Effect of storage temperature on viral RNA accumulation in plum pox virus-infected cv. Red Lyon plum fruit growing in the Central Valley of Chile

doi:10.21203/rs.3.rs-3591477/v1

Download PDF

Research Article

Effect of storage temperature on viral RNA accumulation in plum pox virus-infected cv. Red Lyon plum fruit growing in the Central Valley of Chile

https://doi.org/10.21203/rs.3.rs-3591477/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Plum pox virus (PPV), the causative agent of Sharka disease, causes serious economic losses to the stone fruit industry. As PPV is not transmitted by seed, fruit from countries with Sharka present are considered low-risk for spreading the disease. However, there have been cases raising concerns about the safety of exporting fruit from countries with Sharka disease. Due to this, the generation of new scientific evidence becomes important to address these concerns. This study aimed to compare the relative accumulation of PPV viral titer between freshly harvested infected fruit with fruit subjected to cold storage, simulating transit conditions to export markets. During two consecutive seasons, but with independent experiments in each, the fruit was collected from a PPV-infected cv. Red Lyon plum orchard, and divided into three treatments (T): freshly harvested fruit (T1); fruit exposed to cold (0 °C) for seven days (T2), and fruit exposed to cold (0 °C) for 15 days (T3). Semi-quantitative RT-PCR was used to estimate the viral titer; band density values obtained for products of amplification of a PPV genome fragment were normalized with the density values obtained from the constitutive gene nad5and plotted relative to treatment T1, which served as a control for this purpose. The results showed a significant difference (p<0.05) between T1 and other treatments. For the first season, the viral RNA reduction was of 50% in T2 and 61% in T3, compared to T1. For the second season, the corresponding RNA viral reductions were 45% in T2 and 56% in T3, compared to T1.

Virology

cold storage

plum fruit

PPV

viral RNA accumulation

Sharka disease, caused by plum pox virus (PPV), a member of the genus Potyvirus in the family Potyviridae, is devastating for the stone fruit industry worldwide. Therefore, many countries have implemented rigorous restrictions on the entry of plant propagation material to prevent the spread of the disease (García et al. 2014). However, these restrictions do not apply to fruit, as it is consumed by humans rather than used for propagation. Several studies have shown that PPV is not transmitted by seed (Pasquini and Barba, 2006; Barba et al., 2011; James, 2017), although the virus has been detected in parts of the seed but not in the embryo (Milusheva et al., 2008). Based on this knowledge, there is a consensus that stone fruit can move freely throughout different world markets, regardless of whether its country of origin is affected by Sharka disease.

The stone fruit industry in Chile has been able to avoid major economic losses caused by the virus, for two main reasons: only the Dideron (PPV-D) strain of PPV is present in the country, which is considered to be non-epidemic or attenuated (Rosales et al., 1996 and 1998; Reyes et al., 2001 and 2003; Fiore et al., 2010 and 2016), and thanks to the dedicated work of the Agricultural and Livestock Service (SAG), the entity responsible for safeguarding plant health in Chile, which since the onset of the disease has maintained strict control of quarantines, production of PPV-free stone fruit plants and orchard surveillance (Resolutions 796, 534 and 4906, available at https://www.sag.cl/ambitos-de-accion/plum-pox-virus-raza-d-enfermedad-de-sharka/normativas). However, the scenario changed due to the detection of PPV-D in Chilean fruit exported to Brazil (Rezende et al., 2016). This caused significant problems for the Chilean industry, as entire shipments of stone fruit were rejected, resulting in significant economic losses. Plums were the most-affected fruit, with 68.8% of the total rejected shipments. On October 3, 2016, Instruction 17 of the Phytosanitary Regulations of the Ministry of Agriculture, Livestock and Supply (MAPA) of Brazil regulated the entry of fruit from countries where Sharka disease is present. It should be noted that currently Instruction 17 is not in force for Chilean fruit. This determination from Brazil was based on scientific studies that show under laboratory conditions aphids can transmit the virus from an infected fruit to a healthy leaf (Labonne and Quiot, 2001; Gildow et al., 2004). Therefore, it is possible that transported fruit infected with PPV-D could be a route of disease transmission. To our knowledge, there are no other reports that corroborate this finding to date, and the scientific community agrees that PPV virus transmission through exported fruit is uncertain (Cambra and Vidal, 2017).

There is evidence that temperature can affect the growth and population of viruses, leading to a decrease in viral RNA at low temperatures (Chung et al., 2015; Singh et al., 2018). Other authors suggest that environmental factors such as vector pressure, feeding preferences, and the availability of the virus in the host should be considered in the epidemiology of the disease (Moreno et al., 2009; Cambra and Vidal, 2017).

Considering these aspects, the generation of new scientific evidence becomes important to elucidate whether or not trade fruits are a route of Sharka disease dissemination. Thus the objective of this study was to compare the relative accumulation of viral titer of PPV-D in freshly harvested fruit to that of fruit subjected to cold storage, simulating transit conditions to export markets.

Sampling source

The samples consisted of fruit from a 6-year-old commercial plum (Prunus domestica L.) cv. Red Lyon orchard located in the Libertador Bernardo O'Higgins region of Chile. To identify trees infected with plum pox virus, leaves were collected from four cardinal points of each tree, individually labeled and kept at a temperature between 8°C and 10°C until further processing. PPV identification in the samples was performed by RT-PCR using universal primers described in the literature (Sánchez-Navarro et al., 2005) (Table 1). Positive trees were marked in the field.

Table 1

Primers for molecular analyses
Organism	Primer name	Sequence 5´- 3´	Fragment Size	Annealing Temperature	Reference
Plum pox virus	PPV-9196 PPV-9506	CAATAAAGCCATTGTTGGATC CTCTGTGTCCTCTTCTTGTG	313pb	50°C	Sánchez-Navarro et al., 2005
Gen nad5	Nad5-F Nad5-R	GATGCTTCTTGGGGCTTCTTGTT CTCCAGTCACCAACATTGGCATAA	181pb	62°C	Menzel et al., 2002

Experimental design

The experiment was carried out during two consecutive seasons (2020–2021 and 2021–2022). During the first season (2020–2021) a total of 36 fruit with evident PPV symptoms were randomly collected at the time of the commercial harvest, from ten trees marked as infected with plum pox virus.

During the second season (2021–2022) the number of samples was increased. A total of fruit with evident PPV symptoms were collected randomly at the time of commercial harvest from twenty-eight trees marked as infected with plum pox virus. The results of from each experiment were analyzed separately, using a completely randomized design.

Treatments

The fruit samples were divided into the following treatments: Treatment 1 (T1): Freshly harvested fruit; Treatment 2 (T2): Fruit harvested and stored at 0°C for 7 days; Treatment 3 (T3): Fruit harvested and stored at 0°C for 15 days. The fruit in the T1 treatment were kept at room temperature for 18 hours before being analyzed. The fruit in the T2 and T3 treatments were packed in plastic boxes with a perforated bag with 0.3% ventilated area and arranged in a honeycomb tray. These were precooled to 4°C for 18 hours and then placed in a regular air cold chamber (atmospheric conditions) at 0°C, with an average of 75% relative humidity.

The relative accumulation of PPV-D RNA in fruit of each treatment was determined using semi-quantitative reverse transcription polymerase chain reaction (RT-PCR).

RNA extraction

Total nucleic acids (TNAs) were extracted from leaf samples using the silica capture method (Foissac et al., 2000) with minor modifications. 100 mg of tissue from each leaf sample was homogenized with 1 mL extraction buffer (4 M guanidinium thiocyanate, 0.2 M sodium acetate, 25 mM EDTA, 1 M potassium acetate, 2.5% (w/v) PVP-40, 1% 𝛃-mercaptoethanol). After centrifugation at 900 g for 4 minutes, 500 µL of the supernatant was mixed with 100 µL of 10% (w/v) N-lauroylsarcosine and incubated at 70°C for 10 minutes with occasional stirring. After another centrifugation at 12,500 g for 6 minutes, 300 µL of the supernatant was mixed with 300 µL of 6 M sodium iodide, 150 µL of 95% ethanol, and 25 µL of 1 g mL^-1 silica. This mixture was incubated for 10 min at room temperature and then centrifuged at 5000g for 1 minute to precipitate the silica. The precipitate was washed twice with 500 µL of wash buffer (20 mM Tris-HCl pH 7.5, 100 mM NaCl, 1 mM EDTA, and 50% ethanol) and centrifuged at 5000g for 1 minute. Finally, 50 µL of nuclease-free water (Molecular Biology Grade Water, Corning™) was added to elute the TNAs and stored at -80°C.

TNAs were extracted from fruit peel using the same procedure as described above, except that 300 mg of peel from the symptomatic zone was taken from each fruit. In Season 1 (2020–2021) 36 fruit were evaluated, with 12 fruit per treatment. In Season 2 (2021–2022) 180 fruit were evaluated, with 60 fruit per treatment.

For each sample (leaves and fruit), the TNAs were treated with DNase (RQ1 RNase-Free DNase, Promega Corporation) to eliminate all DNA. A reaction mixture was prepared with 4 µL of TNAs, 0.5 µL of DNase, 0.5 µL of buffer DNase I 10X (Promega Corporation), and incubated at 37°C for 30 minutes. Then 0.5 µL of stop solution (Promega Corporation) was added to inactivate the DNase, and the reaction mixture was incubated at 65°C for 10 minutes.

RT-PCR and semi-quantitative PCR

cDNA was synthesized by mixing the RNA with 0.4 µL Random Primers (200ng µL^-1, Invitrogen™) and 0.9 µL nuclease-free water (Molecular Biology Grade Water, Corning™), incubating at 70°C for 5 minutes, then cooling on ice for 5 minutes to prevent secondary structure formation. Then we added 4 µL M-MLV 5X reaction buffer (Promega Corp.), 1 µl dNTPs (10mM, Thermo Scientific™), 1 µL M-MLV Reverse Transcriptase (200U µL^-1, Promega Corp.), and 0.5 µL RiboLock RNase Inhibitor (40U µL^-1, Thermo Scientific™), following this thermal protocol: 25°C for 5 minutes, 37°C for 60 minutes, and 70°C for 15 minutes. PPV fragments were amplified using PPV-9196/PPV-9506 primers (Table 1) that amplify fragments of 313 bp. The PCR reaction mixture was prepared as follows: 4 µL 5x GoTaq® Flexi buffer (Promega Corp.), 1.6 µL MgCl₂ solution (25mM, Promega Corp.), 0.4 µL dNTPs (10mM, Thermo Scientific™), 0.4 µL forward primer, 0.4 µL reverse primer (both described in Table 1), 0.13 µL GoTaq® DNA polymerase (5UµL^-1, Promega Corp.), and 2 µL of template. A volume of 20 µL was completed with nuclease-free water (Molecular Biology Grade Water, Corning™). Negative controls were prepared by replacing the template volume with nuclease-free water, and positive controls were prepared using known PPV-infected samples as the template. The PCR cycling conditions were 94°C (3 min) followed by 40 cycles of denaturation at 94°C (30 s), annealing at 50°C (30 s) and extension at 72°C (30 s), with a final extension at 72°C for 7 min.

Semi-quantitative PCR were performed to analyze the fruit samples. A PCR was performed for the constitutive gene nad5 using Nad5-F/Nad5-R primers (Table 1) as an internal control, to determine the levels of PPV RNA relative to this gene. The PCR for PPV was performed using PPV-9196/PPV-9506 primers (Table 1). The same reaction mixture was used for both the PPV and nad5 PCRs. To ensure that differences in the amplified concentration were due to different levels of viral RNA among the samples, an optimization of the number of PCR cycles for each reaction was made; the optimal number of cycles was defined as the number that produced a well-defined band without saturated DNA. The PCR cycling conditions were 94°C (3 minutes) followed by 30 (for nad5) or 24 (for PPV PCR) cycles of denaturation at 94°C (30 seconds), annealing at 50°C or 62°C (30 seconds) (for PPV-9196/PPV-9506 or Nad5-F/Nad5-R respectively) and extension at 72°C (30 seconds), with a final extension at 72°C for 7 minutes. Amplified fragments were observed on 1.5% agarose gels in 0.5X TBE Buffer with 0.05 µL mL^-1 SafeView, using the 100pb GeneRuler™ standard (Fermentas). A volume of 7 µL of the amplified product was loaded, and the gels were run at 90 V for 25 minutes. The gels were analyzed using a transilluminator (WiseDoc WGD-30S, Daihan Scientific Co Ltd, Korea) and the Wise CaptureII program (Daihan Scientific Co).

The results of the semi-quantitative PCR assay were analyzed using ImageJ v1.53f51 software (National Institutes of Health, USA), which can be used to quantify the density of the bands observed in each electrophoresis gel. The values obtained were normalized in relation to the density measured in the samples of the nad5 gene and then graphed in relation to the RNA accumulation in Treatment T1, which served as a control for this purpose.

Statistical analysis and graphic representation

Data from each experiment were analyzed separately using one-way analysis of variance (ANOVA). The PPV/NAD5 ratio was compared between treatments with Tukey’s Honestly Significant Difference test at P ≤ 0.05. All statistical analyses were performed using InfoStat software version 2020 (InfoStat Transfer Center, FCA, National University of Cordoba, Argentina). To graph the relative accumulation of PPV viral RNA between treatments, the average of ratio PPV/Nad5 in the control treatment (T1) was considered as 100%. Therefore, the results of T2 and T3 are represented as percentages relative to the control treatment.

Cycle optimization for each PCR indicated that 30 cycles for the nad5 gene allowed the visualization of an unsaturated amplicon band, while 24 cycles was the optimal condition for PPV (Fig. 1).

The results of the semi-quantitative PCR analysis showed a significant difference (p<0.05) between the relative viral accumulation obtained in the fruit analyzed immediately after harvest (T1) and fruit subjected to a period of cold storage at 0 °C for 7 or 15 days (T2 and T3, respectively). For the first season, the results showed a viral RNA reduction of 50% and 61% in T2 and T3, respectively, compared to T1. For the second season, the corresponding RNA viral reductions were 45% and 56% (Fig. 2 and Fig. 3). These results demonstrate that cold temperatures of 0 °C significantly reduce the viral accumulation in infected fruit.

The report of Labonne and Quiot (2001) demonstrated that aphids are capable of transmitting the virus from infected fruit to a seedling under optimal laboratory conditions. Gildow et al. (2004) suggested that PPV-infected fruit have the potential to serve as a source of inoculum for virus dissemination under laboratory conditions. However, under real field conditions, a number of factors influence and must be taken into account when analyzing epidemiological aspects of the disease and the plant-pathogen interaction (Singh et al., 2018). Moreno et al. (2009) determined that brief probes of feeding on a host can inoculate nearly 26000 viral RNA particles, but with only a 20% chance of resulting in a systemic infection. Electrical Penetration Graph (EPG) tests have shown that only the viral particles retained in the distal anterior part of the aphid stylet are inoculated in the host by the aphid’s salivation process (Fereres, 2007; Blanc et al., 2014). Therefore, the number of viral particles present in the host and available for the vector to acquire is very important. PPV is transmitted in a non-persistent manner (Ilardi and Tavazza, 2015), thus the aphid has the challenge of acquiring particles from PPV-infected fruit and then transmitting it to a plant host within a short period of time, while the virus is still virulent.

The results obtained in this study indicated a decrease in viral RNA due to exposure of infected fruit to low temperatures. This is consistent with data reported in the scientific literature, which show that cold can reduce viral accumulation in plants. Singh et al., (2018) evaluated the effect of four different temperatures on symptom expression and viral RNA accumulation in cowpea plants inoculated with Groundnut Bud Necrosis Virus (GBNV). They found that while viral RNA accumulation increased continuously in infected plants incubated at 25 °C and 30 °C, the viral titer decreased in individuals kept at 20 °C and 15 °C. In this study, the authors not only determined that viral titer decreases with the maintenance temperature of the plant but also affects the systemic movement of the virus. Similar results have been found or other viruses, such as turnip mosaic virus (TuMV). Chung et al. (2015, 2016), showed that viral RNA concentration of TuMV decreases at low temperatures. They also found that the concentration of the coat protein of the TuMV was higher in infected plants incubated at temperatures between 23 and 28 °C and that infection did not prosper at 10 °C. However, it is important to consider that the effectiveness of cold temperatures to reduce the viral content may vary depending on different factors, such as the virus strain, the fruit species and the specific storage conditions, among others. Because of this, more research is needed to understand fully the effectiveness of cold and how it can be appropriately applied in practice.

The results obtained in this study, combined with the information in the literature that shows the relationship between viral RNA concentration in a host and low temperature and the information related to virus-vector and vector-host interactions, suggest that the possibility of transmission of Sharka disease from an infected fruit that has undergone at least 7 days at 0 °C, is very low. Our findings suggest that cold storage of export fruit at 0 °C for at least 7 days may reduce the risk of transmission of Sharka disease by reducing the amount of viral RNA present in the fruit. This result is a valuable precedent when conducting a risk analysis for export fruit that undergoes a period of cold and comes from a country where Sharka disease is present.

The results of this study demonstrate a significant reduction in the percentage of relative accumulation of the transcript of the PPV genome that codes for a region of the coat protein when a period of cold storage is applied to the virus-host. The results were consistent across the two seasons in which this experiment was carried out.

Acknowledgments This work was carried out thanks to the support of the Foundation for Agrarian Innovation (FIA).

Data Availability

The datasets generated during the current study are available from the corresponding author

Funding’ and/or ‘Competing interests

The authors declare that they have no known competing financial interest or personal relationships that could have appeared to influence the work reported in this paper

Authors' contributions

All authors contributed to the study conception and design.

Conceptualization: Mónica Madariaga, Methodology: Isabel Ramírez, Jéssica Devia and Karina Sepúlveda, Formal analysis and investigation: Mónica Madariaga, Writing original draft preparation: Mónica Madariaga; Writing - review and editing: Pablo Meza and Nelly Nova, Statistical analysis Review: Pablo Meza, Funding acquisition: Mónica Madariaga, Resources: Mónica Madariaga Supervision: Mónica Madariaga, Cold storage facilities and supervision: Bruno Defilippi

All authors read and approved the final manuscript.

Barba, M., Hadidi, A., Candresse, T., & Cambra, M. (2011). CHAPTER 36: Plum pox virus. In The American Phytopathological Society eBooks (pp. 185–197). https://doi.org/10.1094/9780890545010.036
Blanc, S., Drucker, M., & Uzest, M. (2014). Localizing viruses in their insect vectors. Annual Review of Phytopathology, 52(1), 403–425. https://doi.org/10.1146/annurev-phyto-102313-045920
Cambra, M., & Vidal, E. (2017). Sharka, a vector-borne disease caused by Plum pox virus: vector species, transmission mechanism, epidemiology and mitigation strategies to reduce its natural spread. Acta Horticulturae, 1163, 57–68. https://doi.org/10.17660/actahortic.2017.1163.10
Chung, B. N., Choi, K. S., Ahn, J. J., Joa, J. H., Seck, K., & Park, K. (2015). Effects of Temperature on Systemic Infection and Symptom Expression of Turnip mosaic virus in Chinese cabbage (Brassica campestris). Plant Pathology Journal (Suwon), 31(4), 363–370. https://doi.org/10.5423/ppj.nt.06.2015.0107
Chung, B. N., Canto, T., Tenllado, F., Choi, K. S., Joa, J. H., Ahn, J. J., Kim, C. H., & Seck, K. (2016). The Effects of High Temperature on Infection by Potato virus Y, Potato virus A, and Potato leafroll virus. Plant Pathology Journal (Suwon), 32(4), 321–328. https://doi.org/10.5423/ppj.oa.12.2015.0259
Fereres, A. (2007). The role of aphid salivation in the transmission of plant viruses. Phytoparasitica, 35(1), 3–7. https://doi.org/10.1007/bf02981054
Fiore, N., Araya, C., Zamorano, A., González, F., Mora, R., Sánchez-Navarro, J., Pallás, V., & Rosales, I. M. (2010). Tracking Plum pox virus in Chile throughout the year by three different methods and molecular characterization of Chilean isolates. Julius-Kühn-Archiv, 427, 156–161. https://ojs.openagrar.de/index.php/JKA/article/view/426
Fiore, N., Zamorano, A., Pino, A.M., González, F., Rosales, I.M., Sánchez-Navarro, J.A., & Pallás, V. (2016). Survey of stone fruit viruses and viroids in Chile. Journal of Plant Pathology, 98(3):631–635. http://www.jstor.org/stable/44280512.
Foissac, X., Svanella-Dumas, L., Dulucq, M., Candresse, T., & Gentit, P. (2001). Polyvalent detection of fruit tree Tricho, Capillo and Faveaviruses by nested RT-PCR using degenerated and inosine containing primers (PDO RT-PCR). Acta Horticulturae, 550, 37–44. https://doi.org/10.17660/actahortic.2001.550.2
Garcı́a, J. A., Glasa, M., Cambra, M., & Candresse, T. (2014). Plum pox virus and sharka: a model potyvirus and a major disease. Molecular Plant Pathology, 15(3), 226–241. https://doi.org/10.1111/mpp.12083
Gildow, F. E., Damsteegt, V. D., Stone, A. L., Schneider, W. L., Luster, D. G., & Lévy, L. (2004). Plum pox in North America: identification of aphid vectors and a potential role for fruit in virus spread. Phytopathology, 94(8), 868–874. https://doi.org/10.1094/phyto.2004.94.8.868
Ilardi, V., & Tavazza, M. (2015). Biotechnological strategies and tools for Plum pox virus resistance: trans-, intra-, cis-genesis, and beyond. Frontiers in Plant Science, 6. https://doi.org/10.3389/fpls.2015.00379
James, D. (2017). Perspective on strategies for controlling the spread of Plum pox virus, causal agent of sharka/plum pox disease. Acta Horticulturae, 1163, 129–136. https://doi.org/10.17660/actahortic.2017.1163.19
Labonne, G., & Quiot, J. B. (2001). Aphids can acquire plum pox virus from infected fruits. Acta Horticulturae, 550, 79–84. https://doi.org/10.17660/actahortic.2001.550.8
Menzel, W., Wilhelm, J., & Maiß, E. (2002). Detection of four apple viruses by multiplex RT-PCR assays with coamplification of plant mRNA as internal control. Journal of Virological Methods, 99(1–2), 81–92. https://doi.org/10.1016/s0166-0934(01)00381-0
Milusheva, S., Gercheva, P., Bozhkova, V., & Kamenova, I. (2008). Experiments on transmission of plum pox virus through Prunus seeds. Journal of Plant Pathology, 90:S23–S26. http://www.jstor.org/stable/41998436.
Moreno, A., Fereres, A., & Cambra, M. (2009). Quantitative estimation of plum pox virus targets acquired and transmitted by a single Myzus persicae. Archives of Virology, 154(9), 1391–1399. https://doi.org/10.1007/s00705-009-0450-5
Pasquini, G., & Barba, M. (2006). The question of seed transmissibility of Plum pox virus. Eppo Bulletin, 36(2), 287–292. https://doi.org/10.1111/j.1365-2338.2006.00989.x
Reyes, F., Reyes, M., Sepúlveda, P., Herrera, G., Hinrichsen, P., López‐Moya, J. J., & Prieto, H. B. (2001). New insights on Plum pox virus present in Chile. Acta Horticulturae, 550, 135–140. https://doi.org/10.17660/actahortic.2001.550.19
Reyes, F., Fiore, N., Reyes, M., Sepúlveda, P., Paredes, V., & Prieto, H. (2003). Biological Behavior and Partial Molecular Characterization of Six Chilean Isolates of Plum pox virus. Plant Disease, 87(1), 15–20. https://doi.org/10.1094/pdis.2003.87.1.15
Rezende, J. a. M., Camelo‐García, V. M., & Kitajima, E. W. (2016). First Report on Detection of Plum pox virus in Imported Peach Fruits in Brazil. Plant Disease, 100(4), 869. https://doi.org/10.1094/pdis-09-15-1015-pdn
Rosales, M., Hinrichsen, P., & Herrera, G. (1996). PCR-specific detection of a Plum pox virus (PPV) isolate in Chile. Agricultura Técnica, 56,89-98.
Rosales, M., Hinrichsen, P., & Herrera, G. (1998). Molecular characterization of Plum pox virus isolated from apricots, plums and peaches in Chile. Acta Horticulturae, 472, 401–406. https://doi.org/10.17660/actahortic.1998.472.47
Sánchez‐Navarro, J. A., Aparicio, F., Herranz, M. C., Minafra, A., Myrta, A., & Pallás, V. (2005). Simultaneous detection and identification of eight stone fruit viruses by one-step RT-PCR. European Journal of Plant Pathology, 111(1), 77–84. https://doi.org/10.1007/s10658-004-1422-y
Singh, A., Permar, V., Basavaraj, Tomar, B. S., & Praveen, S. (2018). Effect of Temperature on Symptoms Expression and Viral RNA Accumulation in Groundnut Bud Necrosis Virus Infected Vigna unguiculata. PubMed, 16(3), e1846. https://doi.org/10.15171/ijb.1846

Download PDF

Version 1

posted

You are reading this latest preprint version

Effect of storage temperature on viral RNA accumulation in plum pox virus-infected cv. Red Lyon plum fruit growing in the Central Valley of Chile

Status:

Version 1

Abstract

Figures

Introduction

Material and methods

Results and discussion

Conclusions

Declarations

References

Status:

Version 1