of subcutaneous adipose tissue, was collected and processed in triplicated after gentle washing with phosphate-buffered saline (PBS, Cyclone, Logan, UT, USA). These tissue sections were fixed in 4% paraformaldehyde at room temperature. Simultaneously, the samples for ELISA analysis were immediately stored at -80°C. Subsequently, the remaining samples intended for RNA extraction were promptly flash-frozen in liquid nitrogen and stored at -80°C.

2.3 Tissue Section

Skin tissues were extracted from the fixative, followed by dehydration, wax infiltration, embedding, and sectioning at a thickness of 4 µM for subsequent HE staining. Subsequently, sequentially immerse the paraffin sections in Xylene I for a duration of 20 minutes, followed by Xylene II for 20 minutes. Then, treated them with Anhydrous ethanol I and II for 5 minutes each. Subsequently, immersed the sections in 75% Ethyl alcohol for another 5 minutes before rinsing them thoroughly with tap water and distilled water through a series of 3–5 washes. Each slide was subjected to Masson Fontana Stain Kit (Wuhan Servicebio Technology Co., Ltd., Wuhan, China) and sealed with a neutral resin. The prepared skin tissue sections were examined under a Nikon Eclipse E100 microscope (Nikon, Tokyo, Japan) and captured using the NIKONDS-U3 imaging system (Nikon, Tokyo, Japan).

2.4 ELISA Assay

We quantified the concentrations of melanin in skin tissues using an enzyme-linked immunosorbent assay (ELISA) kit for goose melanin obtained from Beijing JINZHIYAN Biotechnology Co., Ltd., Beijing, China, following the manufacturer's instructions.

2.5 Total RNA isolation and Illumina sequencing

The skin tissues were subjected to RNA extraction using the Trizol Reagent (Invitrogen, Carlsbad, CA, USA) following the manufacturer's protocol. The concentration, quality, and integrity of RNA were assessed using a NanoDrop spectrophotometer (Thermo Fisher Scientific Inc., Waltham, MA, USA). The cDNA libraries were prepared using the NEBNext Ultra II RNA Library Prep Kit for Illumina (New England Biolabs Inc; Ipswich, Massachusetts, USA) from 3 µg of high-quality total RNA (OD260/280 > 2.0, OD260/230 > 2.0), following the established protocol. Thereafter, the cDNA libraries underwent shearing, purification, blunting of ends, and ligation to adapters optimized for Illumina sequencing as per the prescribed procedure. Library products corresponding to 400–500 base pairs were enriched and purified using the AMPure XP system (Beckman Coulter, Beverly, CA, USA). DNA fragments with ligated adaptor molecules on both ends were selectively amplified using Illumina PCR Primer Cocktail in a 15-cycle PCR reaction. The resulting products were purified again using the AMPure XP system and quantified by Agilent high sensitivity DNA assay on a Bioanalyzer 2100 system (Agilent Technologies, Santa Clara, CA, USA). Finally, each sequencing library was sequenced on NovaSeq 6000 platform (Illumina, USA) at Shanghai Personal Biotechnology Co. Ltd. China.

2.6 Transcriptome Analysis

To obtain high-quality sequences, the fastp (0.22.0) software was employed to eliminate connectors and low-quality reads from the raw data. The filtered reads were subsequently aligned to the reference genome using HISAT2 (v2.1.0). For gene expression analysis, HTSeq (v0.9.1) was employed to count Read Count values for each gene as a measure of its initial expression, which were then normalized to FPKM. Differential expression analysis was performed using DESeq (v1.38.3), applying the following filter criteria: an absolute |log2FoldChange| > 1 and a significant P-value < 0.05. Simultaneously, we employed the R language Pheatmap (v1.0.12) software package to conduct bidirectional clustering analysis of all distinct genes in the samples. We generated a heatmap based on the expression levels of the same gene across different samples and the expression patterns of different genes within the same sample, using Euclidean distance calculation and the Complete Linkage method for clustering.

Moreover, gene expression profiling analysis and GO and KEGG pathway enrichment analyses of the differentially expressed unigenes were carried out. GO enrichment analysis for functional significance utilized the hypergeometric test to map all differentially expression genes (all DEGs/up DEGs/down DEGs) to terms in the Gene Ontology database using topGO (v2.50.0). We looked for significantly enriched GO terms and calculated p-values by the hypergeometric distribution method (the standard for significant enrichment was a p-value < 0.05). ClusterProfiler (v4.6.0) software was used to carry out the enrichment analysis of KEGG pathway for differential genes, focusing on the significant enrichment pathway with a p-value < 0.05. Gene Set Enrichment Analysis (GSEA) (v4.1.0) was used for GSEA enrichment analysis of all genes, and GSEA enrichment analysis pathway map was drawn.

2.7 Validation of DGE results using qRT-PCR

To validate the differential expression of genes across the entire overfeeding and interrupted overfeeding cycle, we selected five significantly differentially expressed candidate genes for quantitative real-time PCR (qRT-PCR) analysis. According to the previously assembled sequences, the primers for six candidate genes were designed using oligo 6.0 software. The information of the six candidate genes and their corresponding primers is provided in Table 1. The qRT-PCR was performed using the SYBR Premix Ex TaqTM II reagent Kit (RR820A, Takara, Dalian, China) and Applied Biosystems 7500 Fast Real-Time PCR Systems (7500, ABI, America). The qRT-PCR reaction mixture consisted of 1 uL of cDNA template, 10 uL of SYBR Premix ExTaq, 0.4 uL Rox Reference Dye (II), 7.4 uL of nuclease-free water, and 0.6 uL of each gene-specific primer. The amplification programs followed the established protocol, including an initial denaturation step at 95°C for 2 minutes, followed by 40 cycles of denaturation at 95°C for 30 seconds, annealing at 58°C for 30 seconds, and extension at 72°C for 30 seconds. Subsequently, a thermal denaturing step was performed to generate melt curves. The relative expression levels of the selected candidate genes were quantified based on the threshold cycle value (Ct) and normalized to GAPDH using the equation ΔΔCt = Ct(target gene) - Ct(GAPDH), where ΔΔCt represents fold change.

Table 1

Real-time PCR primer sequences
Gene Name	Primer SequenCes (5’ − 3’)	Annealing Temperature	Size of target fragments
MITF	F:AGCTCGGGCACATGGACT R:AGAGAGGGTATCGTCCATCA	65℃	280bp
TYRP1	F:AATGAGATGTTTGTTACTG R:ACTGATCAGTGAGAAGAGG	65℃	208bp
TYR	F:GCGACTGAGAACGAGAAGAA R:AAGAGTGTGTCCCGAGAGGC	56℃	222bp
DCT	F:CCGCAATTCCAGTTTCAGCT R:ACCGCTTCATCCACTCATCA	56℃	209bp
MC1R	F:CAAGACGCTCTTCATGCTGC R:ATGGTGATGTAGCGGTCCAC	65℃	159bp
GAPDH	F:GGTGGTGCTAAGCGTGTCAT R:CCCTCCACAATGCCAAAGTT	60℃	200bp
The candidate genes: MITF: Microphthalmia-associated transcription factor; TYRP1: Tyrosinase-related protein 1; TYR: Tyrosinase; DCT: Dopachrome tautomerase; MC1R: Melanocortin receptor 1 and GAPDH: Glyceraldehyde-3-phosphate dehydrogenase. F denotes forward primers and R denotes reverse primers.

2.8 Statistical analysis

Melanin levels and the expression levels of candidate genes were organized using Excel 2007 for data management. Statistical analysis was performed using the one-way ANOVA method in SPSS 26.0 software, followed by the Duncan's multiple comparison method. A significance level of P < 0.05 was used to determine statistically significant differences.

3.1 Histological examination of dorsal skin tissues

To investigate potential disparities in melanin quantity and distribution within feather follicles between male and female individuals, histological examinations were conducted on dorsal skin tissues of goslings at two developmental stages: 17-day embryos and day-old goslings. The representative images of skin sections stained with silver nitrate method are depicted in Fig. 2. The results reveal distinct differences in melanin distribution within skin feather follicles. At 17 days of embryonic development, the number of melanin-containing feather follicles and a great amount of melanin in these follicles were found to be higher in female geese(Fig. 2A1 and B1) compared to male geese (Fig. 2A2 and B2). However, the amount of melanin in the feather follicles of female goose was significantly lower in day-old goslings (Fig. 2A3 and B3) compared to that observed in 17-day-old embryos. In day-old goslings, melanin was found to be concentrated at the central position of the feather roots (Fig. 2A3), whereas it was evenly distributed primarily on the feather bud surface (Fig. 2A1) of 17-day-old embryos. However, melanin was not detected in the feather follicles of day-old male goslings (Fig. 2A4 and B4).

3.2 Determination of melanin content in dorsal skin tissues

The melanin content in the dorsal skin of goslings was quantitatively detected at two developmental stages using ELISA to compare the sexual dimorphism. The results showed that at the 17-day embryo stage, the melanin content in the dorsal skin of female goslings was significantly higher than that of male goslings (Fig. 3A). However, there were no differences between females and males at day-old goslings (Fig. 3A). In comparison to 17-day goose embryos, both female and male individuals exhibited a significant reduction in melanin concentrations in the dorsal skin at day-old stage (Fig. 3B).

3.3 Analysis of differential gene expression (DGE) in dorsal skin

The dorsal skin samples were collected from two distinct developmental stages, namely 17-day embryos and day-old goslings, for mRNA-Seq analysis. In total, 20 samples were obtained and all raw data have been deposited in the SRA database (accession number PRJNA1039165). The results of Principal Component Analysis (PCA) reveal four major clustering patterns among samples from different developmental stages and genders, while samples from the same developmental stage and gender exhibit similar characteristics (Fig. 4A). Differential gene expression (DGE) analysis based on mRNA-Seq data enabled the investigation of sexual dimorphism at distinct developmental stages through pairwise comparisons, with a significance threshold of |log2-fold change| > P-adjust < 0.05. The results revealed significant differential expression levels in 324 genes between the sexes in the dorsal skin for the embryos at 17-day stage, with 238 transcripts up-regulated and 86 transcripts down-regulated in females compared to males (Fig. 4B). In day-old goslings, a total of 976 differentially expressed transcripts were identified in the dorsal skin when comparing females and males, with 509 transcripts up-regulated in males and 467 transcripts up-regulated in females (Fig. 4B). Compared to 17-day embryos and day-old goslings, the dorsal skin of female geese exhibited 4068 differential genes, while male geese showed 4442 differential genes (Fig. 4B). We then overlapped the list of DGEs between groups using a Venn diagram (Fig. 4C). According to the clustering heatmap in Fig. 4D, the expression patterns of differentially expressed in both comparison groups exhibited striking similarity, with females and males distinctly clustered into separate categories at each developmental stage.

3.4 Analysis of GO enrichment in DEGs

To gain a comprehensive understanding of the biological implications of differentially expressed genes (DEGs), we conducted a rigorous Gene Ontology (GO) enrichment analysis. The results revealed significant enrichment of GO terms, which were categorized into three fundamental aspects: molecular function (MF), cellular component (CC), and biological process (BP). DEGs between E17F and E17M were primarily involved in structural constituent of the cytoskeleton, intermediate filament, and intermediate filament cytoskeleton (Fig. 5A). DEGs between D0F and D0M predominantly demonstrated participation in structural molecule activity, calcium ion binding, and extracellular matrix functions (Fig. 5B). DEGs between E17F and D0F mainly showed associations with cell periphery, plasma membrane, and intermediate filament processes (Fig. 5C). DEGs between E17M and D0M were primarily associated with the cell periphery, plasma membrane, and plasma membrane part functions (Fig. 5D). According to the GO sorting, three DEGs were identified between E17F and E17M: ENSACDG00005001594 (solute carrier family 7 member 11), ENSACDG00005014799 (RAB17), and ENSACDG00005003532 (melanocortin 1 receptor). These DEGs were significantly enriched in processes related to melanin biosynthesis, melanosome transport, and melanosome localization. Notably, a series of significantly DEGs were observed in processes related to melanin and melanosome production, which exhibited significant down-regulation or even silencing in the dorsal skin of day-old goslings compared to 17-day embryos (Fig. 7).

3.5 Analysis of KEGG enrichment in DEGs

The DEGs were further subjected to analysis using the Kyoto Encyclopedia of Genes and Genomes (KEGG) database. The top 20 KEGG pathway data were categorized into four groups and are shown in Fig. 6. The KEGG enrichment analysis revealed that “Neuroactive ligand-receptor interaction” and “Glycolysis/Gluconeogenesis” were the two most significantly enriched pathways when comparing E17F and E17M (Fig. 6A). In the comparison between D0F and D0M, “Focal adhesion” and “Ribosome” exhibited the highest enrichment levels among all pathways (Fig. 6B). Furthermore, “Neuroactive ligand-receptor interaction” and “Calcium signaling pathway” emerged as the two most significantly enriched pathways in both comparisons: E17F vs D0F and E17M vs D0M (Fig. 6C and D).

The enrichment analysis also revealed a significant activation of the “Wnt signaling pathway” and “Melanogenesis pathway,” both of which play crucial roles in regulating the feather coloration. This was observed in the pairwise comparisons between E17F and D0F, as well as between E17M and D0M. It is noteworthy that only one mRNA, ENSACDG00005003532 (melanocortin 1 receptor), exhibited significant enrichment in the Melanogenesis pathway in E17F vs E17M. Similar to the GO analysis, a series of significant DGEs were observed in the Melanogenesis pathway, demonstrating significant down-regulation or even silencing in the dorsal skin of day-old goslings compared to 17-day embryos (Fig. 7).

3.6 Expression of genes involved in the melanogenesis process through qRT-PCR analysis

To validate the accuracy of differentially expressed mRNAs identified through transcriptome sequencing technology and investigate the expression of genes associated with melanogenesis in dorsal skin tissues of goslings at two developmental stages, we selected four key genes (MC1R, TYR, DCT and TYRP1) involved in Melanogenesis, identified through transcriptome analysis, as candidate genes for quantitative real-time PCR (qRT-PCR) analysis. The results revealed a significant upregulation of MC1R gene expression in the dorsal skin of female geese compared to male geese at the 17-day embryo stage (P < 0.001)(Fig. 8B). Moreover, there was a significantly higher expression of TYR gene in the dorsal skin of female geese than in male geese (P < 0.05)(Fig. 8D). However, no significant differences were observed in the expression levels of DCT and TYRP1 genes between the sexes (Fig. 8E and F). All four genes associated with melanogenesis had little or no expression in dorsal skin tissues of day-old goslings (Fig. 8B and D-F).

Additionally, the observed trend in gene expression across two developmental stages of goslings' dorsal skin tissues was consistent with the findings obtained from the RNA-seq analysis (Fig. 8). Furthermore, the absence of MITF in the RNA-Seq data, a crucial player in avian melanogenesis pathway, prompted us to investigate its expression in dorsal skin tissues of goslings. The results showed that MITF expression in the dorsal skin of goslings was significantly higher in female embryos at the 17-day embryo stage than male counterparts. No detectable expression was found for the day-old goslings (Fig. 8C).

The distinctive dorsal down coloration in newborn Hungarian white geese, characterized by sexual dimorphism, presents a valuable opportunity to explore the genetic mechanisms underlying this biologically significant phenotype. In this study, we conducted histological examinations of dorsal skin tissue and observed that female geese displayed a higher density of melanin-containing feather follicles and a more concentrated melanin distribution within these follicles compared to male geese at 17 days of embryonic development and in day-old goslings (Fig. 1). The results from enzyme-linked immunosorbent assay (ELISA) quantification of melanin content in the dorsal skin tissue of goslings at two developmental stages were consistent with the histological observations (Fig. 2). Our findings are in line with the previous studies that have also noted higher melanin deposition in the skin follicles of female geese compared to male geese at various embryonic developmental stages (E14, E18, and E28) [2]. This supports the concept of sex-based differences in melanin levels on the dorsal skin of Hungarian white geese. Furthermore, similar sexual dimorphism has been observed in Barn Swallows [6] and mallards [23], it has been attributed to significant sex-specific variations in determinants influencing melanin deposition and feather coloration. Based on our findings and previous research, it becomes evident that the coloration of the dorsal down in newborn Hungarian white geese exhibits sexual dimorphism, closely associated with both the quantity and distribution of melanin within the feather follicle. For example, in domestic rock pigeons, recessive red pigeons exhibit higher levels of pheomelanin and lower levels of eumelanin in their feathers compared to wild-type blue pigeons [24]. Additionally, yellow plumage in chicken lacks eumelanin [25], indicating that the feather coloration of poultry is influenced by the specific type of melanin. Hence, the balance between eumelanin and pheomelanin in the feather follicles on the dorsal skin may contribute to the variations in gosling feather coloration. However, further research is needed to draw definitive conclusions.

It is noteworthy that both female and male individuals demonstrated a substantial decrease in melanin concentrations within the dorsal skin of day-old goslings when compared to 17-day goose embryos. A scarcity of melanin-containing feather follicles was observed in the dorsal skin tissue slices of female goslings at day-old stage, a phenomenon not observed in male goslings. These findings provide further evidence for the hypothesis that the absence of melanin in newly formed feather follicles, resulting in the lack of pigmentation in feathers, subsequently transforming into pure white plumage during adulthood. This is supported by the observed absence of pigmentation in white feathers of chickens [25].

Furthermore, our GO and KEGG enrichment analysis unveiled a set of significantly DEGs associated with Melanogenesis and Wnt pathways. These genes demonstrated considerable down-regulation or complete silencing within the dorsal skin of day-old goslings when compared to 17-day embryos (Fig. 7). Consistent with our findings, several previous studies [23, 26–29] have reported similar results from transcriptome and RNA-seq analysis of poultry skin feather follicles, demonstrating a notable enrichment of genes in both the Wnt signaling pathway and melanogenesis process. These signaling pathways play a pivotal role in the development of melanocytes and melanin biosynthesis [30–32], regulating the expression of key regulatory factors like melanocortin 1 receptor (MC1R), dopachrome tautomerase (DCT), tyrosinase(TYR), tyrosinase-related protein 1 (TYRP1), and microphthalmia transcription factor (MITF), thereby determining the levels of melanin production [33–35]. In our RNA-seq and qRT-PCR analysis, we observed a significant down-regulation or even silencing of these gene expressions within the dorsal skin of day-old goslings (Fig. 5). A similar study indicated a significant decline in their expression levels from E15 to E28 in geese [36], ultimately reaching undetectable levels by E29. Moreover, the mRNA and protein of TYRP1 was exclusively expressed in dorsal skin feather follicles of goslings at E18 [2]. These findings suggest a potential association between genes involved in melanogenesis and the melanogenic activity of follicular melanocytes (MC), which exhibits heightened activity during the anagen stage of the feather cycle but is downregulated or even silenced during the late feather cycle. In mammals, hair follicle melanogenesis is only active during hair growth, being switched off during the catagen stage and absent throughout telogen [32, 37]. As with our tissue section and biochemical results, we observed a significant decrease in dorsal skin melanin concentrations compared to 17-day goose embryos, and minimal or absent presence of melanin in the feather follicles of day-old goslings.

Collectively, the involvement of multiple key genes in melanogenesis pathways is likely to exert a pivotal influence on the development and pigmentation of skin, feather follicles, and feathers in goslings. The downregulation of melanogenesis genes leads to inadequate synthesis of melanin within the feather follicle, consequently resulting in a transition from gray to pure white coloration following molting. Regrettably, the precise factors responsible for the suppression of melanogenesis genes remain elusive.

Additionally, in our efforts to uncover potential key genes responsible for sex-specific differences in feather colorarion in goslings, our transcriptomic profiles revealed a significant enrichment of only one DEG (ENSACDG00005003532 - melanocortin 1 receptor) in the Melanogenesis pathway, specifically in E17F compared to E17M. Notably, qRT-PCR analysis demonstrated a remarkable upregulation of MC1R gene expression in the dorsal skin of female geese at the 17-day embryo stage when compared to their male counterparts (P < 0.001) (Fig. 8B). These findings suggest a potential correlation between the MC1R gene and the pigmentation of dorsal feathers in goslings. Previous studies have demonstrated the pivotal role of MC1R in the regulation of avian melanin feather pigmentation [11, 38–43]. Additionally, the MC1R demonstrates responsiveness to α-MSH and activates the αMSH/MC1R signaling pathways, thereby inducing an elevation in intracellular cAMP levels [44], which plays a pivotal role in regulating melanogenesis. Elevated cAMP levels lead to increased MITF expression and stimulate tyrosinase activity, subsequently promoting melanogenesis [45]. Tyrosinase is considered a crucial enzyme that regulates melanin synthesis and facilitates the production of eumelanin by melanocytes [5, 46]. Furthermore, it has been discovered that MC1R mutations are associated with feather color variation in avian species [10, 12, 49–50]. The q-PCR results revealed a concordant expression pattern between the MITF and MC1R genes in the dorsal skin of geese at embryonic day 17 (Fig. 8B and C).

By integrating our histological and biochemical findings, taking into account the pivotal role of MITF as the central regulator in the melanin production pathway, we demonstrate that both MITF and MC1R genes synergistically govern the melanin concentration in feather follicles, thereby influencing the dorsal down coloration of goslings. In summary, MITF and MC1R serve as the principal regulatory genes controlling melanin biosynthesis during the 17-day embryo stage. Higher expression levels of MITF and MC1R in female geese were positively associated with enhanced melanin synthesis and deposition, thereby resulting in a more pronounced plumage phenotype characterized by darker coloration. In conclusion, these findings suggest that MITF and MC1R genes can serve as two pivotal candidate functional genes. Further validation is required to investigate the differential expression and mutation sites in different sexes, which contribute to variations in coloration.

This study confirms the existence of sex-specific differences in melanin deposition within dorsal skin feather follicles during both embryonic and postnatal periods. Furthermore, transcriptome analysis has identified several key genes involved in melanogenesis pathways that are likely to be pivotal in the development and pigmentation of feathers in goslings. The downregulation of these melanogenesis genes results in insufficient synthesis of melanin within the feather follicle. Of particular importance are MITF and MC1R, two candidate genes strongly associated with sexual dimorphism in feather coloration. Ultimately, the cessation of melanogenesis gene activity may be responsible for the whitening of feathers after molting.

The melanin synthesis in goose feather follicles is determined by the expression of multiple melanogenesis genes. Sexual dimorphism in the dorsal down coloration of day-old Hungarian white goose goslings relies on the two essential genes, MC1R and MITF. This research lays a vital foundation for the genetic breeding of autosexing geese, representing a significant advancement for breeders and producers.

Data availability statement

The data that support the findings of this study are available from the corresponding author upon reasonable request. All transcriptome sequencing reads are openly available in NCBI SRA at https://submit.ncbi.nlm.nih.gov/, reference number PRJNA1039165.

Author contributions

Yi Liu and Guangquan Li contributed equally to this work. Yi Liu, Guangquan Li, Zhanbao Guo, Huiling Zhang, Baozhi Wei and Daqian He conceived and designed the study. Yi Liu, Guangquan Li, Zhanbao Guo, Huiling Zhang and Baozhi Wei performed the experiments and analyzed the data. Yi Liu and Guangquan Li wrote the manuscript. Daqian He reviewed and edited the manuscript. All authors read and approved the final manuscript.

Conflict of interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Funding

This research was funded by the China Agriculture Research System of MOF and MARA(CARS-42-7), the SAAS Program for Excellent Research Team (2022-021), and the Special Project of Modern Agriculture [2021Z131].

Valcu M, Valcu C, Kempenaers B. Extra-pair paternity and sexual dimorphism in birds. J Evol Biol. 2023;36(5):764-779.
Xu X, Wang S, Feng Z, Song Y, Zhou Y, Mabrouk I, Cao H, Hu X, Li H, Sun Y. Sex Identification of Feather Color in Geese and the Expression of Melanin in Embryonic Dorsal Skin Feather Follicles. Animals (Basel). 2022;12(11). doi:10.3390/ani12111427
Delhey K. The colour of an avifauna: A quantitative analysis of the colour of Australian birds. Sci Rep. 2015;5:18514. doi:10.1038/srep18514
McGraw KJ, Safra RJ, Evans MR, Wakamatsu K. European barn swallows use melanin pigments to color their feathers brown. Behav Ecol. 2004; 15:889-891.
Roulin A, Ducrest A. Genetics of colouration in birds. Semin Cell Dev Biol. 2013;24(6-7):594-608.
Saino N, Romano M, Rubolini D, Teplitsky C, Ambrosini R, Caprioli M, Canova L, Wakamatsu K. Sexual dimorphism in melanin pigmentation, feather coloration and its heritability in the barn swallow (Hirundo rustica). PLoS ONE. 2013;8(2):e58024. doi:10.1371/journal.pone.0058024
Galván I, Solano F. Bird Integumentary Melanins: Biosynthesis, Forms, Function and Evolution. Int J Mol Sci. 2016;17(4):520. doi:10.3390/ijms17040520
Haase E, Ito S, Wakamatsu K. Influences of sex, castration, and androgens on the eumelanin and pheomelanin contents of different feathers in wild mallards. Pigment Cell Res. 1995;8(3):164-70.
Grouw HV. What colour is that bird? The causes and recognition of common colour aberrations in birds. British Birds. 2013;106(1): 17-29.
Pointer MA, Mundy NI. Testing whether macroevolution follows microevolution: are colour differences among swans (Cygnus) attributable to variation at the MCIR locus. BMC Evol Biol. 2008;8:249. doi:10.1186/1471-2148-8-249
Johnson JA, Ambers AD, Burnham KK. Genetics of plumage color in the Gyrfalcon (Falco rusticolus): analysis of the melanocortin-1 receptor gene. J Hered. 2012;103(3):315-21.
Nam IS, Oh MG, Nam MS, Kim WS. Specific mutations in the genes of MC1R and TYR have an important influence on the determination of pheomelanin pigmentation in Korean native chickens. J Adv Vet Anim Res. 2021;8(2):266-273.
Cho E, Kim M, Manjula P, Cho SH, Seo D, Lee S, Lee JH. A retroviral insertion in the tyrosinase (TYR) gene is associated with the recessive white plumage color in the Yeonsan Ogye chicken. J Anim Sci Technol. 2021;63(4):751-758.
Li J, Marthey S, Valade M, Dureux A, Moroldo M, Péchoux C, Coville J, Gourichon D, Vieaud A, Dorshorst B, Andersson L, Tixier-Boichard M. A missense mutation in TYRP1 causes the chocolate plumage color in chicken and alters melanosome structure. Pigment Cell Melanoma Res. 2018;32(3):381-390.
Guo Q, Jiang Y, Wang Z, Bi Y, Chen G, Bai H, Chang G. Genome-Wide Analysis Identifies Candidate Genes Encoding Beak Color of Duck. Genes (Basel). 2022;13(7). doi:10.3390/genes13071271
Yuan H, Zhang X, Zhang Q, Wang Y, Wang S, Li Y, Zhang Y, Jing J, Qiu J, Wang Z, Leng L. Comparative transcriptome profiles of Lindian chicken eyelids identify melanin genes controlling eyelid pigmentation. Br Poult Sci. 2018;60(1):15-22.
Zhou Z, Li M, Cheng H, Fan W, Yuan Z, Gao Q, Xu Y, Guo Z, Zhang Y, Hu J, Liu H, Liu D, Chen W, Zheng Z, Jiang Y, Wen Z, Liu Y, Chen H, Xie M, Zhang Q, Huang W, Wang W, Hou S, Jiang Y. An intercross population study reveals genes associated with body size and plumage color in ducks. Nat Commun. 2018;9(1):2648. doi:10.1038/s41467-018-04868-4
Li L, Li D, Liu L, Li S, Feng Y, Peng X, Gong Y. Endothelin Receptor B2 (EDNRB2) Gene Is Associated with Spot Plumage Pattern in Domestic Ducks (Anas platyrhynchos). PLoS ONE. 2015;10(5):e0125883. doi:10.1371/journal.pone.0125883
Sultana H, Seo D, Choi N, Bhuiyan MSA, Lee SH, Heo K, Lee J. Identification of polymorphisms in MITF and DCT genes and their associations with plumage colors in Asian duck breeds. Asian-australas J Anim Sci. 2017;31(2):180-188.
Yang L, Mo C, Shen W, Du X, Akbar Bhuiyan A, Li L, Li N, Gong Y, Li S. The recessive C locus in the MITF gene plays a key regulatory role in the plumage colour pattern of duck (Anas platyrhynchos). Br Poult Sci. 2019;60(2):105-108.
Xi Y, Xu Q, Huang Q, Ma S, Wang Y, Han C, Zhang R, Wang J, Liu H, Li L. Genome-wide association analysis reveals that EDNRB2 causes a dose-dependent loss of pigmentation in ducks. BMC Genomics. 2021;22(1):381. doi:10.1186/s12864-021-07719-7
Guo Q, Jiang Y, Wang Z, Bi Y, Chen G, Bai H, Chang G. Genome-Wide Analysis Identifies Candidate Genes Encoding Feather Color in Ducks. Genes (Basel). 2022;13(7). doi:10.3390/genes13071249
Ma S, Liu H, Wang J, Wang L, Xi Y, Liu Y, Xu Q, Hu J, Han C, Bai L, Li L, Wang J. Transcriptome Analysis Reveals Genes Associated With Sexual Dichromatism of Head Feather Color in Mallard. Front Genet. 2021;12:627974. doi:10.3389/fgene.2021.627974
Domyan ET, Hardy J, Wright T, Frazer C, Daniels J, Kirkpatrick J, Kirkpatrick J, Wakamatsu K, Hill JT. SOX10 regulates multiple genes to direct eumelanin versus pheomelanin production in domestic rock pigeon. Pigment Cell Melanoma Res. 2019;32(5):634-642.
Zheng X, Zhang B, Zhang Y, Zhong H, Nie R, Li J, Zhang H, Wu C. Transcriptome analysis of feather follicles reveals candidate genes and pathways associated with pheomelanin pigmentation in chickens. Sci Rep. 2020;10(1):12088. doi:10.1038/s41598-020-68931-1
Liu C, Sello CT, Sui Y, Hu J, Chen S, Msuthwana P, Zhou Y, Wachiebine SK, Sun Y, Liu J, Li S, Yang W, Song Y, Xu Y, Guo C, Sui Q, Sun Y. Characterization of Embryonic Skin Transcriptome in Anser cygnoides at Three Feather Follicles Developmental Stages. G3 (Bethesda). 2020;10(2):443-454.
Li S, Wang C, Yu W, Zhao S, Gong Y. Identification of genes related to white and black plumage formation by RNA-Seq from white and black feather bulbs in ducks. PLoS ONE. 2012;7(5):e36592. doi:10.1371/journal.pone.0036592
Chen X, Ge K, Wang M, Zhang C, Geng Z. Integrative analysis of the Pekin duck (Anas anas) MicroRNAome during feather follicle development. BMC Dev Biol. 2017;17(1):12. doi:10.1186/s12861-017-0153-1
Xi Y, Liu H, Li L, Xu Q, Liu Y, Wang L, Ma S, Wang J, Bai L, Zhang R, Han C. Transcriptome Reveals Multi Pigmentation Genes Affecting Dorsoventral Pattern in Avian Body. Front Cell Dev Biol. 2020;8:560766. doi:10.3389/fcell.2020.560766
Jin EJ, Erickson CA, Takada S, Burrus LW. Wnt and BMP signaling govern lineage segregation of melanocytes in the avian embryo. Dev Biol. 2001;233(1):22-37.
Gajos-Michniewicz A, Czyz M. WNT Signaling in Melanoma. Int J Mol Sci. 2020;21(14). doi:10.3390/ijms21144852
D′Mello Stacey, Graeme F , Bruce B ,Marjan, AA. Signaling Pathways in Melanogenesis. International Journal of Molecular Sciences. 2016;17(7):1144.doi:10.3390/ijms17071144.
Bellei B, Pitisci A, Catricalà C, Larue L, Picardo M. Wnt/β-catenin signaling is stimulated by α-melanocyte-stimulating hormone in melanoma and melanocyte cells: implication in cell differentiation. Pigment Cell Melanoma Res. 2011;24(2):309-25.
Jang S, Chi W, Kim S. Dimethyl Itaconate Reduces α-MSH-Induced Pigmentation via Modulation of AKT and p38 MAPK Signaling Pathways in B16F10 Mouse Melanoma Cells. Molecules. 2022;27(13). doi:10.3390/molecules27134183
Yoon J, Youn K, Jun M. Discovery of Pinostrobin as a Melanogenic Agent in cAMP/PKA and p38 MAPK Signaling Pathway. Nutrients. 2022;14(18). doi:10.3390/nu14183713
Yang Y, Wang H, Li G, Liu Y, Wang C, Qiu S, Wang X, Yao J, Zhu L, He D. Using comparative genomics to detect mutations regulating plumage variations in graylag (A. anser) and swan geese (A. cygnoides). Gene. 2022;834:146612. doi:10.1016/j.gene.2022.146612
Slominski A, Paus R. Melanogenesis is coupled to murine anagen: toward new concepts for the role of melanocytes and the regulation of melanogenesis in hair growth. J Invest Dermatol. 1993;101(1 Suppl):90S-97S. doi:10.1111/1523-1747.ep12362991
Ling MK, Lagerström MC, Fredriksson R, Okimoto R, Mundy NI, Takeuchi S, Schiöth HB. Association of feather colour with constitutively active melanocortin 1 receptors in chicken. Eur J Biochem. 2003;270(7):1441-1449.
Zhang LY, Huang MY, Li Y, Yang XD, Luo YS, Shi XW. Molecular characteristics of MC1R gene in tile-grey plumage of domestic chicken. Br Poult Sci. 2020;61(4):382-389.
Khumpeerawat P, Duangjinda M, Phasuk Y. Factors affecting gene expression associated with the skin color of black-bone chicken in Thailand. Poult Sci. 2021;100(11):101440. doi:10.1016/j.psj.2021.101440
Yang L, Du X, Wei S, Gu L, Li N, Gong Y, Li S. Genome-wide association analysis identifies potential regulatory genes for eumelanin pigmentation in chicken plumage. Anim Genet. 2017;48(5):611-614. doi:10.1111/age.12573
Schwochow D, Bornelöv S, Jiang T, Li J, Gourichon D, Dorshorst BJ, Chuong C, Tixier-Boichard M, Andersson L. The feather pattern autosomal barring in chicken is strongly associated with segregation at the MC1R locus. Pigment Cell Melanoma Res. 2021;34(6):1015-1028.
Li Y, Zhang X, Pang Y, Qi Y, Zhao S. Construction of MC1R and ASIP Eukaryotic Expression Vector and its Regulation of Plumage Color in Japanese Quail (Coturnix japonica). J Poult Sci. 2019;56(2):84-90. doi:10.2141/jpsa.0180058
Bowers RR, Biboso A, Chávez O. The role of alpha-MSH, its agonists, and C-AMP in in vitro avian melanocytes. Pigment Cell Res. 1997;10(1-2):41-45.
Yuan XH, Jin ZH. Paracrine regulation of melanogenesis. Br J Dermatol. 2018;178(3):632-639.
Boswell T, Takeuchi S. Recent developments in our understanding of the avian melanocortin system: its involvement in the regulation of pigmentation and energy homeostasis. Peptides. 2005;26(10):1733-1743.
Araguas RM, Sanz N, Viñas J, Vidal O. MC1R polymorphism associated with plumage color variations in Coturnix chinensis. Anim Genet. 2018;49(5):475-477.
Kerje S, Lind J, Schütz K, Jensen P, Andersson L. Melanocortin 1-receptor (MC1R) mutations are associated with plumage colour in chicken. Anim Genet. 2003;34(4):241-248.
Fan Y, Wu X, Li Y, Han H, Zhang Y, Yang J, Liu Y. Effect of polymorphisms in the 5'-flanking sequence of MC1R on feather color in Taihang chickens. Poult Sci. 2022;101(12):102192. doi:10.1016/j.psj.2022.102192
Hoque MR, Jin S, Heo KN, Kang BS, Jo C, Lee JH. Investigation of MC1R SNPs and Their Relationships with Plumage Colors in Korean Native Chicken. Asian-australas J Anim Sci. 2013;26(5):625-629.

No competing interests reported.

Download PDF

Editorial decision: Revision requested
30 Jan, 2024
Reviews received at journal
11 Jan, 2024
Reviews received at journal
10 Jan, 2024
Reviewers agreed at journal
03 Jan, 2024
Reviewers agreed at journal
15 Dec, 2023
Reviewers invited by journal
22 Nov, 2023
Editor assigned by journal
14 Nov, 2023
Editor invited by journal
14 Nov, 2023
Submission checks completed at journal
14 Nov, 2023
First submitted to journal
10 Nov, 2023

You are reading this latest preprint version

Transcriptome Analysis of Sexual Dimorphism in Dorsal Down Coloration in Goslings

Status:

Version 1

Abstract

Background

Results

Conclusions

Figures

1. Background

2. Materials and methods

2.1 Animal ethics

2.2 Animals and Sample Collection

2.3 Tissue Section

2.4 ELISA Assay

2.5 Total RNA isolation and Illumina sequencing

2.6 Transcriptome Analysis

2.7 Validation of DGE results using qRT-PCR

2.8 Statistical analysis

3. Results

3.1 Histological examination of dorsal skin tissues

3.2 Determination of melanin content in dorsal skin tissues

3.3 Analysis of differential gene expression (DGE) in dorsal skin

3.4 Analysis of GO enrichment in DEGs

3.5 Analysis of KEGG enrichment in DEGs

3.6 Expression of genes involved in the melanogenesis process through qRT-PCR analysis

4. Discussion

5. Conclusion

Declarations

References

Additional Declarations

Status:

Version 1