Gentiopicroside improves the lipopolysaccharide-induced inflammatory response and hypertrophy in chondrocytes

doi:10.21203/rs.3.rs-3590928/v1

Download PDF

Research Article

Gentiopicroside improves the lipopolysaccharide-induced inflammatory response and hypertrophy in chondrocytes

https://doi.org/10.21203/rs.3.rs-3590928/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 25 Mar, 2024

Read the published version in Journal of Orthopaedic Surgery and Research →

You are reading this latest preprint version

Purpose: This study aimed to evaluate the protective effects of gentiopicroside against lipopolysaccharide (LPS)-induced chondrocyte inflammation.

Methods: Chondrocytes were stimulated with LPS (5 μg/ml) for 24 h, and treated with different concentrations of GPS (10, 20, 40 μM) for 24 h. The toxic effects of GPS on chondrocytes were determined using a CCK-8 assay and Edu staining. Western blot, qPCR, and immunofluorescence were used to explore the protective effects of gentiopicroside on the inflammatory response of chondrocytes induced by LPS. One-way ANOVA was used to compare the differences between the data groups (significance level of 0.05).

Results: The CCK-8 results showed that 10, 20 and 40 μM GPS had no significant toxicity on chondrocytes; GPS effectively reduced the production of IL-1β and PGE2, reversed LPS-induced extracellular matrix degradation in cartilage by inhibiting the Stat3/Runx2 signaling pathway, and suppressed the hypertrophic transformation of chondrocytes.

Conclusion: Our study demonstrated that GPS has a significant inhibitory effect on the LPS-induced inflammatory response and hypertrophic cellular degeneration in chondrocytes and is a valuable traditional Chinese medicine for the treatment of knee osteoarthritis.

Osteoarthritis

Knee Osteoarthritis

Gentiopicroside

Lipopolysaccharide

Hypertrophy

Knee osteoarthritis (KOA) is a chronic disease that is often accompanied by chronic pain and stiffness [1] and is highly prevalent in elderly individuals, obese individuals, and those with a history of knee trauma [2]. Long-lasting chronic pain and the resulting emotional disorders seriously affect the quality of daily life of patients, and the long treatment cycle and accompanying high treatment costs increase the economic burden on patients and society [3]. At present, more than 22% of adults over the age of 40 worldwide have KOA [4]. The pathological changes in KOA include articular cartilage destruction, subchondral bone remodeling, and synovial inflammation [5–6]. The destruction of articular cartilage is considered the main pathological change in KOA, which is manifested by excessive degradation of the extracellular matrix and chondrocyte degeneration [7]. Chondrocytes are the only cells in knee cartilage tissue. The extracellular matrix (ECM), mainly composed of collagen II, is synthesized and secreted to maintain the normal shape of cartilage and balance stress in the knee joint [8–9] and has important clinical significance in the pathogenesis of KOA. Therefore, an in vivo model simulating chondrocyte degeneration would be valuable for exploring the pathogenesis and treatment of KOA.

Lipopolysaccharide is a kind of polysaccharide compound, and can be used as a pathogenic factor, causing the inflammatory response of the body and abnormal activation of the immune system [10]. Local injection of LPS induces synovitis and inflammatory cartilage damage, and an LPS-induced chondrocyte inflammation model effectively reflects the extent of OA cartilage damage [11]. The SW1353 cell line, which is derived from chondrosarcoma, is presently a commonly utilized in vitro model for studying osteoarthritis [12], therefore, in this study, we employed them to simulate the inflammatory response and catabolism of OA via LPS stimulation.

Treatment of KOA includes health management, medication and surgery [13]. Owing to the lack of vascular and lymphatic tissues and its limited proliferative capacity, cartilage tissue is difficult to repair after injury or degeneration [14]. Conventional treatments can only relieve clinical symptoms and cannot repair damaged cartilage tissue or slow disease [15]. In recent years, herbal monomers of plant origin have been ranked as the first choice to treat inflammatory diseases [16]. Gentiopicroside is a natural iridoid glycoside compound extracted from gentian with anti-inflammatory, analgesic, antioxidant, and other biological activities [17]. GPS can significantly inhibit the expression of marker genes related to osteoclast generation in mouse bone marrow macrophages stimulated by NF-κB ligand receptor activator, inhibit osteoclast generation, and improve the symptoms of osteoporosis in mice [18]. Studies have shown that GPS can alleviate synovitis and cartilage destruction in mice with collagen-induced rheumatoid arthritis and plays an anti-rheumatic and cartilage- protective role by decreasing the secretion of matrix metalloproteinases (MMPs), which are potential drugs for the treatment of rheumatoid arthritis [19].

Kindlin-2 is a key adhesion protein that interacts with the cytoplasmic domain of integrin which is highly expressed in healthy chondrocytes [20]. In OA chondrocytes, the low level of Kindlin-2 promotes inflammation and catabolism through the activation of Stat3 phosphorylation [21]. There have been numerous studies on the anti-inflammatory effects of gentiopicroside [18–19]; however, whether GPS ameliorates inflammation and chondrocyte hypertrophy in a murine model of lipopolysaccharide-induced osteoarthritis via the Stat3/Runx2 signaling pathway has not been reported. Therefore, we evaluated the effects of GPS in a lipopolysaccharide-induced KOA cartilage model using cellular experiments and explored the molecular mechanisms of the Stat3/Runx2 signaling pathway in the therapeutic effects of GPS.

SW 1353 cells (Pricella, China); Gentiopicroside (MCE, China); Lipopolysaccharide, toluidine blue stain (Sigma, USA); Fetal bovine serum (Corning, USA); DMEM high sugar medium, green streptomycin double resistance solution (Servicebio, China); CCK-8 kit, IL-1β, IL-10, PGE2 active enzyme-linked immunosorbent assay kit (Solarbio, China). 5-Ethynyl-2 '-deoxyuridine (Edu)-488 cell proliferation detection kit (Beyotime, China); COX-2, IL-β and IL-10 antibodies (Affinity, China); ADAMTS5, MMP13, col2, ACAN and col10 antibodies (Proteintech, China.); Kindlin-2, Runx2, Stata3, P-Stata antibody (Abcam,UK); Trizol (Invitrogen, USA); PCR kit (Vazyme, China); Fluorescent quantitative PCR primer sequence (Sangon, China).

Identification of chondrocytes

Cells were seeded into 6-well plates covered with polylysine slides at a density of 1×10⁴ and incubated at constant 37℃ for 24 h. Then, the prepared cell crawling tablets were fixed with 4% paraformaldehyde for 15 min, rinsed with phosphate buffered saline (PBS) 3 times, and stained with 1% toluidine blue solution for 30 min. After rinsing twice with PBS, cell morphology was observed using an inverted fluorescence microscope.

Cell viability assessment

The toxic effects of gentiopicroside on cells were detected using a CCK-8 kit. Chondrocytes were seeded in 96-well plates at a density of 3×10³ cells/well. Once the cell density reached 80%, 0, 10, 20, 40, 80, and 160 µM GPS was added for 24 h of intervention. The medium was replaced, and 10 µL CCK-8 solution was added to each well, shaken until well mixing, and then placed in the incubator at 37℃ for 4 h. The OD value of the UV light at 450 nm was detected using a multifunctional enzyme standard meter (blank group without cells; control group without GPS intervention). To examine the effect of GPS on the proliferation of osteoarthritic chondrocytes, cells were first pretreated with 5 µg/ml LPS for 24 h [22]. GPS was incubated with 10, 20 and 40 µM concentrations for 24, 48 and 72 h to observe the pro-proliferative effects of different concentrations of GPS on osteoarthritic chondrocytes.

Edu staining

Cells were inoculated into 12-well plates at a density of 5×10³ cells/well, and pretreated with 5µg/ml LPS for 24 h, and then treated with 0, 10, 20, and 40 µM serum-free GPS solution for 24 h. One milliliter of Edu working solution (20µM) was added to each well, and incubation was continued for 2 h. Cells were fixed with 4% paraformaldehyde for 15 min and permeated with 0.3% Triton X-100 for 15 min. Finally, cells were incubated with 200 µl click reaction solution for 1 h. Nuclei were stained with Hoechst 33342 for 10 min. Chondrocyte proliferation was observed using an inverted fluorescence microscope, and the positive cell rate was calculated.

Cell grouping and intervention

According to the above results, cells were divided into a control group (G0), model group (G1), LPS + GPS low-dose group (G2), LPS + GPS medium-dose group (G3), and LPS + GPS high-dose group (G4). Cells in each group (except the control group) were treated with 5 µg/ml LPS to establish the osteoarthritis cell model, and then treated with 10, 20, and 40 µM GP [22–23].

Measurement of IL-1β and PGE2

Cells were treated according to the method described above, and the supernatant was collected. The contents of IL-1β and PGE2 inflammatory factors in the culture medium of each group were detected according to the ELISA kit operation method.

Immunofluorescence staining

In each group, cell crawlers were prepared, fixed in 4% paraformaldehyde for 15 min, permeabilized with 0.5% Triton-X-100 for 15 min, rinsed with PBS and blocked with 5% bovine serum albumin (BSA) for 1 h at room temperature, rinsed with PBS 2 times, and incubated with col2 antibody at 4℃ overnight. On the second day, fluorescence-coupled secondary antibody was added and incubated in the dark for 1h. The cells were washed 3 times with PBS and then stained with DAPI for 10 min; the slices were blocked, and images of col2 were captured by confocal laser scanning microscopy.

Western blot

Cells from each group were collected and placed on ice for 30 min in RIPA strong cracking buffer mixed with PMSF. Total protein from each group was extracted, and the protein concentration was detected using a BCA protein quantitative kit. The same amounts of proteins in different groups were separated by SDS-PAGE and transferred to PVDF membranes, sealed with protein-free rapid sealing solution for 10 min, incubated with primary antibody at 4°C overnight after TBST cleaning, and then incubated with specific secondary antibodies at room temperature for 1 h. After washing three times with TBST, the film was placed in a chemiluminescent color-developing solution to avoid light, and statistical analysis was performed.

Real-time quantitative PCR

Cells from each group were collected, total RNA was extracted by an RNA isolation and extraction kit, RNA was reverse transcribed into the cDNA template by a reverse transcription kit, the housekeeping gene GAPDH was selected as an internal reference, and real-time fluorescence quantitative PCR was performed by using SYBR® GreenERTM SuperMix Universal (Invitrogen®). Relative expression was calculated by the 2-ΔΔCt method (ΔCt is the difference between the threshold cycle of the samples and the reference value of GAPDH), and the sequences of primer used in the experiment are detailed in Table 1.

Table 1

Primer sequences of genes.
Gene name	Base sequence 5’-3’	Length
Collagen Ⅱ	F: GTAACCCTGGAACAGATGGAAT	149
	R: TTCACCCGTCTGACCTTTCG
Collagen Ⅹ	F: ACAGGCAACAGCATTATGACCC	198
	R: CGATGATGGCACTCCCTGAA
Aggrecan	F: ATTTCAGCGGTTCCTTCTCCA	212
	R: GTATAGGCTGGTTCCCATTCTG
MMP-13	F: AATGCAGTCTTTCTTCGGCTTAG	188
	R: CAGAATGAGTCATATCAGGGGTGT
ADAMTS 5	F: GAGCCTGGAAGTGAGCAAGAA	137
	R: CACATAAATCCTCCCGAGTAAACA
IL-1β	F: CGATCACTGAACTGCACGCTC	131
	R: ACAAAGGACATGGAGAACACCACTT
COX2	F: AGCACTTCACGCATCAGTTTTTC	205
	R: GCCTGAGTATCTTTGACTGTGGG
GADPH	F: GGAAGCTTGTCATCAATGGAAATC	168
	R: TGATGACCCTTTTGGCTCCC

Statistical analysis

SPSS 28.0.1.1 software was used to analyze the experimental results. Measurement information was expressed as the mean ± standard deviation (SD). One-way ANOVA was used to compare the differences between the data groups (significance level of 0.05).

Toluidine blue staining

Toluidine blue staining showed that the proteoglycan secreted by chondrocytes was heterochromatic when combined with toluidine blue staining solution. Cells grew in monolayers, some were polygonal, and some were elongated; the cytoplasm was bluish-purple, proving that the cultured cells were chondrocytes (Fig. 1).

Effect of gentiopicroside on chondrocyte viability

The results showed that 0, 10, 20, 40, and 80 μM gentiopicroside had no toxic effects on chondrocytes. However, the growth of chondrocytes was inhibited at a GPS concentration of 80 μM, and the survival of chondrocytes was significantly inhibited at a drug concentration of 160 μM (Fig. 2A). Therefore, gentiopicroside concentrations of 10, 20, and 40 μM were selected for subsequent experiments. The proliferation rate of chondrocytes significantly decreased after LPS treatment, and the LPS-induced decrease in the proliferation rate of chondrocytes was reversed when GPS was added to the culture medium (Fig. 2B). The apoptosis of chondrocytes was significantly inhibited when the GPS concentration of 40 μM significantly increased the proportion of proliferating chondrocytes in LPS-treated chondrocytes (Fig. 2C). EdU staining showed that GPS inhibited chondrocyte apoptosis after LPS treatment (Fig. 2D)

Effect of gentiopicroside on LPS-induced chondrocyte inflammation

ELISA results showed a significant increase in IL-1β and PGE2 in chondrocytes after LPS intervention. IL-1β and PGE2 production in the supernatant of the 40 μM GPS-treated group was significantly lower than that in the model group (Fig. 3 A, B). In addition, the mRNA expression of IL-1β and COX2 in chondrocytes in the model group was significantly increased compared with that in chondrocytes in the control group and showed a significant downward trend after treatment with different concentrations of GPS (Fig. 3 C, D).

Effect of gentiopicroside on the production of MMP-13 and ADAMTS5 in LPS-induced chondrocytes

Our results showed that GPS significantly reduced the mRNA expression of MMP-13 and ADAMTS5 in the 20 and 40 μM GPS intervention groups (Fig. 4 A,B). Moreover, the production of MMP-13 and ADAMTS5 proteins were significantly reduced compared to that in the model group (Fig. 4 C-E).

Gentiopicroside reverses LPS-induced extracellular matrix degradation and hypertrophy of chondrocytes

The results showed that LPS significantly decreased the mRNA expression of col2 and aggrecan, while the expression of col10 in chondrocytes was significantly prolonged. When different concentrations of GPS were applied, the expression of col2 and aggrecan mRNA were significantly increased, while the expression of col10 mRNA was significantly decreased. (Fig. 5 A-C). In addition, Western blotting results showed that the expressions of col2 and aggrecan in chondrocytes of the model group were significantly decreased, while col10 expression was significantly increased. GPS (40 μM) significantly increased the expression of col2 and aggrecan in chondrocytes, while decreasing the expression of col10 (Fig. 5 D-G). Immunofluorescence staining revealed that GPS significantly inhibited col2 degradation. (Fig. 5 H).

Gentiopicroside inhibits LPS-induced Stat3 activation

To investigate the effect of GPS on the Stat3/Runx2 signaling pathway, cells were incubated with 5 μg/ml LPS for 24 h, and then treated with GPS (10, 20 and 40 μM) for 24 h. Western blotting results showed that LPS significantly decreased the level of Kindlin-2 protein on the cell membrane surface, induced Stata phosphorylation and promoted Runx2 expression. GPS treatment significantly reduced the degradation of the Kindlin-2 protein while inhibiting Stata phosphorylation and Runx2 overproduction (Fig. 6).

With the aging population worldwide, the incidence of KOA is increasing. KOA is mainly caused by an imbalance between destruction and repair of articular cartilage; the degradation of cartilage extracellular matrix, production of inflammatory mediators, and chondrocyte hypertrophy are involved in the pathological process of KOA [24]. Although NSAIDs are commonly used in the clinical treatment of OA, they only provide temporary relief from clinical symptoms and can cause significant side effects in the cardiovascular, cerebrovascular, and gastrointestinal tracts [25]. Recently, there has been extensive interest in the use of gentiopicroside for the treatment of bone and joint diseases owing to its potent anti-inflammatory and analgesic properties [19, 26–27]. Our study results demonstrate effective inhibition of the inflammatory response in chondrocytes induced by lipopolysaccharides and the alleviation of hypertrophy through the use of gentiopicroside. Consequently, it plays a crucial role in protecting cartilage and establishing a novel theoretical foundation for the clinical implementation of traditional Chinese medicine monomer-based therapy.

The CCK-8 assay is commonly used to detect cell proliferation and cytotoxicity. Our findings revealed that chondrocyte viability was unaffected and there was no cytotoxicity when exposed to GPS concentrations ranging from 0 to 40 µM. Furthermore, GPS concentrations of 10, 20, and 40 µM effectively prevented LPS-induced chondrocyte apoptosis and promoted chondrocyte proliferation. These results suggest that GPS can effectively reverse inflammation-induced chondrocyte apoptosis within a specific concentration range. Another study demonstrated that low concentrations of gentiopicroside were safe and nontoxic to chondrocytes, and significantly inhibited inflammation in OA chondrocytes [23], which is consistent with our findings.

Inflammation plays a vital role in the progression of OA, and various inflammatory mediators contribute to its progression. IL-1β and PGE2 are particularly important in the development of OA [28–29]. In this experiment, we utilized 5 µg/ml LPS to create cell models of osteoarthritis. Following a 24-hour LPS intervention, the levels of IL-1β and PGE2 in the culture medium increased significantly compared to those in the control group. Upon treating the osteoarthritis model cells with 40 µM gentiopicrin, the production of PGE2 decreased significantly, as did the expression of COX2 mRNA. These findings suggest that gentiopicrin effectively inhibits the production of PGE2 by COX2 and reduces the inflammatory response of chondrocytes. However, further research is necessary to fully understand the underlying mechanisms.

Chondrocyte hypertrophy refers to an increase in chondrocyte volume, which is a critical step in the natural process of endochondral osteogenesis. However, abnormal activation of chondrocyte hypertrophy after injury and aging accelerates the pathological progression of OA [30]. Chondrocyte hypertrophy, characterized by the increased expression of type X collagen (col10), Runx2, and MMP-13, is a significant factor in the development of OA [31]. The extracellular matrix of cartilage relies on type II collagen (col2) as its framework. Col2 works together with aggrecan to maintain the structural integrity of cartilage and serves as a lubricant to aid in the mechanical support of cartilage [32]. The presence of CTX-II, a metabolite of col2, is easily detectable in urine and exhibits a strong correlation with the severity of KOA [33], implying that the loss of extracellular matrix plays a crucial role in the pathogenesis of KOA. In our study, we utilized 5 µg/ml LPS to treat chondrocytes and observed a significant decrease in the expression of col2 and aggrecan, while the expression of col10 increased significantly in the model group. However, when we applied different concentrations of GPS, it effectively reversed the degradation of the extracellular matrix in cartilage and reduced the expression of the chondrocyte hypertrophic marker col10. These findings suggested that GPS has a positive chondroprotective effect and can reverse cellular hypertrophy.

Matrix metalloproteinases (MMPs) are a family of zinc-dependent proteolytic enzymes, among which the expression of MMP-13 is most closely related to KOA, and its function is to degrade col2, [34]. Recombinant A Disintegrin And Metalloproteinase With Thrombospondin (ADAMTS) is a protease that mediates the degradation of the ECM of chondrocytes, leading to the destruction of cartilage integrity and degradation of aggrecan [35]. Even in the early stages of KOA, significant expression of ADAMTS5 was detected in articular cartilage [36]. Little et al. showed that compared with wild-type mice, MMP-13 whole-gene knockout mice showed relatively reduced articular cartilage degradation in an OA model, whereas MMP-13 gene overexpression aggravated the progression of OA in mice [37]. A recent study reported a significant increase in MMP-3 and MMP-13 secretion by degenerative lumbar disc cartilage [38]. In our study, we observed an increase in the production of MMP-13 and ADAMTS5, as well as accelerated degradation of col2 in chondrocytes following LPS stimulation. However, administration of GPS effectively blocked the LPS-induced upregulation of MMP-13 and ADAMTS5 and prevented extracellular matrix degradation. These findings suggest that GPS inhibits extracellular matrix degradation.

During the pathogenesis of KOA, the Stat3/Runx2 signaling pathway plays a role in ECM degradation, and the adhesion protein Kindlin-2 interacts with the cytoplasmic domain of integrin to activate integrin and regulate ECM adhesion and migration [39]. Previous studies on Kindlin-2 have mainly focused on bone development and the regulation of bone remodeling; however, its role in cartilage diseases has become a popular topic in recent years [40–41]. According to a previous report, the absence of Kindlin-2 in articular chondrocytes in adult mice results in spontaneous OA and worsens surgery-induced OA lesions [42]. Western blotting showed that GPS significantly inhibited LPS-induced Stat3 phosphorylation in chondrocytes and reduced the acceleration of chondrocyte extracellular matrix catabolism caused by excessive Runx2 accumulation. Previous results have demonstrated that GPS significantly inhibits Stat3 phosphorylation and improves colon damage in mice with DSS-induced acute colitis [43], which mainly aligns with our results.

In summary, our study suggests that GPS reduces inflammation by inhibiting LPS-induced overproduction of IL-1β and PGE2 in chondrocytes and inhibits LPS-induced expression of MMP-13 and ADAMTS5 through the Stat3/Runx2 signaling pathway and reversing extracellular matrix degradation. It also reduced the production of col10, a marker of chondrocyte hypertrophy. These experimental data indicate that GPS can inhibit the inflammatory response of KOA chondrocytes and chondrocyte hypertrophy to a certain extent, making it a promising drug for the treatment of KOA.

KOA, Knee Osteoarthritis

LPS, lipopolysaccharide

GPS, gentiopicroside

CCK-8, Cell Counting Kit-8

MMP-13, Matrix Metalloproteinase-13

ADAMTS, A Disintegrin and Metalloproteinase with Thrombospondin

GAPDH, Glyceraldehyde 3-phosphate dehydrogenase

ELISA: Enzyme-Linked Immunosorbent Assay

Edu: 5-ethynyl-2'-deoxyuridine

Ethics approval and consent to participate

This study protocol was approved by the Research Ethics Committee of the Affiliated Hospital of Binzhou Medical College (KYLL-2022-114).

Consent for publication

Not applicable.

Availability of data and materials

The datasets supporting the conclusions of this article are all included within this article.

Competing interests

The authors declare no conflicts of interest.

Funding

This study was supported by The Shandong Natural Science Foundation (ZR2022MH063) and Shandong Medical and Health Technology Development Plan (202020010886).

Authors' contributions

Wei Li and Chen Li contributed to the study design, Longfei Li and Yixuan Zhao performed the experiments, Longfei Li and Qianqian Fan prepared the manuscript, Qian Zhang performed the data analysis, and all the authors have read and approved the final manuscript.

Acknowledgement

Not applicable.

Zhao X, Meng F, Hu S, et al. The Synovium Attenuates Cartilage Degeneration in KOA through Activation of the Smad2/3-Runx1 Cascade and Chondrogenesis-related miRNAs. Mol Ther Nucleic Acids. 2020,22:832-845. https://doi.org/10.1016/j.omtn.2020.10.004.
Wallace I J, Worthington S, Felson D T, et al. Knee osteoarthritis has doubled in prevalence since the mid-20th century. Proceedings of the National Academy of Sciences. 2017,114(35):9332-9336. https://doi.org/10.1073/pnas.1703856114
Wright L J, Zautra A J, Going S. Adaptation to early knee osteoarthritis: the role of risk, resilience, and disease severity on pain and physical functioning. Ann Behav Med. 2008,36(1):70-80. https://doi.org/10.1007/s12160-008-9048-5
Quicke JG C P C N. Osteoarthritis year in review 2021: epidemiology & therapy. Osteoarthritis and cartilage. 2022,30(2):196-206. https://doi.org/10.1016/j.joca.2021.10.003.
Hu Y, Gui Z, Zhou Y, et al. Quercetin alleviates rat osteoarthritis by inhibiting inflammation and apoptosis of chondrocytes, modulating synovial macrophages polarization to M2 macrophages. Free Radical Biology and Medicine. 2019,145:146-160. https://doi.org/10.1016/j.freeradbiomed.2019.09.024.
Xiang X, Zhu S, He H, et al. Mesenchymal stromal cell-based therapy for cartilage regeneration in knee osteoarthritis. Stem cell research & therapy. 2022,13(1):14. https://doi.org/10.1186/s13287-021-02689-9.
Yao Q, Wu X, Tao C, et al. Osteoarthritis: pathogenic signaling pathways and therapeutic targets. Signal Transduct Target Ther. 2023,8(1):56. https://doi.org/10.1038/s41392-023-01330-w.
Charlier E, Deroyer C, Ciregia F, et al. Chondrocyte dedifferentiation and osteoarthritis (OA). Biochemical Pharmacology. 2019,165:49-65. https://doi.org/10.1016/j.bcp.2019.02.036.
Zhang H, Shao Y, Yao Z, et al. Mechanical overloading promotes chondrocyte senescence and osteoarthritis development through downregulating FBXW7. Annals of the Rheumatic Diseases. 2022,81(5):676-686. https://doi.org/10.1136/annrheumdis-2021-221513.
Pussinen P J, Kopra E, Pietiainen M, et al. Periodontitis and cardiometabolic disorders: The role of lipopolysaccharide and endotoxemia. Periodontol 2000. 2022,89(1):19-40. https://doi.org/10.1111/prd.12433.
Zhang Q, Bai X, Wang R, et al. 4-octyl Itaconate inhibits lipopolysaccharide (LPS)-induced osteoarthritis via activating Nrf2 signalling pathway. J Cell Mol Med. 2022,26(5):1515-1529. https://doi.org/10.1111/jcmm.17185.
Zhang Z, Wang S, Liu X, et al. Secoisolariciresinol diglucoside Ameliorates Osteoarthritis via Nuclear factor-erythroid 2-related factor-2/ nuclear factor kappa B Pathway: In vitro and in vivo experiments. Biomedicine & Pharmacotherapy. 2023,164:114964. https://doi.org/10.1016/j.biopha.2023.114964.
L. S. Osteoarthritis of the Knee. N Engl J Med. 2021. 2021, 384(1):51-59. https://doi.org/10.1056/NEJMcp1903768.
Fujii Y, Liu L, Yagasaki L, et al. Cartilage Homeostasis and Osteoarthritis. Int J Mol Sci. 2022,23(11). https://doi.org/10.3390/ijms23116316.
Skou ST R E L M. Total knee replacement and non-surgical treatment of knee osteoarthritis: 2-year outcome from two parallel randomized controlled trials. Osteoarthritis and Cartilage. 2018. https://doi.org/10.1016/j.joca.2018.04.014.
Hongzhi D, Xiaoying H, Yujie G, et al. Classic mechanisms and experimental models for the anti-inflammatory effect of traditional Chinese medicine. Animal Model Exp Med. 2022,5(2):108-119. https://doi.org/10.1002/ame2.12224.
Xiao H, Sun X, Lin Z, et al. Gentiopicroside targets PAQR3 to activate the PI3K/AKT signaling pathway and ameliorate disordered glucose and lipid metabolism. Acta Pharmaceutica Sinica B. 2022,12(6):2887-2904. https://doi.org/10.1016/j.apsb.2021.12.023.
Chen F, Xie L, Kang R, et al. Gentiopicroside inhibits RANKL-induced osteoclastogenesis by regulating NF-κB and JNK signaling pathways. Biomedicine & Pharmacotherapy. 2018,100:142-146. https://doi.org/10.1016/j.biopha.2018.02.014.
Jia N, Ma H, Zhang T, et al. Gentiopicroside attenuates collagen-induced arthritis in mice via modulating the CD147/p38/NF-κB pathway. International Immunopharmacology. 2022,108:108854. https://doi.org/10.1016/j.intimp.2022.108854.
Lai Y, Zheng W, Qu M, et al. Kindlin-2 loss in condylar chondrocytes causes spontaneous osteoarthritic lesions in the temporomandibular joint in mice. Int J Oral Sci. 2022,14(1):33. https://doi.org/10.1038/s41368-022-00185-1.
Ali A, Park Y, Lee J, et al. In Vitro Study of Licorice on IL-1β-Induced Chondrocytes and In Silico Approach for Osteoarthritis. Pharmaceuticals. 2021,14(12):1337. https://doi.org/10.3390/ph14121337.
Luo X, Wang J, Wei X, et al. Knockdown of lncRNA MFI2-AS1 inhibits lipopolysaccharide-induced osteoarthritis progression by miR-130a-3p/TCF4. Life Sci. 2020,240:117019. https://doi.org/10.1016/j.lfs.2019.117019.
Zhao L, Ye J, Wu G, et al. Gentiopicroside prevents interleukin-1 beta induced inflammation response in rat articular chondrocyte. Journal of Ethnopharmacology. 2015,172:100-107. https://doi.org/10.1016/j.jep.2015.06.031.
Liu L, Luo P, Yang M, et al. The role of oxidative stress in the development of knee osteoarthritis: A comprehensive research review. Front Mol Biosci. 2022,9:1001212. https://doi.org/10.3389/fmolb.2022.1001212.
He L, Pan Y, Yu J, et al. Decursin alleviates the aggravation of osteoarthritis via inhibiting PI3K-Akt and NF-kB signal pathway. International Immunopharmacology. 2021,97:107657. https://doi.org/10.1016/j.intimp.2021.107657.
He M, Hu C, Chen M, et al. Effects of Gentiopicroside on activation of NLRP3 inflammasome in acute gouty arthritis mice induced by MSU. J Nat Med. 2022,76(1):178-187. https://doi.org/10.1007/s11418-021-01571-5.
Jiang H, Zhong J, Li W, et al. Gentiopicroside promotes the osteogenesis of bone mesenchymal stem cells by modulation of β-catenin-BMP2 signalling pathway. J Cell Mol Med. 2021,25(23):10825-10836. https://doi.org/10.1111/jcmm.16410.
Mantsounga C S, Lee C, Neverson J, et al. Macrophage IL-1β promotes arteriogenesis by autocrine STAT3- and NF-κB-mediated transcription of pro-angiogenic VEGF-A. Cell Rep. 2022,38(5):110309. https://doi.org/10.1016/j.celrep.2022.110309.
Jiang W, Jin Y, Zhang S, et al. PGE2 activates EP4 in subchondral bone osteoclasts to regulate osteoarthritis. Bone Res. 2022,10(1):27. https://doi.org/10.1038/s41413-022-00201-4.
Ferrao B M, Domenech G H, Legeai-Mallet L, et al. Tyrosine kinases regulate chondrocyte hypertrophy: promising drug targets for Osteoarthritis. Osteoarthritis Cartilage. 2021,29(10):1389-1398. https://doi.org/10.1016/j.joca.2021.07.003.
Rim Y A, Nam Y, Ju J H. The Role of Chondrocyte Hypertrophy and Senescence in Osteoarthritis Initiation and Progression. International Journal of Molecular Sciences. 2020,21(7):2358. https://doi.org/10.3390/ijms21072358.
Rahmati M, Nalesso G, Mobasheri A, et al. Aging and osteoarthritis: Central role of the extracellular matrix. Ageing Res Rev. 2017,40:20-30. https://doi.org/10.1016/j.arr.2017.07.004.
Lv Z, Yang Y X, Li J, et al. Molecular Classification of Knee Osteoarthritis. Front Cell Dev Biol. 2021,9:725568. https://doi.org/10.3389/fcell.2021.725568.
Alharbi K S, Afzal O, Altamimi A S A, et al. Potential role of nutraceuticals via targeting a Wnt/β‐catenin and NF‐κB pathway in treatment of osteoarthritis. Journal of Food Biochemistry. 2022,46(12). https://doi.org/10.1111/jfbc.14427.
Weng K, Luo M, Dong D. Elucidation of the Mechanism by Which a ADAMTS5 Gene MicroRNA-Binding Site Single Nucleotide Polymorphism Affects the Risk of Osteoarthritis. Genet Test Mol Biomarkers. 2020,24(8):467-477. https://doi.org/10.1089/gtmb.2020.0067.
Deng R, Zhang H, Huang L, et al. MicroRNA-186 ameliorates Knee osteoarthritis via regulation of P2X7-mediated Cathepsin-K/Runx2/ADAMTS5 signalling axis in articular chondrocytes. Saudi J Biol Sci. 2021,28(8):4270-4275. https://doi.org/10.1016/j.sjbs.2021.06.091.
Little C B, Barai A, Burkhardt D, et al. Matrix metalloproteinase 13-deficient mice are resistant to osteoarthritic cartilage erosion but not chondrocyte hypertrophy or osteophyte development. Arthritis Rheum. 2009,60(12):3723-3733. https://doi.org/10.1002/art.25002.
Shao Z, Wang B, Shi Y, et al. Senolytic agent Quercetin ameliorates intervertebral disc degeneration via the Nrf2/NF-κB axis. Osteoarthritis and cartilage. 2021,29(3):413-422. https://doi.org/10.1016/j.joca.2020.11.006.
Yao Q, Gong W, Wu X, et al. Comparison of Kindlin-2 deficiency-stimulated osteoarthritis-like lesions induced by Prg4(CreERT2) versus Aggrecan(CreERT2) transgene in mice. J Orthop Translat. 2023,41:12-19. https://doi.org/10.1016/j.jot.2023.05.005.
Lei Y, Fu X, Li P, et al. LIM domain proteins Pinch1/2 regulate chondrogenesis and bone mass in mice. Bone Res. 2020,8:37. https://doi.org/10.1038/s41413-020-00108-y.
Komori T. Molecular Mechanism of Runx2-Dependent Bone Development. Mol Cells. 2020,43(2):168-175. https://doi.org/10.14348/molcells.2019.0244.
Wu X, Lai Y, Chen S, et al. Kindlin-2 preserves integrity of the articular cartilage to protect against osteoarthritis. Nature Aging. 2022,2(4):332-347. https://doi.org/10.1038/s43587-021-00165-w.
Xie Y, Shao Y, Han W, et al. Study on the mechanism of regulation of macrophage polarization by gentiopicroside pathway based on JAK2/STAT3 in mice with ulcerative colitis, Modern Chinese traditional medicine. 2021, 23(12): 2107-2114. https://doi.org/10.13313/j.issn.1673-4890.20210108007.

No competing interests reported.

Download PDF

Journal Publication

published 25 Mar, 2024

Read the published version in Journal of Orthopaedic Surgery and Research →

Editorial decision: Revision requested
21 Feb, 2024
Reviews received at journal
20 Feb, 2024
Reviewers agreed at journal
03 Feb, 2024
Reviewers agreed at journal
19 Jan, 2024
Reviewers invited by journal
16 Nov, 2023
Editor assigned by journal
14 Nov, 2023
Submission checks completed at journal
14 Nov, 2023
First submitted to journal
10 Nov, 2023

You are reading this latest preprint version

Gentiopicroside improves the lipopolysaccharide-induced inflammatory response and hypertrophy in chondrocytes

Status:

Journal Publication

Version 1

Abstract

Figures

Introduction

Materials and Reagents

Methods

Identification of chondrocytes

Cell viability assessment

Edu staining

Cell grouping and intervention

Measurement of IL-1β and PGE2

Immunofluorescence staining

Western blot

Real-time quantitative PCR

Statistical analysis

Results

Discussion

Abbreviations

Declarations

References

Additional Declarations

Status:

Journal Publication

Version 1