Laminin α5β2γ1 promotes uterine stromal cells' mesenchymal-epithelial transition during decidualization

doi:10.21203/rs.3.rs-3592521/v1

Download PDF

Research Article

Laminin α5β2γ1 promotes uterine stromal cells' mesenchymal-epithelial transition during decidualization

https://doi.org/10.21203/rs.3.rs-3592521/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Decidualization is critical to pregnancy in primates and rodents. Endometrial stromal cells undergo the mesenchymal-epithelial transition to transform into decidual stromal cells to provide nutrition and support vascularization during decidualization. Laminins, as the main component of the epithelial basement membrane, regulate cellular adhesion, growth, migration, and differentiation. Our previous study showed that laminin α5β2γ1 strongly expressed in mouse decidua. However, the regulation and function of laminin α5β2γ1 during endometrium decidualization are still unknown. Here, our study reveals robust expression of laminin α5β2γ1 in mice and artificially induced mice deciduoma. And laminin α5β2γ1 is also upregulated during mice and human in vitro decidualization. We demonstrate that progesterone regulates the expression of laminin α5β2γ1 during in vitro decidualization in mice. Interestingly, coated-laminin α5β2γ1 promotes the mesenchymal-epithelial transition in mouse and human uterine stromal cells.

laminin α5β2γ1

mesenchymal-epithelial transition

decidualization

uterine stromal

The processes of embryo implantation and endometrium decidualization are pivotal for establishing pregnancy in both rodents and humans, primarily regulated by ovarian hormones. [1]. During implantation and decidualization, the uterine stromal undergoes extensive remodeling. The fibroblast like endometrial stromal cells undergo differentiate into epithelial like decidual stromal cells, a process known as mesenchymal - epithelial transition (MET), and deposit various epithelial basement membrane (BM) components in the extracellular matrix [2, 3]. However, the precise mechanism of EMT in decidualization is still not fully understood.

Laminins are trimeric proteins that are composed of α, β, and γ chains, serving as major constituents of BMs. In mammals, at least 16 laminin isoforms exist [4]. Among these isoforms, laminin α5β2γ1, the most prevalent isoform in adult tissues, garnered significant attention due to its capacity to support stem cell self-renewal [5, 6]. In our prior studies, we observed a substantial increase in laminin α5β2γ1 during mouse early pregnancy. However, the precise regulatory mechanisms and functions of laminin α5β2γ1 during decidualization remain undisclosed.

In the present study, we observed that laminin α5, β2, and γ1 are significantly upregulated in mice uterine stromal cells after decidualization or artificial decidualization. We also discovered that progesterone plays a pivotal role in regulating laminin α5β2γ1 expression in mouse uterine stromal cells. Furthermore, laminin α5β2γ1 promotes EMT in both mouse and human uterine stromal cells EMT during decidualization.

Animals

All mouse procedures were conducted in accordance with approved protocols from the Shanxi Agricultural University Institutional Animal Care and Use Committee. Mature mice (ICR strain, 6 weeks old) were purchased from Slack Laboratory Animal Co., LTD (Hunan, China) and were housed in an SPF environment (12h light). To induce pseudopregnancy or pregnancy, female mice were mated overnight with either vasectomized or fertile males, and the day of observing the vaginal plug was considered day 1. During day 5 of pregnancy, implantation sites were distinguished through tail vein injections of 0.1 mL 1% Chicago Blue solution (2610-05-1, Sigma-Aldrich, USA). Artificial decidualization was performed as previously described [7]. Briefly, on day 4 pseudopregnancy of the mice was induced by injecting 0.01mL sesame oil (8008-74-0, Aladdin, China) into one uterine horn, and uterine samples were collected on day 8.

Mouse endometrial stromal cells isolate and treat

Cells were isolated following established methods [8]. Briefly, the uteri were obtained by euthanizing the mice through spinal dislocation on day 4. Subsequently, the uteri were longitudinally split and digested in 5 mL of Hanks' balanced salt solution (HBSS, Sigma-Aldrich) containing 6 mg/mL neutral dispase (04942078001, Roche, USA) and 1% trypsin (97063-884, Amresco, USA). The digestion process involved incubation for 1 hour at 4°C, followed by 1 hour at 22°C, and a final 10-minute step at 37°C. After epithelial fragments were removed, mouse uteri were treated with 0.15 g/L collagenase I (17100017, Gibco, USA) in HBSS at 37°C for 30 minutes and subjected to 20 to 30 shakes. The supernatant was then centrifuged for 5 minutes at 1200 rpm, and the cell pellets were washed and cultured in DMEM / F12 (D0547, Sigma-Aldrich) containing 10% fetal bovine serum (FBS, 10270106, Thermo Fisher Scientific Inc., USA).

Using 1 µM progesterone (57-83-0, P4, Sigma-Aldrich) and 10 nM estradiol-17β (50-28-2, E2, Sigma-Aldrich) with 2% cFBS (charcoal-treated FBS, 12676029, Thermo Fisher Scientific Inc.) in DMEM/F12 for inducing in vitro decidualization. We followed the protocol for the coating plate. Briefly, diluted the LN521 (LN521-02, BioLamina AB, Sweden) stock solution with DPBS (Ca²⁺/Mg²⁺) to 5µg/mL. Then, the diluted solution was added to cover the surface, keeping the plate at 4°C overnight. Seeding cells into the plate after removing the solution.

Human endometrial stromal cells culture and treat

In this study, we used the telomerase-immortalized human endometrial stromal cells (T HESCs, ATCC, CRL-4003 ™, USA). T HESCs were cultured with 10% cFBS in DMEM/F12. In vitro decidualization of T HESCs as previously described [9]. In brief, T HESCs cells were treated with 0.5 mM dibutyryl cAMP (db-cAMP, 16980-89-5, Sigma-Aldrich) and 0.001 mM medroxyprogesterone acetate (71-58-9, MPA, Sigma-Aldrich) in 2% cFBS in DMEM/F12.

Real-time quantitative polymerase chain reaction (qPCR)

qPCR was conducted and analyzed as previously mentioned [10]. In this study, total RNAs were extracted by TRIzol (Accurate, AG21101, China). Subsequently, the RNAs were reverse transcribed into cDNAs with the HiScript kit (R222-01, Vazyme, China). qPCR was carried out with CFX96 qPCR System (Bio-Rad, USA) and LightCycler® 480 Instrument II (Roche) using ChamQ SYBR qPCR kit (Q711-02, Vazyme). The data were analyzed using the 2^−△△CT method and normalized to Rpl7 (mouse) or RPL7 (human). The qPCR primer sequences are listed in Table 1.

Table 1

Sequences of primers were used in this study.
Gene	Primer sequences (5' to 3')	Accession number	Size (bp)	Application
Lama5	CCAAACTGCAACAAGAATG	NM_001081171.2	87	qPCR
	GTAGACGCACCAGCAGAG3
Lamb2	CTGGTGACCAACCGAGAGAC	NM_008483.3	305	qPCR
	CAGCGCAGTAGCAGGTCATA
Lamc1	CGGAGTTTGTTAATGCCGCC	NM_010683.2	126	qPCR
	TCGGCCTGGTTGTTGTAGTC
Prl8a2	AGCCAGAAATCACTGCCACT	NM_010088	119	qPCR
	TGATCCATGCACCCATAAAA
Cdh1	AGCCTCATATCATCACCATC	NM_009864.3	167	qPCR
	GTATTCGCCAATCTCTAAGTC
Rpl7	GCAGATGTACCGCACTGAGATTC	NM_011291.5	129	qPCR
	ACCTTTGGGCTTACTCCATTGATA
IGFBP1	CCAAACTGCAACAAGAATG	NM_001013029	87	qPCR
	GTAGACGCACCAGCAGAG
RPL7	CTGCTGTGCCAGAAACCCTT	NM_000971	194	qPCR
	TCTTGCCATCCTCGCCAT

Immunofluorescence

Immunofluorescence was conducted following the previously described [11]. Briefly, the frozen sections were fixed in 4% PFA (Paraformaldehyde, 158127, Sigma-Aldrich) in PBS. Then, permeabilization with 0.1% Triton X-100 (9036-19-5, Sigma-Aldrich) in PBS for 20 minutes, and blocking with 10% FBS at 37°C for 1 hour. Following this, the sections were incubated overnight at 4°C with anti-laminin α5 (1:1000, ab184330, Abcam, USA), anti-laminin β2 (1:1000, 05-206, Sigma-Aldrich), or anti-laminin γ1 (1:1000, ab233398, Abcam). The sections were incubated with the secondary antibody conjugated with FITC (Invitrogen, USA) for 1 hour. And we used DAPI (1:1000, D8417, Sigma-Aldrich) for counterstain. Images were captured by the Leica TCS SP8 Confocal System (Leica, Germany).

Western blot

Western blot analysis was performed as previously mentioned [12]. Briefly, proteins were extracted using RIPA lysis buffer. After measuring the concentration of samples by BCA Protein Assay Kits (23225, Thermo Fisher Scientific Inc.), the samples were separated by electrophoresis on a 10% SDS-PAGE gel and subsequently transferred to the PVDF membrane The membranes were then blocked with 5% non-fat milk (BBI Life Sciences, China) and incubated overnight at 4°C with the primary antibodies. Primary antibodies used in this study included anti-laminin α5 (1:1000, ab184330, Abcam), anti-laminin β2 (1:1000, ab277521, Abcam), anti-laminin γ1 (1:1000, ab233398, Abcam), anti-E-cadherin (1:1000, 3195S, Cell Signaling Technology (CST), USA), anti-N-cadherin (1:1000, 13116S, CST), and anti-α-tubulin (1:2000, 2144S, CST). ECL chemiluminescent kits from Merck (WBULS0500, Germany) were used for detecting the signals.

RNA sequencing and data analysis

RNA sequencing was using Illumina Novaseq6000 by Gene Denovo Biotechnology Co. (China). Differential expression analysis of RNAs was carried out using edgeR software for comparisons between two samples [13]. Transcripts with a false discovery rate (FDR) parameter below 0.05 and an absolute fold change of at least 2 were considered as differentially expressed transcripts. All raw transcriptome data has been deposited in the NCBI SRA database (BioProject ID: PRJNA1033268).

Statistical analysis

For all experiments, we conducted at least three independent repetitions, except for RNA sequencing. The data presented are the mean ± standard deviation. Student's t-test was used to compare differences between the two groups, while a one-way ANOVA test was used for multiple comparisons. Statistical significance was defined as p < 0.05.

Laminin α5, β2, and γ1 expression in the uterus during mice early pregnancy

Our qPCR results showed Lama5, b2, and c1 were significantly upregulated in mouse uteri after embryo implantation (Fig. 1A). Immunofluorescence results indicated that laminin α5, β2, and γ1 were robustly expressed in decidua stromal cells during mouse decidualization (Fig. 1B). To determine whether the expression of laminin α5β2γ1 is affected by the activated embryo, we use the artificial decidualization model. Our results demonstrated that laminin α5, β2, and γ1 were significantly up-regulated on deciduoma compared to control uterine in mice (Fig. 1C to E).

Laminin α5β2γ1 expression during mice in vitro decidualization and progesterone regulates laminin α5β2γ1 expression in mice endometrial stromal cells

To investigate the potential involvement of laminin α5β2γ1 in mouse decidualization, we performed in vitro decidualization. The expression of prolactin family 8, subfamily A, member 2 (Prl8a2), a well-established marker for mouse decidualization [14], was encouraged during in vitro decidualization (Fig. 2A), which means our induction system was robust. In this study, laminin α5, β2, and γ1 were significantly increased under mouse uterine stromal cells in vitro decidualization (Fig. 2A and B). Our previous data indicated that laminin α5 was regulated by progesterone [15]. Based on this, we hypothesized that laminin β2 and γ1 might also be regulated by progesterone. Our western blot and qPCR results demonstrated that progesterone strongly promoted the laminin α5, β2, and γ1 expression, this effect was abolished by RU486 (Mifepristone), a progesterone receptor antagonist (Fig. 2C and D).

Laminin α5β2γ1 promotes mesenchymal-epithelial transition in mouse and human uterine stromal cells

We initially investigated the impact of laminin α5β2γ1 recombinant protein (LN521) on the in vitro decidualization process. Our results indicated that adding LN521 to the medium harmed in vitro decidualization (Fig. 3A). Given that LN521 has been used to maintain stem cell self-renewal by coating LN521 on the plate before seeding cells [5]. We also prepared LN521-coated plates for mouse uterine stromal cells. One day after seeding the cells, the morphology of the LN521-coated cell appeared similar compared to the control group (Fig. 3B). Interestingly, western blot results showed that E-cadherin was remarkably promoted while N-cadherin was decreased after using the LN521-coated plate (Fig. 3C). Although coated-LN521 did not affect the in vitro decidualization, the expression of Cdh1 (coding E-cadherin) was significantly encouraged (Fig. 3D). Collectively, these results revealed that LN521 promotes MET in mouse endometrial cells. We also used RNA sequencing to verify this finding. The heat map indicated that epithelial-related genes were remarkably up-regulated in mouse uterine stromal cells after incubation the LN521 (Fig. 3E).

Next, we investigated the involvement of laminin α5β2γ1 in human decidualization. Our western blot analysis results revealed increased expression of laminin α5, β2, and γ1 during in vitro decidualization of human endometrial cells (Fig. 3F). These findings indicate that laminin α5β2γ1 may also have a role in the process of human decidualization. Insulin growth factor binding protein 1 (IGFBP1), a well-established marker for human decidualization [16]. Additionally, qPCR results demonstrated that direct addition of LN521 into the medium inhibited in vitro decidualization (Fig. 3G). Likewise, coated-LN521 did not affect the in vitro decidualization and cell morphology (Fig. 3H and I). Interestingly, they did lead to an increase in E-cadherin expression and decrease in N-cadherin expression (Fig. 3J). Our results indicated that LN521 promotes MET in both mouse and human uterine stromal cells.

Endometrial decidualization, a transient and vital process that serves as a bridge between embryo implantation and placentation, plays a pivotal role in ensuring the successful of pregnancy. It’s characterized by fibroblast-like endometrial cells transformation into epithelial-like decidual stromal cells, a process that involves MET [17]. However, decidual structure is dynamic, transient, and complex, it is not fully understood. Laminins, as the major component of epithelial cell BM, was shown to be involved in cytoskeletal remodeling and uterine decidualization in mouse endometrial stromal cells [18]. Our previous data showed that laminin α5β2γ1 strongly increased during the mouse early pregnancy after implantation. However, the regulation of laminin α5β2γ1 during decidualization is not investigated. To our knowledge, our study first showed that laminin α5β2γ1 were strongly upregulated in uterine stromal cells during human and mouse decidualization.

The progesterone-progesterone receptor signaling pathway plays a critical role in controlling decidualization during early pregnancy [19, 20]. Steroid hormone-regulated transcription factor CCAAT enhancer-binding protein β have shown to regulate the laminin γ1 during decidualization [18]. Our lab previously reported that laminin α5 was regulated by progesterone. RU486 significantly inhibit the progesterone-stimulated laminin α5 expression in ovariectomized mice [15]. In this study, we found that progesterone is a critical mediator for laminin α5β2γ1 during decidualization.

Laminin α5β2γ1 (LN521) became popular for chemically defined and feeder-free cultivation of human pluripotent stem cells recently [21]. LN521/E-cadherin matrix can facilitate the generation of human embryonic stem cell lines from embryo and maintained for several months for cell renewal [5]. Additionally, LN521 has been found to promote the proliferation of hepatic progenitor cells [22] and contribute to hepatic specification in human embryonic stem cell-derived definite endoderm cells [23]. Furthermore, LN521 also suggested to promote hepatic stellate cell quiescence in rat [24]. Using thermoresponsive (N-isopropylacrylamide) and LN521 coated plate, Sung et al. developed a promising method for induce human pluripotent stem cells to cardiomyocytes and purification them [25]. Recent research shows that LN521-coated dishes promote osteogenic differentiation in human pluripotent stem cell-derived mesenchymal stem cells [26]. In our study, although LN521-coated plate did not affect the decidualization in vitro, LN521 encouraged MET in both mouse and human endometrial stromal cells. Recent single-cell spatial enhanced resolution omics-sequencing studies in mouse early pregnancy revealed that MET process involved in endometrial decidualization. Specifically, MET-related genes, Lama5, Lamb2, and Lamc1 were found to be highly expressed during the transdifferentiation process of decidual stromal cells [17]. These findings align with our perspective. Integrins are heterodimer proteins with α and β subunits in mammals and as the primary receptor for laminins [27]. It has become clear that laminins-integrins interaction plays a pivotal role in cell differentiation, proliferation, migration, and survival [28]. Specifically, the interaction of LN521 with integrin α5β1 has been demonstrated to be involved in shear stress-induced release of hepatocyte growth factor [29]. Our RNA sequencing data showed Itga2b, Itgb4 and Itgb6 expression were increased after coating LN521 in mouse endometrial stromal cells. This suggests that integrin α2b, β4 and β6 may be implicated in the induction of MET in endometrial stromal cells by LN521.

The epithelial-to-mesenchymal transition (EMT) is an essential process in cancer cell metastasis. Tumor cells progressively lose the epithelial phenotype, change the cell-matrix adhesion, remodel the cytoskeleton, and become a mesenchymal-like cell, which improves cell motility during EMT [30]. Although some studies showed that LN521 promotes self-renewal in colorectal cancer cell [31], our study suggests an alternative perspective. Based on our study, we propose that the development of new biomaterials, such as nano films containing LN521, may have the potential to inhibit the migration of cancer cells in vitro and in vivo, possible use to cancer therapy.

In conclusion, we showed that laminin α5, β2, and γ1 were robustly expressed in human and mouse decidual stromal cells in vitro and in vivo. Progesterone regulated laminin α5, β2, and γ1 during mouse in vitro decidualization. Laminin α5β2γ1 promotes the MET process during in vitro decidualization. Further deciphering the mechanism of laminin α5β2γ1 in endometrial stromal cells and cancer cells may provide the basis for improving fertility and cancer therapy.

BM: Basement membrane

EMT: Epithelial-mesenchymal transition

LN521: Laminin α5β2γ1 recombinant protein

MET: Mesenchymal-epithelial transition

Ethics approval and consent to participate

Not applicable.

Consent for publication

The authors declare that they have no conflict of interest.

Availability of data and materials

Data will be made available on request.

Competing interests

The authors declare that they have no conflict of interest.

Funding

This work was supported by the grants from the Fundamental Research Program of Shanxi Province (No.202203021222172), the University Science and Technology Innovation Project of the Shanxi Province (No.2021L170), the Shanxi Province Excellent Doctoral Work Award-Scientific Research Project (No.SXBYKY2021040), and the Science and Technology Innovation Program of Shanxi Agricultural University (No.2021BQ05).

Author’s contributions

Peng-Chao Wang: Conceptualization, Methodology, Investigation, Data curation, Writing- Original draft preparation and editing; Tao Fu: Methodology, Data curation, Writing- Original draft preparation and editing; Juan Xie: Data curation, Writing- Original draft preparation and editing; Zhenshan Yang: Conceptualization, Methodology, Investigation, Data curation, Writing- Original draft preparation, Writing- Reviewing and Editing, Supervision. All authors have read and agreed to the published version of the manuscript.

Acknowledgments

We kindly thank Ms. Haiyang Pan for her support in this study.

Wang, H. and S.K. Dey, Roadmap to embryo implantation: clues from mouse models. Nat Rev Genet, 2006. 7(3): p. 185-99.
Jones-Paris, C.R., et al., Embryo implantation triggers dynamic spatiotemporal expression of the basement membrane toolkit during uterine reprogramming. Matrix Biol, 2017. 57-58: p. 347-365.
Owusu-Akyaw, A., et al., The role of mesenchymal-epithelial transition in endometrial function. Hum Reprod Update, 2019. 25(1): p. 114-133.
Yap, L., et al., Laminins in Cellular Differentiation. Trends Cell Biol, 2019. 29(12): p. 987-1000.
Rodin, S., et al., Clonal culturing of human embryonic stem cells on laminin-521/E-cadherin matrix in defined and xeno-free environment. Nat Commun, 2014. 5: p. 3195.
Aumailley, M., The laminin family. Cell Adh Migr, 2013. 7(1): p. 48-55.
Gu, X.W., et al., Blastocyst-induced ATP release from luminal epithelial cells initiates decidualization through the P2Y2 receptor in mice. Sci Signal, 2020. 13(646).
Yang, C., et al., Female reproductive abnormalities in mouse adolescent pregnancy. Reproduction, 2021. 162(5): p. 353-365.
Wang, P.C., et al., Tryptophan and kynurenine stimulate human decidualization via activating Aryl hydrocarbon receptor: Short title: Kynurenine action on human decidualization. Reprod Toxicol, 2020. 96: p. 282-292.
Chen, S.T., et al., Embryo-derive TNF promotes decidualization via fibroblast activation. Elife, 2023. 12.
Li, Y., et al., The regulation and function of acetylated high-mobility group box 1 during implantation and decidualization. Front Immunol, 2023. 14: p. 1024706.
Song, Z., et al., Caveolin-1 Regulation and Function in Mouse Uterus during Early Pregnancy and under Human In Vitro Decidualization. Int J Mol Sci, 2022. 23(7).
Robinson, M.D., D.J. McCarthy, and G.K. Smyth, edgeR: a Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics, 2010. 26(1): p. 139-40.
Kimura, F., et al., Messenger ribonucleic acid for the mouse decidual prolactin is present and induced during in vitro decidualization of endometrial stromal cells. Gynecol Endocrinol, 2001. 15(6): p. 426-32.
Yang, Z.S., et al., Regulation and Function of Laminin A5 during Mouse and Human Decidualization. Int J Mol Sci, 2021. 23(1).
Al-Sabbagh, M., et al., NADPH oxidase-derived reactive oxygen species mediate decidualization of human endometrial stromal cells in response to cyclic AMP signaling. Endocrinology, 2011. 152(2): p. 730-40.
Yang, M., et al., Spatiotemporal insight into early pregnancy governed by immune-featured stromal cells. Cell, 2023. 186(20): p. 4271-4288.e24.
Ramathal, C., et al., Transcription factor CCAAT enhancer-binding protein beta (C/EBPbeta) regulates the formation of a unique extracellular matrix that controls uterine stromal differentiation and embryo implantation. J Biol Chem, 2011. 286(22): p. 19860-71.
Cope, D.I. and D. Monsivais, Progesterone Receptor Signaling in the Uterus Is Essential for Pregnancy Success. Cells, 2022. 11(9).
Large, M.J. and F.J. DeMayo, The regulation of embryo implantation and endometrial decidualization by progesterone receptor signaling. Mol Cell Endocrinol, 2012. 358(2): p. 155-65.
Rodin, S., et al., Monolayer culturing and cloning of human pluripotent stem cells on laminin-521-based matrices under xeno-free and chemically defined conditions. Nat Protoc, 2014. 9(10): p. 2354-68.
Ma, M., et al., p53 positively regulates the proliferation of hepatic progenitor cells promoted by laminin-521. Signal Transduct Target Ther, 2022. 7(1): p. 290.
Kanninen, L.K., et al., Laminin-511 and laminin-521-based matrices for efficient hepatic specification of human pluripotent stem cells. Biomaterials, 2016. 103: p. 86-100.
Rohn, F., et al., Laminin-521 promotes quiescence in isolated stellate cells from rat liver. Biomaterials, 2018. 180: p. 36-51.
Sung, T.C., et al., Efficient differentiation of human pluripotent stem cells into cardiomyocytes on cell sorting thermoresponsive surface. Biomaterials, 2020. 253: p. 120060.
Tian, Z., et al., Effect of extracellular matrix proteins on the differentiation of human pluripotent stem cells into mesenchymal stem cells. J Mater Chem B, 2022. 10(30): p. 5723-5732.
Pang, X., et al., Targeting integrin pathways: mechanisms and advances in therapy. Signal Transduct Target Ther, 2023. 8(1): p. 1.
Halder, S.K., A. Sapkota, and R. Milner, The impact of genetic manipulation of laminin and integrins at the blood-brain barrier. Fluids Barriers CNS, 2022. 19(1): p. 50.
Rohn, F., et al., Impaired integrin α(5) /β(1) -mediated hepatocyte growth factor release by stellate cells of the aged liver. Aging Cell, 2020. 19(4): p. e13131.
Pastushenko, I. and C. Blanpain, EMT Transition States during Tumor Progression and Metastasis. Trends Cell Biol, 2019. 29(3): p. 212-226.
Qin, Y., et al., Laminin 521 enhances self-renewal via STAT3 activation and promotes tumor progression in colorectal cancer. Cancer Lett, 2020. 476: p. 161-169.

No competing interests reported.

Westernblot.zip

Download PDF

Version 1

posted

You are reading this latest preprint version

Laminin α5β2γ1 promotes uterine stromal cells' mesenchymal-epithelial transition during decidualization

Status:

Version 1

Abstract

Figures

Background

Methods

Animals

Mouse endometrial stromal cells isolate and treat

Human endometrial stromal cells culture and treat

Real-time quantitative polymerase chain reaction (qPCR)

Immunofluorescence

Western blot

RNA sequencing and data analysis

Statistical analysis

Results

Laminin α5, β2, and γ1 expression in the uterus during mice early pregnancy

Laminin α5β2γ1 promotes mesenchymal-epithelial transition in mouse and human uterine stromal cells

Discussion

Conclusions

Abbreviations

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1