Biodiversity and antifungal activities of actinomycetes isolated from the rhizosphere of Inga edulis in an urban forest fragment of the amazon

doi:10.21203/rs.3.rs-3597253/v1

Download PDF

Research Article

Biodiversity and antifungal activities of actinomycetes isolated from the rhizosphere of Inga edulis in an urban forest fragment of the amazon

https://doi.org/10.21203/rs.3.rs-3597253/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Actinobacteria are major producers of antibacterial and antifungal metabolites and are targets of increasing research in the search for substances of biotechnological interest, especially for use in agriculture. The Amazon soils is potentially rich in actinobacteria; therefore, we prospected actinobacteria from the rhizospheres of three individuals of Inga edulis found on the campus of the Federal University of Amazonas, the largest urban forest fragment in the Amazon. We isolated 64 strains of actinobacteria, which were distributed in 16 morphogroups. A total of 20 strains representing these 16 groups were subjected to morphological analysis, genotyping using the 16S rRNA gene, and assays against pathogenic fungi of important agricultural plants in the region that also cause annual losses of millions of dollars to world agriculture. Using GenBank-NCBI and EzBioCloud data, 90% of the strains were identified as Streptomyces and 10% as Kitasatospora, indicating at least 16 different species and possible new species. All showed antagonisms for two or more phytopathogen strains of Corysnepora cassiicola, Colletotrichum sp., Colletotrichum guaranicola, Pestalotiopsis sp., and Sclerotium coffeicola. Two stood out for their broad spectrum and better results against phytopathogens of the guarana plant (Paullinia cupana), an important crop for the regional economy and one of the best sources of caffeine in the world, whose powder is used in the food industry and traditional medicine. Complementary analyses ratified the potential of these strains as sources of highly effective antifungal substances. In general, the results exemplify the high diversity and richness of the actinomycetes in the Amazon.

Rhizobacteria

actinobacteria

biodiversity

agricultural development

biocontrol of phytopathogens

In the last decade, prospection of new isolates of actinomycetes that produce natural products (NPs) has been carried out in virtually every ecosystem on the planet. The screening of strains isolated from these environments, mainly by paired culture methods and biological assays with extracts, have revealed many of them to be promising sources of NPs of biotechnological interest (Alkhalifah 2021; Chevrette et al. 2019; Elshafie and Camele 2022; Liu et al. 2019 (a); Pavan et al. 2018; Rego et al. 2019; Xie and Pathom-Aree 2021). These prospections are a result of the scarcity of medicinal and agricultural resources to stop the spread of multidrug-resistant human pathogens and plant pests that ravage plantations in all parts of the planet. These pathogens compromise agricultural production and are due to the large-scale use of biocides that are employed to meet the growing food needs in the 20^th and 21^st centuries (Butler et al. 2023; Djebaili et al. 2021; Oyedoh et al. 2023; Priyashantha and Tibpromma 2023; Saeed et al.2021; Strobel et al. 2004).

The cosmopolitanism of actinomycetes is strictly related to their essential ecological activities for the planet and other living beings, such as nitrogen fixation, recycling of organic matter, and the secretions of phytohormones, antibiotics, lytic enzymes and biocontrol agents of phytoprages, among others. These activities make them great allies of plants through endophytic-epiphytic relationships and as rhizobacteria (Liu et al. 2019 (a); Liu et al. 2019 (b); Liu et al. 2019 (c)). In fact, actinomycetes maintain symbiotic systems with plants, secreting protective antimicrobials against phytopathogens and hormones that induce plant growth and feeding on nutrients released by plants, which makes them strong candidates for biocontrol agents and natural fertilizers (Djebaili et al. 2021; Saeed et al.2021). The potential of these microorganisms against fungal phytopathogens, which have attracted the attention of many researchers seeking new antifungals and more sustainable methods for agriculture, should be highlighted (Oyedoh et al. 2023).

Among the microorganisms that produce NPs, actinomycetes stand out for being responsible for the production of 70% of the antimicrobials available to medicine and agriculture (Bérdy 2012; Sharma and Thakur 2020). The genus Streptomyces is the best known and largest producer of NPs, with about 7,500 of the more than 10,000 NPs assigned to the more than 200 genera of the phylum Actinobacteria (Barka et al. 2016; Bérdy 2005; Law et al. 2019). Other genera, among them Micromonospora, Kitasatospora, and Nocardia, however, are gaining more and more interest in the search for new NPs (Takahashi 2017; Yan et al. 2022), especially the antifungal compounds whose best-known class for this group of microorganisms is that of macrolides (Kim et al. 2012; Nara et al. 2017; Wang et al. 2017).

Regarding biodiversity, the largest currently recognized genera are Streptomyces, with approximately 700 species (Komaki 2023), Micromonospora, with 110 species (Yan et al. 2022), and Kitasatospora, with 23 species (Takahashi 2017). In general, phenotypically, these bacteria are gram-positive, have aerial mycelia or an absence of mycelia, have segments with cylindrical, spherical, and ovoid shapes and spore chains that are spiral (or partially) and linear (Shirling and Gottlieb 1972). Their genomes are rich in guanine-cytosine, with sizes ranging between 8 and 9 million base pairs (BP) of nucleotides, and hold dozens of clusters of biosynthetic genes (BGCs) related to the synthesis of NPs (Van Bergeijk et al. 2020). Whole genome sequencing and DNA-DNA hybridization are the most-used techniques for taxonomic definitions at the species level. In addition to the traditional 16S rRNA marker, currently, other markers are used to increase reliability in taxonomic definitions in the absence of the total genome sequence, for example, atpD, gyrB, recA, rpoB and trpB (Komaki 2023).

In this perspective, we investigated the diversity of a sample of actinomycetes isolated from the rhizospheres of three individuals of Inga edulis present on the campus of the Federal University of Amazonas (UFAM), the largest urban forest fragment in the Amazon and, at 670 hectares, one of the largest in the world, which potentially houses an incalculable and almost unexplored microbial diversity. The antifungal potential of these actinomycetes against phytopathogens of regional and global interest was also evaluated, among which stand out phytopathogens of the guarana plant (Paullinia cupana), one of the largest commercial sources of caffeine, and Sclerotium coffeicola, a phytopathogen recognized worldwide for affecting hundreds of plants of agricultural importance. This study is part of a larger project that seeks to collect, preserve, identify, and comprehend the biodiversity and potential applications of microorganisms from the Amazon, particularly from the campus at UFAM.

Soil sample collections

Three collections were carried out at different points on the UFAM campus (Point 1 - 3°05'19.4" S 59°58'00.5" W, Point 2 - 3°05'20.8" S 59°57'57.5" W and Point 3 - 3° 5'19.06"S 59°57'56.26"W), in which there were individuals of I. edulis that were not the period of seedpod production. At each point, three rhizosphere samples were collected at distances of 40 cm from the collar of the plant and 20 cm below in piliferous regions of the roots. Sterilized materials were used in all sample collections: 50 mL Falcon^TM tubes, metal spatulas and plastic bags to transport the samples. The samples were collected and taken to the Laboratory of Bioassays and Microorganisms of the Amazon (LaBMicrA) - UFAM, where they were stored at -20 ºC.

Isolation and purification of actinobacterium strains

All the manipulations of the microorganisms in this study were performed in a biological safety cabin (Filterflux^® Class II A1). Twenty-four hours after the collections, 1 g of soil from a sample of each of the points was dissolved in 5 mL of sterilized distilled water containing 0.02% Tween-20. One mL of each suspension was subjected to serial decimal dilution in test tubes containing 9 mL of 0.8% saline. From the 5^th, 4^th and 3^rd dilutions, 50 µL were spread in triplicate in 90 x 15 mm Petri dishes containing the oat-based culture medium (for 1 L: 10 g of oats, 14 g of agar, 10 g of malt, 4 g of yeast extract, and 4 g of glucose) and ISP2 culture medium (for 1 L: 10 g of starch, 14 g of agar, 10 g of malt, 4 g of yeast extract, and 4 g of glucose), to which 100 µg/mL of the antifungals nystatin and tetracycline were added. This was followed by incubation in a BOD chamber at 28 ± 2 ºC for a period of 30 days, during which the strains of actinomycetes that grew were isolated and purified.

Microculture and microscope analysis

The isolated and purified actinobacteria were subjected to microcultures (adapted from Shirling and Gottlieb 1972) and were stained using the Gram method (LB Laborclin^®). In summary, the spores of the purified strains were sown in 40 x 15 mm Petri dishes containing their respective isolation media; 18 x 18 mm coverslips were tilted at 45º over the streaks. After 96 hours of incubation at 28 ± 2 ºC in a BOD chamber, the coverslips were removed and attached with plastic tape to 26 x 76 mm slides; then they were subjected to the Gram staining method. All the stained slides were observed under an optical microscope with the 100x objective (Carl Zeiss optical microscope, coupled to Zen AxioCamER - Zen lite 2012 photo documenter).

Conservation, selection, and morphological description of the strains of actinobacteria

For the conservation, the strains of actinobacteria were cultured in a solid medium (as described in Section 2.2) for 10 days. Five fragments of each colony were preserved in triplicates in 1.5 mL microtubes containing 20% glycerol. All the microtubes were stored in a freezer at -80 ºC and are preserved in the LaBMicrA microorganism collection at the UFAM’s Analytical Center. As selection criteria and for the definition of the group of biotechnological studies, the macromorphological aspects of isolates grown in ISP2 were observed. The strains were registered in the National System for the Management of Genetic Heritage and Associated Traditional Knowledge (SisGen) under the number AC1746C. After cultivation in ISP2 culture medium, the selected strains were described morphologically according to the manuals of Shirling and Gottlieb (1972). In the macromorphological aspects, we observed the patterns of the pigmentation of the pseudohyphae, dorsal-dishes and types of edges of the colonies – the colors of the pseudohyphae and dorsal dishes were determined using the ISCC/NBS color system (available at https://www.w3schools.com/colors/colors_nbs.asp).

Phytopathogens selected to evaluate the antifungal potential of the actinobacteria

To evaluate the antifungal potential of the actinobacteria, five phytopathogens were chosen, which were kindly provided by the Laboratory of Microbiology and Phytopathology of the Faculty of Agricultural Sciences (FCA) at UFAM: Colletotrichum sp. (habanero-type pepper-ISO01) isolated from leaf tissue lesions of habanero-type pepper plants (Capsicum chinense); C. guaranicola (guarana plant-P01) and Pestalotiopsis sp. (guarana plant-3002R2) isolated from leaf tissue lesions of different guarana plants (Paullinia cupana); Corynespora cassicola (tomato plant-ISO079) isolated from leaf tissue lesions of tomato plants (Solanum lycopersicum); and Sclerotium coffeicola (Mango tree-M01) isolated from leaf tissue lesions of mango trees (Mangifera indica). These plants, especially guarana, are of economic importance to the Amazon region and to rest of the world.

DNA extraction, PCR, sequencing and phylogenetic analysis

For DNA extraction, the selected strains of actinobacteria were cultured in 125 mL Erlenmeyer flasks containing 30 mL of potato, dextrose and yeast extract (PDY) medium (Souza et al. 2004), at 28 ± 2 °C and 120 rpm, for 72 h. The extractions followed the protocol of the Zymo Research Fungal/Bacterial DNA MicroPrep™kit. The DNAs were quantified in a spectrophotometer (NanoDrop, Thermo Scientific) and their integrities were recorded using electrophoresis with 0.8% agarose gel. The polymerase chain reaction (PCR) was performed using 20 ng of DNA, the PCR kit Illustratm PuReTaq Ready-to-GoTM PCR beads (GE Healthcare) and the primers 27F AGAGTTTGATCMTGGCTCAG and 1492R CGGTTACCTTGTTACGACTT (Haygood & Davidson 1997), with a final volume of 25 µL, in a 96-well thermal cycler (Applied Biosystems) (Ebrahimi-Zarandi et al. 2021). The amplified product was visualized in electrophoresis with 1% agarose gel, stained with GelRed™, using the Invitrogen^®1 Kb Plus DNA Ladder base pair marker, and photo-documented using the L-Pix Touch Loccus^®Photo-documentation system. Amplicons were purified with the enzyme ExoSAP-IT (GE Healthcare). The samples were sequenced using the Sanger method and the BigDye Terminator kit (Applied Biosystems).

The products of the partial sequencing of the 16S rRNA gene were compared with the sequences retrieved from the GenBank databases (NCBI) using the BLASTn alignment (http://www.ncbi.nlm.nih.gov/BLAST/Blast.cgi) and EzBioCloud (https://www.ezbiocloud.net/). The alignment of the sequencing products was performed using CLUSTAL W (MEGA 11 (Molecular Evolutionary Genetics Analysis). Subsequently, a phylogenetic tree was constructed using the evolutionary analysis by the maximum likelihood method using the neighbor-joining and BioNJ (Tamura-Nei, 1993) algorithms and the bootstrap test with a maximum of 1,000 replications ((MEGA 11, available at www.megasoftware.net) (Felsenstein 1985; Tamura et al. 2021). Accession numbers generated by NCBI are available in the Supplementary Material (MS 1).

Screening using the paired cultures method

After being reactivated in ISP2, the actinomycete strains were inoculated linearly, from one end to the other, passing through the center, in new Petri dishes containing ISP2, and incubated at 28 ± 2 ºC in a BOD chamber. Two days previously, the pathogen lines were inoculated in PDA (Souza et al. 2004). On the fifth day of growth of the pathogens and third of the actinomycetes, discs of agar of 5 mm in diameter containing the phytopathogens were removed from the culture in PDA and inoculated at one centimeter from the edges, perpendicularly in relation to the line containing the bacterial inocula, in the dishes with ISP2. At one centimeter from one of these inocula, a cavity was made by removing a 10 mm wide strip of the culture medium from one edge to the other, parallel to the bacterial line, in order to verify the possible production of antifungal volatile substances (Fig.5). Similar control dishes were also made with ISP2, which contained only each phytopathogen at two opposite poles and separated by a 10 mm cavity. All paired cultures were made in triplicate and incubated for 10 days, in order to observe the possible inhibition of pathogens by the actinomycetes. A stacked bar graph was constructed from the means of the inhibition zones of each triplicate using the GraphPad Prism version 8.0.1.

Production curves of the extracts

The strains Streptomyces spp. LaBMicrA B270 (OR724732) and B280 (OR724701), which were selected from the bioassay of paired cultures, were cultured for 96 h in Petri dishes with ISP2 and 1.5% microbiological agar, from which two fragments of 5 x 5 mm were inoculated in an Erlenmeyer flask of 250 mL containing 120 mL of ISP2, with a total of 36 flasks. The strains were grown at 120 rpm and 28 ± 2 ºC. During incubation, three Erlenmeyer flasks of each strain were collected at scheduled intervals, totaling 12 samples in triplicate at intervals of 12 h, 24 h, 36 h, 48 h, 72 h, 120 h, 168 h, 216 h, 264 h, 312 h, 360 h, and 408 h. At each interval, glucose consumption and pH were measured, and intra- and extracellular extracts were obtained, the masses of which were used for the construction of the production curves of the extracts and biological assays.

To obtain the extracts at each interval, the biomass and cultured medium of each flask were separated via centrifugation (Eppendorf^® centrifuge) at 4,000 rpm for 15 min, and then the biomass was washed three times with 10 mL of distilled water. The biomasses were then vortexed and macerated for 24 h with 5 mL of 1:1 MeOH/AcOEt. The cultured medium was partitioned with successive volumes of 40, 30, and 30 mL of AcOEt/2-propanol 9:1, which were then pooled. After evaporation of the solvents, the extracts were weighed, dried in a desiccator with activated silica, and weighed again, until they reached a constant weight, in order to establish the average values of the triplicate of each point. After this, the three extracts from each point were collected, concentrated, weighed, and stored at 4 ºC until the day of the bioassays.

Assays of the extracts from the points of the curve against phytopathogens

Only the extracts collected from the cultured medium of each of the twelve points of the growth curve of the Streptomyces spp. LaBMicrA B270 (OR724732) and B280 (OR724701) strains were tested against the target phytopathogens. To the flasks containing the dried and weighed extracts, 200 µL of DMSO were added and, after being dissolved, 800 µL of autoclaved distilled water were added. From these solutions, stock solutions were made by diluting aliquots corresponding to 20 mg of each dry extract in sterilized distilled water, reaching a final volume of 1 mL. As a positive control, 20 mg of nystatin was dissolved in 1 mL of water. Phytopathogens were reactivated in Petri dishes containing potato, dextrose, agar and yeast extract (PDAY) ulture medium (Souza et al. 2004) at 28 ± 2 ºC for 96 h, in a BOD chamber. The extract and control assays were performed in triplicate in cell culture plates with 12 wells, containing: test: 0.950 mL PDAY, 50 µL extract + phytopathogen; negative control: 1 mL PDAY + phytopathogen; positive control: 0.950 mL PDAY, 50 µL nystatin solution + phytopathogen. The solutions of the extract or control with the culture medium were homogenized at approximately 40 ºC. For the inoculation of the pathogens in the wells, discs (5 mm in diameter) of the culture in PDAY were used in each of them. The assays were observed for 10 days.

Production of the extracts and minimum inhibitory concentration assay

From the results of the growth curves and bioassays, new extracts of LaBMicrA B270 (OR724732) and B280 (OR724701) strains were prepared, which were cultivated for 10 days using cultivation and extract production methods similar to those described above (Section 2.8.). In the production of the extracts, the only difference was the lyophilization of the cultured medium after partition with AcOEt/2-propanol 9:1. The concentrated extracts and lyophilized material were stored at -18 ºC. To determine the minimum inhibitory concentration (MIC), the AcOEt/2-propanol 9:1 and MeOH/AcOEt 1:1 extracts and the aqueous lyophilized material were successively diluted to the concentrations of: 1,000, 500, 250, 125, 62.5, 31.25, 15.63 and 7.81 µg/mL. The extracts were tested with the phytopathogens in a similar way to what is described in the previous item.

Morphological and genotypic diversity

From the three rhizospheres of the I. edulis trees, respectively found at the three collection points (P1, P2 and P3) of the UFAM campus (Fig.1), 64 actinomycetes were isolated using oat-based and ISP2 culture media. Among these points, P2 stood out for the largest number of isolates, 30 isolates (46.9%), followed by P1 with 19 isolates (29.7%), and P3 with 15 isolates (23.4%).

Fig.1

The observations of the macromorphology and the pigmentation of the culture media in the Petri dishes (front and back) allowed us to preliminarily group the 64 isolated actinobacteria into 16 morphogroups. The 20 strains selected, one from each smaller group and two from each of the larger group of morphologically similar individuals, and the respective macro- and micromorphological descriptions according to the criteria established in Section 2.4, were tabulated according to the collection point; these being: seven from P1 (green), ten from P2 (orange) and three from P3 (blue) (Table 1). The photos of the macro and micromorphologies, shown in the photos of the Streptomyces spp. LaBMicrA B270 (OR724732) and B280 (OR724701) (Fig. 2), whose antifungal activities stood out among the others (see below), can be observed in the Supplementary Material (SM 1).

(Fig. 2)

The amplicons obtained from the 20 selected strains and subjected to sequencing had extensions of approximately 1400 bp of the 16S rRNA gene. The sequenced amplicons presented viable sequences with 650-800 nucleotides. The greatest similarities of these sequences with those deposited in the NCBI databases (https://blast.ncbi.nlm.nih.gov/Blast.cgi) and EzBioCloud (https://www.ezbiocloud.net/) revealed that 18 strains are of the genus Streptomyces (90%) and two of the genus Kitasatospora (10%) (Table 1). The following strains presented amplicons with similarities (greater than 99%) to a single strain in one or both databases: Streptomyces spp. LaBMicrA B280, B289, and B290 in GenBank-NCBI; Streptomyces spp. LaBMicrA B310 and B322 in EzBioCloud; and Streptomyces spp. LaBMicrA B267 and B314 in both databases. Among them, only Streptomyces sp. LaBMicrA B314 had the same species suggestion, S. olivaceus (NBRC 12805, 99.61% in GenBank-NCBI and NRRL B-3009, 99.74% in EzBioCloud). Four other strains, all with similarities over 90% and below 99%, had a single suggested species in both databases: Streptomyces spp. LaBMicrA B278 (S. misionensis), B304 (S. pulveraceus), and B318 (S. similanensis) and Kitasatospora sp. LaBMicrA B282 (K. acidiphila). Three strains showed similarity below 90% in at least one database: Streptomyces spp. LaBMicrA B272 (in both), B289 (EzBioCloud) and B299 (GenBank). Among them, the strain Streptomyces sp. LaBMicrA B272 stands out as the strongest candidate for a new (or not yet deposited) species, with low similarity with S. acidicola K1PN6 (88.60%) and S. sundarbansensis MS1/7 (78.35%). Eight strains, six of Streptomyces and two of Kitasatospora, presented more than one suggestion of species with equal weight: four in both databases, two in GenBank and two in EzBioCloud. More than 50% of the 20 strains present similarity values lower than 98% in both databases (Table 1).

(Table 1).

Phylogeny

In the phylogenetic analysis using the 20 strains of this study and 29 strains of the GenBank-NCBI database, a tree was obtained considering only the values of the nodes from 50% of the bootstrap (Fig.3). The phylogenetic differences between the Streptomyces (90%) and Kitasatospora (10%) strains only occurred in the root of the tree, with a bootstrap value of less than 50% (not shown) in five monophyletic clades: one formed exclusively by Kitasatospora strains, including the two in this study, three with only Streptomyces strains, including six in this study, and a larger one, containing almost exclusively Streptomyces strains, including the remaining 12 of this study. Four strains (Streptomyces LaBMicrA B304, B310, and B325, below 50%, and B318, at the limit of 50%) are the least phylogenetically connected with the GenBank strains. Conversely, four strains (Kitasatospora LaBMicrA B282 and Streptomyces LaBMicrA B272, B322, and B289) presented phylogenetic indices of 99-100% with at least one of the strains in this database. All the others are between these two extremes. Of all the strains, Streptomyces LaBMicrA B325 is the only one that emerges alone from the root of the tree and does not align with any of its five GenBank species suggestions, all of which have 99% similarity (Table 1).

(Fig.3).

Antifungal activities of the 20 strains against phytopathogens

In the screening using the paired cultures method, all the 20 strains showed antagonism against the phytopathogens Corysnepora cassiicola (ISO079) and Colletotrichum sp. (ISO01) (Figs. 4 and 5). Thirteen were active against Pestalotiopsis sp. (3002R2), the same amount was antagonistic against Colletotrichum guaranicola (P01). Only the strains Streptomyces sp. LaBMicrA B267, B280, and B301 showed antagonism against S. coffeicola (M01) and were also the only ones active against the five phytopathogens.

(Fig.4).

The strains Streptomyces spp. LaBMicrA B270 (OR724732) and B280 (OR724701) stood out for their strong antagonism against Colletotrichum guaranicola (P01) and Pestalotiopsis sp. (3002R2), respectively, both phytopathogens of the guarana plant (P. cupana) (Fig.5). No consistent signs of volatile metabolite activities of any actinobacterium against the phytopathogens were observed.

(Fig.5).

Production curves of the extracts and evolution of antifungal activities of the strains Streptomyces sp. LaBMicrA B270 and B280

The strains Streptomyces spp. LaBMicrA B270 (OR724732) and B280 (OR724701), selected due to their promising results in the previous tests, presented production curves of intra- and extracellular extracts that were compatible with the traditional bacterial growth curves (Fig.6). Behavior that was also compatible was the glucose concentration that reached a level close to zero coincident with the beginning of the period of maximum production of the extracts. Interestingly, the behavior of the pH was quite distinct for the two strains: the first reaching a maximum of eight in this period and only falling again in the period of decline, while the second maintained pH 6.5 during all the stages. The decline phases in both curves began between 240 and 288 h of culture (10 and 12 days). The extract yields in the ISP2 medium cultured on the tenth day were respectively 542 and 720 mg/L for Streptomyces spp. LaBMicrA B270 (OR724732) and B280 (OR724701).

(Fig.6).

In the assays against the five phytopathogens, the AcOEt/2-propanol 9:1 fractions of the cultured medium of the two strains from each point sampled showed antifungal activities after 36 hours of growth (Point 3), with the exception that the strain LaBMicrA B270 was confirmed as not being active against S. coffeicola (M01). The activities were confirmed for the other sampling points, until the beginning of the decline phases, which were observed in the respective production curves of the extracts.

Minimum inhibitory dosage assays

In minimum inhibitory dosage assays of extracts with 10 days of growth of the strains Streptomyces spp. LaBMicrA B270 (OR724732) and B280 (OR724701), the best results were obtained with the acetate/isopropanol fractions of the partition of the cultured media (Table 2). Confirming the previous assays, B280 showed activity against all the phytopathogens and B270 did not show activity for S. coffeicola (M01). Except in this case, the acetate/isopropanol fractions showed fungicidal activity at the minimum dosages of 250 or 125 µg/mL and, only below that, did they become fungistatic or inactive. In turn, the extracts of the bacterial biomasses in acetate/methanol showed much weaker activity and to only two or three strains. Finally, no activity was observed in the aqueous fractions of the cultured medium after partitioning with acetate/isopropanol.

(Table 2).

In this study, a small sample of actinomycetes isolated from the rhizospheres of three individuals of I. edulis present in the campus of UFAM, which is the largest urban fragment of the Amazon rainforest, was evaluated for its diversity and antifungal potential. High biodiversity was revealed from the initial macromorphological analysis that resulted in 16 groups in the universe of the 64 strains of actinomycetes collected, which equates to an average of one group for every four strains. Similarly, although the sequences of the 16S rRNA gene revealed a low diversity of genera, only Streptomyces (90%) and Kitasatospora (10%), the diversity of species seems to be very high, if one considers the suggestions of the GenBank-NCBI and EzBioCloud databases: seven different species for the eight strains with sequences over 99% similar to at least one of these databases and nine species different from each other and from the previous ones for the 12 strains with similarities below 99%. Thus, only four strains had suggestions of species already suggested for others 20 sequenced strains. Considering that these 20 strains are representatives of the 16 groups of the 64 strains, there is the possibility of at least one different species for every four strains, which should be confirmed in the future by complete sequencing of the genomic DNA.

The phylogenetic analysis not only confirms the high diversity of the strains of this study, among them and also in relation to those deposited in GenBank, but also reveals cases of high phylogenetic distance, mainly represented by the five strains with 50% or less possibility of clustering. Conversely, four other strains had high phylogenetic indices among themselves or with strains from this database, which reveals the high degree of preservation of the 16S rRNA gene inherited from their common ancestors. Despite the 16S rRNA marker (27F and 1492R (Haygood & Davidson (1997)) not being the gold standard in the taxonomic identification of this group of microorganisms, the possibility of new species can be considered due to this gene having the most evolutionarily conserved region among bacteria (Komaki 2023; Takahashi 2017). Thus, this possibility is greater among the more than 50% of the strains with similarities below 98% to those of GenBank and EzBioCloud and especially among the three with similarity below 90% in at least one of these databases.

Added to the rich biodiversity in this sample of actinomycetes is the potential for their application, which is particularly observed in the antifungal assays of the 20 strains against phytopathogens of agricultural importance, namely Colletotrichum sp. ISO01, C. guaranicola P01, Pestalotiopsis sp. 3002R2, Corynespora cassiicola ISO079 and Sclerotium coffeicola M01. These phytopathogens are reported to cause problems that generate millions of dollars in losses for agriculture. Corynespora cassiicola is widely cited as a disease-causing agent in more than 530 plant species of 380 different genera (Ma et al. 2018) and is a mycosis-causing infectious agent in humans working with vegetable crops (Huang et al. 2010). According to O'Connell et al. (2012), the genus Colletotrichum is responsible for diseases in more than 3,200 plant species. The genus Pestalotiopsis harbors several species of biotechnological interest (Maharachchikumbura et al. 2011; Sun et al. 2014), but some species are reported to be phytopathogens (Deng et al. 2013; Liotti et al. 2018; Marimuthu et al. 2020). S. coffeicola has a high impact on agricultural production and is responsible for lesions in Indian mulberry (Morinda citrifolia L.) leaves (Gasparotto et al. 2019) and mango trees (Mangifera sp.), which are important plants for traditional medicine and in the food and cosmetic industries (Gupta et al. 2022; Ribeiro and Schieber 2010).

The antagonistic results achieved in the in vitro assays, which are a prerequisite in methodologies that are currently under development within a more sustainable agricultural model (Oyedoh et al. 2023), confirm the broad capacity of Streptomyces species to fight other microorganisms, particularly fungi, and indicate that all 20 strains can be sources of antifungal substances. The production curve assays and concomitant evolution of antifungal activities of periodic extracts from the strains Streptomyces spp. LaBMicrA B270 (OR724732) and B280 (OR724701), as well as the minimum inhibitory dosage tests, ratified their potential and suggest highly effective antifungal substances, considering their probable low concentration in these extracts. Chemical studies are being conducted to reveal the active ingredients of the extracts of these strains, which potentially have a broad antifungal spectrum and are strong candidates to combat the phytopathogens Colletotrichum guaranicola (P01) and Pestalotiopsis sp. (3002R2), which threaten the guarana plant (P. cupana), a very important crop in the economy of Amazonian communities. It is one of the best sources of caffeine in the world, and the powdered form is used in the production of soft drinks, as a food supplement and in traditional medicine (Marques et al. 2019). In addition, B280 was also active against Sclerotium coffeicola M01, a phytopathogen that is recognized worldwide for affecting hundreds of plants of agricultural importance.

The development of less harmful, more ecologically correct, and more sustainable methods for agriculture depends on the availability of microorganisms that promote biocontrol and fertilization. Actinomycetes are cited in several studies as being excellent fertilizers, nitrogen fixers, and producers of various lytic enzymes, phytohormones and antimicrobials; as well as siderophores (Liotti et al. 2019; Liu et al. 2019 (a); Liu et al. 2019 (b); Strobel et al. 2004; Oyedoh et al. 2023). In this context, according to the results obtained in the present work, actinomycetes from the rhizosphere of I. edulis represent a viable alternative for sustainable agriculture. Furthermore, the qualities mentioned above for actinomycetes and the results in this work may be related to the success of I. edulis as an ecological vector, which is used in South America in mixed crops and forest management that favor plants of economic importance (Nichols and Carpenter 2006; Piato et al. 2021; Piato et al. 2022; Sobanski and Marques 2014; Iglesias et al. 2011). It is possible that this success is due, in part, to rhizotopic actinomycetes transported via seeds or seedlings from one soil to another and that I. edulis plants, when growing, also spread them through the litter that they commonly generate in abundance (AbdElgawad et al. 2020; Hardoim et al. 2015; Jayasinghe andParkinson, 2008; Shahzad et al. 2018). This possibility, however, needs to be investigated.

In this study, it was revealed that the rhizospheres of three individuals of I. edulis harbor a rich diversity of actinomycetes with great potential against phytopathogenic fungi that commonly ravage plantations of numerous crops of global economic importance. Twenty strains showed antifungal activities against at least two phytopathogens, especially the two strains Streptomyces spp. LaBMicrA B270 (OR724732) and B280 (OR724701), whose extracts showed fungicidal activities at low concentrations, revealing them to be sources of metabolites with potent antifungal activities. These results are an encouraging example of the richness of actinomycetes that are associated with I. edulis in the Amazon, and they should be explored as potential producers of bioactive metabolites, especially against phytopathogenic fungi, and for the development of microbial products to be used in agriculture around the world. Moreover, the possibility of new species was signaled by the genotyping results, and these will be subsequently investigated. This study is thus further evidence of the vast biodiversity in the Amazon and reinforces the need to preserve it.

Acknowledgments

We would like to thank the Universidade Federal do Amazonas (UFAM) and the Programa de Pós-graduação em Biotecnologia and Biodiversidade da Amazonia (PPG-Bionorte) for their support. This work was funded by the Fundação de Amparo à Pesquisa do Estado do Amazonas (FAPEAM) via the call 007/2021 - Programa Biodiversa and project POSGRAD 2021/2022, and Coordenação de Aperfeiçoamento de Pessoal de Nível Superior - CAPES (Finance code 001). The authors also acknowledge the FAPEAM for the PhD scholarship awarded to Rafael de Souza Rodrigues and the Conselho Nacional de Desenvolvimento Científico e Tecnológico – CNPq for the research grant awarded to ADLS.

Financing

The authors declare that no type of funding was received during the preparation of this manuscript

Competing interests

The authors have no relevant financial interests to disclose

Author contributions

Rafael de Souza Rodrigues: project development and manuscript preparation; Anderson Nogueira Barbosa: data analysis; Sarah Raquel Silveira da Silva Santiago: assistance with morphological identification; Roneres Deniz Barbosa and Jania Lilia da Silva Bentes: isolations and identifications of phytopathogens; Thalita Caroline Lima Alves: biological assays; Jeferson Chagas da Cruz: molecular identification; Gilvan Ferreira da Silva: technical and financial support; Antonia Queiroz Lima de Souza and Afonso Duarte Leão de Souza: technical and financial support, methodology, supervision and preparation of the manuscript.

Data availability

Data are contained in the article or Supplementary Material MS 1.

Ethics approval

The strains were registered in the National System for the Management of Genetic Heritage and Associated Traditional Knowledge (SisGen) under the number AC1746C

Consent to participate

This study did not involve human beings in its experiments.

AbdElgawad, H., Abuelsoud, W., Madany, M. M., Selim, S., Zinta, G., Mousa, A. S., Hozzein, W. N. (2020). Actinomycetes enrich soil rhizosphere and improve seed quality as well as productivity of legumes by boosting nitrogen availability and metabolism. Biomolecules, 10(12), 1675. https://doi.org/10.3390/biom10121675
Alkhalifah, D. H. M., 2021. Sponge-associated sp. RM66 metabolome induction with N-acetylglucosamine: Antibacterial, antifungal and anti-trypanosomal activities. Saudi Journal of Biological Sciences, 28(8), 4691-4698. https://doi.org/10.1016/j.sjbs.2021.04.082
Barka, E. A., Vatsa, P., Sanchez, L., Gaveau-Vaillant, N., Jacquard, C., Klenk, H. P., van Wezel, G. P., 2016. Taxonomy, physiology, and natural products of Actinobacteria. Microbiology and molecular biology reviews, 80(1), 1-43.https://doi.org/10.1128/MMBR.00019-15
Bérdy, J., 2005. Bioactive microbial metabolites. The Journal of Antibiotics, 58(1), 1-26.
Bérdy, J. (2012). Pensamentos e factos sobre antibióticos: onde estamos agora e para onde vamos. O Jornal de antibióticos, 65 (8), 385-395. https://doi.org/10.1038/ja.2012.27
Butler, M. S., Henderson, I. R., Capon, R. J., Blaskovich, M. A. (2023). Antibiotics in the clinical pipeline as of December 2022. The Journal of Antibiotics, 1-43. https://doi.org/10.1038/s41429-023-00629-8
Chevrette, M. G., Carlson, C. M., Ortega, H. E., Thomas, C., Ananiev, G. E., Barns, K. J., Currie, C. R. (2019). The antimicrobial potential of Streptomyces from insect microbiomes. Nature communications, 10(1), 516. https://doi.org/10.1038/s41467-019-08438-0
Dalmas, F. R., Astarita, L., DeFilippis, L., Magel, E., Fiedler, H. P., Bauer, R., Hampp, R. (2013). Growth inhibition of an Araucaria angustifolia (Coniferopsida) fungal seed pathogen, Neofusicoccum parvum, by soil streptomycetes. BMC microbiology, 13(1), 1-10. https://doi.org/10.1186/1471-2180-13-168
Deng, J. X., Sang, H. K., Hwang, Y. S., Lim, B. S., Yu, S. H. (2013). Postharvest fruit rot caused by Pestalotiopsis sp. on grape in Korea. Australasian Plant Disease Notes, 8, 111-114. https://doi.org/10.1007/s13314-013-0109-7
Djebaili, R., Pellegrini, M., Ercole, C., Farda, B., Kitouni, M., Del Gallo, M., 2021. Biocontrol of soil-borne pathogens of Solanum lycopersicum L. and Daucus carota L. by plant growth-promoting actinomycetes: in vitro and in planta antagonistic activity. Pathogens, 10(10), 1305. https://doi.org/10.3390/pathogens10101305
Ebrahimi-Zarandi, M., Bonjar, G. H. S., Riseh, R. S., El-Shetehy, M., Saadoun, I., Barka, E. A. (2021). Exploring two Streptomyces species to control Rhizoctonia solani in tomato. Agronomy, 11(7), 1384. https://doi.org/10.3390/agronomy11071384
Elshafie, H. S., Camele, I. (2022). Rhizospheric actinomycetes revealed antifungal and plant-growth-promoting activities under controlled environment. Plants, 11(14), 1872. https://doi.org/10.3390/plants11141872
Felsenstein J. (1985). Limites de confiança em filogenias: Uma abordagem usando o bootstrap. Evolução 39:783-791.
Gasparotto, L., Catarino, A. D. M., da Silva, G. F. (2019). Mancha concêntrica: nova doença do noni, causada por Sclerotium coffeicola. Embrapa, Comunicado Técnico 143 Manaus, AM Dezembro.
Gamaleldin, N. M., Bakeer, W., Sayed, A. M., Shamikh, Y. I., El-Gendy, A. O., Hassan, H. M., Hozzein, W. N. (2020). Exploration of chemical diversity and antitrypanosomal activity of some red sea-derived actinomycetes using the OSMAC approach supported by LC-MS-based metabolomics and molecular modelling. Antibiotics, 9(9), 629. https://doi.org/10.3390/antibiotics9090629
Hao, X., Li, S., Wang, G., Li, J., Peng, Z., Zhang, Y., Gan, M. (2022). Zelkovamycins F and G, Cyclopeptides with Cα-Methyl-threonine Residues, from an Endophytic Kitasatospora sp. Journal of Natural Products, 85(7), 1715-1722. https://doi.org/10.1021/acs.jnatprod.2c00174
Haygood, M. G., Davidson, S. K. (1997). Small-subunit rRNA genes and in situ hybridization with oligonucleotides specific for the bacterial symbionts in the larvae of the bryozoan Bugula neritina and proposal of" Candidatus Endobugula sertula". Applied and environmental microbiology, 63(11), 4612-4616.
Gupta, A. K., Gurjar, P. S., Beer, K., Pongener, A., Ravi, S. C., Singh, S., Verma, D. K. (2022). A review on valorization of different byproducts of mango (Mangifera indica L.) for functional food and human health. Food Bioscience, 48, 101783. https://doi.org/10.1016/j.fbio.2022.101783
Hardoim, P. R., Van Overbeek, L. S., Berg, G., Pirttilä, A. M., Compant, S., Campisano, A., ... & Sessitsch, A. (2015). The hidden world within plants: ecological and evolutionary considerations for defining functioning of microbial endophytes. Microbiology and molecular biology reviews, 79(3), 293-320. https://doi.org/10.1128/mmbr.00050-14
Huang, H. K., Liu, C. E., Liou, J. H., Hsiue, H. C., Hsiao, C. H., Hsueh, P. R. (2010). Subcutaneous infection caused by Corynespora cassiicola, a plant pathogen. Journal of Infection, 60(2), 188-190. https://doi.org/10.1016/j.jinf.2009.11.002
Iglesias, L., Salas, E., Leblanc, H. A., & Nygren, P. (2011). Response of Theobroma cacao and Inga edulis seedlings to cross-inoculated populations of arbuscular mycorrhizal fungi. Agroforestry systems, 83, 63-73. https://doi10.1007/s10457-011-9400-9
Jayasinghe, B. D., & Parkinson, D. (2008). Actinomycetes as antagonists of litter decomposer fungi. Applied soil ecology, 38(2), 109-118. https://doi.org/10.1016/j.apsoil.2007.09.005
Kim, D. G., Moon, K., Kim, S. H., Park, S. H., Park, S., Lee, S. K., Oh, D. C. (2012). Bahamaolides A and B, antifungal polyene polyol macrolides from the marine actinomycete Streptomyces sp. Journal of natural products, 75(5), 959-967. https://doi.org/10.1021/np3001915
Komaki, H. (2023). Recent Progress of Reclassification of the Genus Streptomyces. Microorganisms, 11(4), 831. https://doi.org/10.3390/microorganisms11040831
Law, J. W. F., Chan, K. G., He, Y. W., Khan, T. M., Ab Mutalib, N. S., Goh, B. H., Lee, L. H., 2019. Diversity of Streptomyces spp. from mangrove forest of Sarawak (Malaysia) and screening of their antioxidant and cytotoxic activities. Scientific reports, 9(1), 1-15. https://doi.org/10.1038/s41598-019-51622-x
Liu, C., Zhuang, X., Yu, Z., Wang, Z., Wang, Y., Guo, X., Huang, S. (2019). Community structures and antifungal activity of root-associated endophytic Actinomicetoof healthy and diseased soybean. Microorganisms, 7(8), 243. https://doi.org/10.3390/microorganisms7080243 (a)
Liu, D., Yan, R., Fu, Y., Wang, X., Zhang, J., Xiang, W. (2019). Antifungal, plant growth-promoting, and genomic properties of an endophytic actinobacterium Streptomyces sp. NEAU-S7GS2. Frontiers in microbiology, 10, 2077. (b) https://doi:10.3389/fmicb.2019.02077
Liu, Y., Ponpandian, L. N., Kim, H., Jeon, J., Hwang, B. S., Lee, S. K., Bae, H. (2019). Distribution and diversity of bacterial endophytes from four Pinus species and their efficacy as biocontrol agents for devastating pine wood nematodes. Scientific Reports, 9(1), 12461. (c) https://doi.org/10.1038/s41598-019-48739-4
Liotti, R. G., da Silva Figueiredo, M. I., Soares, M. A. (2019). Streptomyces griseocarneus R132 controls phytopathogens and promotes growth of pepper (Capsicum annuum). Biological Control, 138, 104065. https://doi.org/10.1016/j.biocontrol.2019.104065
Liotti, R. G., da Silva Figueiredo, M. I., da Silva, G. F., de Mendonça, E. A. F., Soares, M. A. (2018). Diversity of cultivable bacterial endophytes in Paullinia cupana and their potential for plant growth promotion and phytopathogen control. Microbiological research, 207, 8-18. https://doi.org/10.1016/j.micres.2017.10.011
Ma, D., Zhu, J., Jiang, J., Zhao, Y., Li, B., Mu, W., Liu, F. (2018). Evaluation of bioactivity and control efficacy of tetramycin against Corynespora cassiicola. Pesticide biochemistry and physiology, 152, 106-113. https://doi.org/10.1016/j.pestbp.2018.09.009
Marimuthu, S., Karthic, C., Mostafa, A. A., Al-Enazi, N. M., Abdel-Raouf, N., Sholkamy, E. N. (2020). Antifungal activity of Streptomyces sp. SLR03 against tea fungal plant pathogen Pestalotiopsis theae. Journal of King Saud University-Science, 32(8), 3258-3264. https://doi.org/10.1016/j.jksus.2020.08.027
Maharachchikumbura, S. S., Guo, L. D., Chukeatirote, E., Bahkali, A. H., Hyde, K. D. (2011). Pestalotiopsis—morphology, phylogeny, biochemistry and diversity. Fungal Diversity, 50, 167-187. https://doi.org/10.1007/s13225-011-0125-x
Mahdi, R. A., Bahrami, Y., Kakaei, E. (2022). Identification and antibacterial evaluation of endophytic Actinomicetofrom Luffa cylindrica. Scientific reports, 12(1), 18236. https://doi.org/10.1038/s41598-022-23073-4
Marques, L. L. M., Ferreira, E. D. F., de Paula, M. N., Klein, T., de Mello, J. C. P. (2019). Paullinia cupana: a multipurpose plant–a review. Revista Brasileira de Farmacognosia, 29(1), 77-110. https://doi.org/10.1016/j.bjp.2018.08.007
Musa, Z., Ma, J., Egamberdieva, D., Abdelshafy Mohamad, O. A., Abaydulla, G., Liu, Y., Li, L. 2020. Diversity and antimicrobial potential of cultivable endophytic Actinomicetoassociated with the medicinal plant Thymus roseus. Frontiers in microbiology, 11, 191. https://doi:10.3389/fmicb.2020.00191
Mohamad, O. A. A., Liu, Y. H., Li, L., Ma, J. B., Huang, Y., Gao, L., Li, W. J. (2022). Synergistic Plant-Microbe Interactions between Endophytic Actinomicetoand Their Role in Plant Growth Promotion and Biological Control of Cotton under Salt Stress. Microorganisms, 10(5), 867. https://doi.org/10.1007/s10482-018-1062-4
Nara, A., Hashimoto, T., Komatsu, M., Nishiyama, M., Kuzuyama, T., Ikeda, H. (2017). Characterization of bafilomycin biosynthesis in Kitasatospora setae KM-6054 and comparative analysis of gene clusters in Actinomycetales microorganisms. The Journal of Antibiotics, 70(5), 616-624. https://doi.org/10.1038/ja.2017.33
Nichols, J. D., & Carpenter, F. L. (2006). Interplanting Inga edulis yields nitrogen benefits to Terminalia amazonia. Forest Ecology and Management, 233(2-3), 344-351. https://doi.org/10.1016/j.foreco.2006.05.031
O'Connell, R. J., Thon, M. R., Hacquard, S., Amyotte, S. G., Kleemann, J., Torres, M. F., Vaillancourt, L. J. (2012). Lifestyle transitions in plant pathogenic Colletotrichum fungi deciphered by genome and transcriptome analyses. Nature genetics, 44(9), 1060-1065. https://doi.org/10.1038/ng.2372
Oyedoh, O. P., Yang, W., Dhanasekaran, D., Santoyo, G., Glick, B. R., Babalola, O. O. (2023). Rare rhizo-Actinomycetes: A new source of agroactive metabolites. Biotechnology Advances, 108205. https://doi.org/10.1016/j.biotechadv.2023.108205
Pavan Kumar, J. G. S., Gomathi, A., Vasconcelos, V., Gothandam, K. M. (2018). Bioactivity assessment of Indian origin—mangrove Actinomicetoagainst Candida albicans. Marine drugs, 16(2), 60. https://doi.org/10.3390/md16020060
Piato, K., Subía, C., Pico, J., Calderón, D., Norgrove, L., Lefort, F. (2021). Organic farming practices and shade trees reduce pest infestations in robusta coffee systems in Amazonia. Life, 11(5), 413. https://doi.org/10.3390/life11050413
Piato, K., Subía, C., Lefort, F., Pico, J., Calderón, D., Norgrove, L. (2022). No Reduction in Yield of Young Robusta Coffee When Grown under Shade Trees in Ecuadorian Amazonia. Life, 12(6), 807. https://doi.org/10.3390/life12060807
Priyashantha, A. K. H., Karunarathna, S. C., Lu, L., Tibpromma, S. (2023). Fungal Endophytes: An Alternative Biocontrol Agent against Phytopathogenic Fungi. Encyclopedia, 3(2), 759-780. https://doi.org/10.3390/encyclopedia3020055
Rego, A., Raio, F., Martins, T. P., Ribeiro, H., Sousa, A. G., Séneca, J., Magalhães, C. (2019). Actinomicetoand cyanobacteria diversity in terrestrial antarctic microenvironments evaluated by culture-dependent and independent methods. Frontiers in microbiology, 10, 1018. https://doi.org/10.3389/fmicb.2019.01018
Ribeiro, S. M. R., Schieber, A. (2010). Bioactive compounds in mango (Mangifera indica L.). In Bioactive foods in promoting health (pp. 507-523). Academic Press. https://doi.org/10.1016/B978-0-12-374628-3.00034-7
Rollo, A., Ribeiro, M. M., Costa, R. L., Santos, C., Clavo P, Z. M., Mandák, B., Lojka, B. (2020). Genetic Structure and Pod Morphology of Inga edulis Cultivated vs. Wild Populations from the Peruvian Amazon. Forests, 11(6), 655. https://doi.org/10.3390/f11060655
Saeed, Q., Xiukang, W., Haider, F. U., Kučerik, J., Mumtaz, M. Z., Holatko, J., Mustafa, A. (2021). Rhizosphere bacteria in plant growth promotion, biocontrol, and bioremediation of contaminated sites: A comprehensive review of effects and mechanisms. International Journal of Molecular Sciences, 22(19), 10529. https://doi.org/10.3390/ijms221910529
Shahzad, R., Khan, A. L., Bilal, S., Asaf, S., Lee, I. J. (2018). What is there in seeds? Vertically transmitted endophytic resources for sustainable improvement in plant growth. Frontiers in Plant Science, 9, 24. https://doi.org/10.3389/fpls.2018.00024n
Sharma, P., & Thakur, D. (2020). Antimicrobial biosynthetic potential and diversity of culturable soil actinobacteria from forest ecosystems of Northeast India. Scientific reports, 10(1), 4104. https://doi.org/10.1038/s41598-020-60968-6
Shirling, E. B., & Gottlieb, D. (1972). Cooperative description of type strains of Streptomyces: V. Additional descriptions. International Journal of Systematic and Evolutionary Microbiology, 22(4), 265-394. https://doi.org/10.1099/00207713-22-4-265
Sobanski, N., & Marques, M. C. (2014). Effects of soil characteristics and exotic grass cover on the forest restoration of the Atlantic Forest region. Journal for Nature Conservation, 22(3), 217-222. https://doi.org/10.1016/j.jnc.2014.01.001
Souza, A. Q. L. D., Souza, A. D. L. D., Astolfi Filho, S., Pinheiro, M. L. B., Sarquis, M. I. D. M., Pereira, J. O. (2004). Atividade antimicrobiana de fungos endofíticos isolados de plantas tóxicas da amazônia: Palicourea longiflora (aubl.) rich e Strychnos cogens bentham. Acta amazônica, 34, 185-195.
Sun, J. F., Lin, X., Zhou, X. F., Wan, J., Zhang, T., Yang, B., Liu, Y. (2014). Pestalols A–E, new alkenyl phenol and benzaldehyde derivatives from endophytic fungus Pestalotiopsis sp. AcBC2 isolated from the Chinese mangrove plant Aegiceras corniculatum. The Journal of Antibiotics, 67(6), 451-457. https://doi.org/10.1038/ja.2014.24
Tamura K. e Nei M. (1993). Estimativa do número de substituições de nucleotídeos na região de controle do DNA mitocondrial em humanos e chimpanzés. Biologia Molecular e Evolução 10:512-526. https://doi.org/10.1093/oxfordjournals.molbev.a040023
Tamura K., Stecher G. e Kumar S. (2021). MEGA 11: Análise Genética Evolutiva Molecular Versão 11. Biologia Molecular e Evolução https://doi.org/10.1093/molbev/msab120.
Thampi, A., Bhai, R. S. (2017). Rhizosphere Actinomicetofor combating Phytophthora capsici and Sclerotium rolfsii, the major soil borne pathogens of black pepper (Piper nigrum L.). Biological Control, 109, 1-13. https://doi.org/10.1016/j.biocontrol.2017.03.006
Takahashi, Y. (2017). Genus Kitasatospora, taxonomic features and diversity of secondary metabolites. The Journal of Antibiotics, 70(5), 506-513. https://doi.org/10.1038/ja.2017.8
Tsai, I., Maharachchikumbura, S. S., Hyde, K. D., Ariyawansa, H. A. (2018). Molecular phylogeny, morphology and pathogenicity of Pseudopestalotiopsis species on Ixora in Taiwan. Mycological Progress, 17, 941-952. https://doi.org/10.1007/s11557-018-1404-7
Van Bergeijk, D. A., Terlouw, B. R., Medema, M. H., van Wezel, G. P., 2020. Ecology and genomics of Actinobacteria: new concepts for natural product discovery. Nature Reviews Microbiology, 18(10), 546-558. https://doi.org/10.1038/nature01096
Xie, F., Pathom-Aree, W. (2021). Actinomicetofrom desert: diversity and biotechnological applications. Frontiers in microbiology, 12, 765531. https://doi:10.3389/fmicb.2021.765531
Yoon, T. M., Kim, J. W., Kim, J. G., Kim, W. G., Suh, J. W. (2006). Talosins A and B: new isoflavonol glycosides with potent antifungal activity from Kitasatospora kifunensis MJM341. The Journal of antibiotics, 59(10), 633-639. https://doi.org/10.1038/ja.2006.84
Takahashi, Y. (2017). Genus Kitasatospora, taxonomic features and diversity of secondary metabolites. The Journal of Antibiotics, 70(5), 506-513. https://doi.org/10.1038/ja.2017.8
Yan, S., Zeng, M., Wang, H., Zhang, H. (2022). Micromonospora: A prolific source of bioactive secondary metabolites with therapeutic potential. Journal of Medicinal Chemistry, 65(13), 8735-8771. https://doi.org/10.1021/acs.jmedchem.2c00626
Strobel, G., Daisy, B., Castillo, U., Harper, J. (2004). Natural products from endophytic microorganisms. Journal of Natural products, 67(2), 257-268. https://doi.org/10.1021/np030397v
Wang, W., Song, T., Chai, W., Chen, L., Chen, L., Lian, X. Y., Zhang, Z. (2017). Rare polyene-polyol macrolides from mangrove-derived Streptomyces sp. ZQ4BG. Scientific Reports, 7(1), 1703. https://doi.org/10.1038/s41598-017-01912-z

Table 1. Phenotypic and genotypic characteristics of actinomycetes isolated from the rhizospheres of three individuals of Inga edulis from the campus of the Federal University of Amazonas.

Isolated strains	Macromophology (colony)	Micromorphology (spore chain)	GenBank/NCBI	EzBioCloud
Streptomyces sp. LaBMicrA B267	Aerial mycelium light gray; deep orange-yellow back; edge rough	Long/flexible partially spiralled, spherical and ovoid segments	S. pulveraceus NBRC 3855 (99.51%)	S. silvae For3 (99.34%)
Streptomyces sp. LaBMicrA B270	Aerial mycelium light gray; back deep yellow-brown; edge rough	Long/flexible partially spiral and cylindrical segments	S. bullii C2 (96.41%)	S. murinus NBRC 12799 (98.36%)
			S. murinus NRRL B-2286 (96.41%)	S. murinus NBRC 12799 (98.36%)
			S. lanatus ISP 5090 (96.41%)	S. lanatus NBRC 12787 (98.36%)
			S. fractus MV32 (96.41%)	S. fractus MV32 (98.36%)
			S. graminearus NBRC 15420 (96.41%)	S. graminearus NBRC 15420 (98.36%)
			S. griseofuscus NBRC 12870 (96.41%)	S. graminearus NBRC 15420 (98.36%)
Streptomyces sp. LaBMicrA B271	Aerial mycelium light gray-brown; back bright yellow-orange; edge rough	Long/flexible partially spiralled and ovoid segments	S. graminearus NBRC 15420 (97.53%)	S. murinus NBRC 12799 (96.66%)
			S. murinus NBRC 14802 (97.53%)	S. murinus NBRC 12799 (96.66%)
			S. griseofuscus NBRC 12870 (97.53%)	S. graminearus NBRC 15420 (96.66%)
			S. murinus NBRC 12799 (97.53%)	S. graminearus NBRC 15420 (96.66%)
Streptomyces sp. LaBMicrA B272	Aerial mycelium light gray; back deep yellowish-brown; edge rough	Long/flexible partially spiralled, cylindrical and ovoid segments	S. acidicola K1PN6 (88.60%)	S. sundarbansensis MS1/7 (78.35%)
Streptomyces sp. LaBMicrA B278	Aerial mycelium light gray-brown; back moderate brown; edge rough	Partially long/flexible spirals, with spherical and ovoid clusters and segments	S. misionensis JCM 4497 (93.78%)	S. misionensis DSM 40306 (94.51%)
Streptomyces sp. LaBMicrA B280	Aerial mycelium yellowish-gray-brown; back deep yellow-orange; edge rough	Long/flexible partially spiralled, cylindrical following	S. graminearus NBRC 15420 (99.09%)	S. graminearus NBRC 15420 (98.83%)
Streptomyces sp. LaBMicrA B280		Long/flexible partially spiralled, cylindrical following	S. graminearus NBRC 15420 (99.09%)	S. murinus NBRC 12799 (98.83%)
Kitasatospora sp. LaBMicrA B282	Aerial mycelium white; back deep brownish-yellow; edge rough	Long/flexible partially spiralled, spherical and ovoid segments	K. acidiphila MMS16-CNU292 (92.45%)	K. acidiphila MMS16-CNU292 (90.98%)
Streptomyces sp. LaBMicrA B301	Aerial mycelium bluish-white; back moderate olive-brown; edge rough	Long/flexible partially spiralled, spherical and ovoid segments	S. pulveraceus NBRC 3855 (96.65%)	S. durocortorensis RHZ10 (96.93 %)
Streptomyces sp. LaBMicrA B304	Aerial mycelium light grey-brown; back deep yellowish-brown; edge rough	Long/flexible partially spiralled, spherical and ovoid segments	S. pulveraceus NBRC 3855 (97.68%)	S. pulveraceus LMG 20322 (98.70)
Streptomyces sp. LaBMicrA B310	Aerial mycelium light grey-brown; back deep yellowish-brown; edge rough	Long/flexible partially spiralled, spherical and ovoid segments	S. pulveraceus NBRC 3855 (98.96%)	S. durocortorensis RHZ10 (99.07 %)
Kitasatospora sp. LaBMicrA B313	Aerial mycelium yellowish-gray; back light olive-brown; edge rough	Long/flexible partially spiralled, spherical and ovoid segments	K. arboriphila HKI 0189 (98.44%)	K. arboriphila HKI 0189 (98.70%)
Kitasatospora sp. LaBMicrA B313			K. aureofaciens KACC 20180 (98.44%)	K. arboriphila HKI 0189 (98.70%)
Streptomyces sp. LaBMicrA B314	Aerial mycelium white; back deep yellow-orange; edge rough	Partially spiral long/flexible long, spherical and ovoid segments	S. olivaceus NBRC 12805 (99.61%)	S. olivaceus NRRL B-3009 (99.74%)
Streptomyces sp. LaBMicrA B317	Aerial mycelium pinkish-gray; back deep yellow-orange; edge rough	Long/flexible partially spiralled, spherical and ovoid segments	S. jiujiangensis JXJ 0074 (97.11%)	S. barringtoniae JA03 (96.79)
Streptomyces sp. LaBMicrA B318	Aerial mycelium white; back deep yellow-orange; edge rough	Long/flexible partially spiral and cylindrical segments	S. similanensis KC-106 (95.10%)	S. similanensis KC-106 (95.45%)
Streptomyces sp. LaBMicrA B319	Aerial mycelium light bluish-gray; back deep yellowish-brown; edge rough	Long/flexible, short/compact partially spiral and cylindrical segments	S. acrimycini NBRC 12736 (97.93%)	S. anandii NRRL B-3590 (97.72%)
Streptomyces sp. LaBMicrA B319			S. roietensis WES2 (97.93%)	S. pimonensis TRM75549 (97.72%)
Streptomyces sp. LaBMicrA B322	Aerial mycelium light grayish-brown; back deep yellowish-brown; edge rough	Long/flexible partially spiralled, spherical and ovoid segments	S. enissocaesilis NRRL B-16365 (96.76%)	S. rochei NRRL B-2410 (100%)
			S. rochei NRRL B-1559 (96.76%)
			S. vinaceusdrappus NBRC 13099 (96.76%)
			S. plicatus NBRC 13071 (96.76%)
			S. vinaceusdrappus NRRL 2363 (96.76%)
Streptomyces sp. LaBMicrA B325	Aerial mycelium vivid yellowish-pink; back deep orange; rough edge	Long/flexible partially spiral and cylindrical segments	S. katrae NRRL B-3093 (99.19%)	S. katrae NRRL ISP 5550 (97.66%)
			S. racemochromogenes NBRC 12906 (99.19%)	S. katrae NRRL ISP 5550 (97.66%)
			S. polychromogenes NRRL B-3032 (99.19%)	S. racemochromogenes NRRL B-5430 (97.66%)
			S. polychromogenes NBRC 13072 (99.19%)	S. racemochromogenes NRRL B-5430 (97.66%)
Streptomyces sp. LaBMicrA B289	Aerial mycelium white; back deep orangey-yellow; rough edge	Long/flexible partially spiral and cylindrical segments	S. sennicomposti RCPT1-4 (99.16%)	S. venetus CMUAB225 (82.22%)
Streptomyces sp. LaBMicrA B290	Aerial mycelium brownish-white; back bright yellow-orange; rough edge	Partially long/flexible spirals, with bunches, spherical and ovoid segment	S. graminearus NBRC 15420 (99.09%)	S. murinus NBRC 12799 (99.22%)
Streptomyces sp. LaBMicrA B290			S. graminearus NBRC 15420 (99.09%)	S. graminearus NBRC 15420 (99.22%)
Streptomyces sp. LaBMicrA B299	Aerial mycelium moderate brown; back bright yellow-orange; rough edge	Long/flexible partially spiralled, spherical and ovoid segments	S. jiujiangensis strain JXJ 0074 (87.36%)	S. panaciradicis 1MR8 (92.88%)

Note.: The shades of the aerial mycelia and backs were determined using the ISCC/NBS color system. The marker used was the 16S rRNA gene.

Table 2. Minimum inhibitory dosage of extracts of the strains Streptomyces sp. LaBMicrA B270 and B280.

Strains tested	Concentrations and activities					Phytopathogens
	1,000 µg/mL	500 µg/mL	250 µg/mL	125 µg/mL	062 µg/mL
	Acetate /isopropanol fraction (culture medium)
Streptomyces sp. LaBMicrA B270	+	+	+	+	±	Colletotrichum sp. (ISO01)
	+	+	+	±	–	C. guaranicola (P01)
	+	+	+	±	–	Corysnepora cassiicola (ISO079)
	+	+	+	+	±	Pestalotiopsis sp. (3002R2)
	–	–	–	–	–	Sclerotium coffeicola (M01)
Streptomyces sp. LaBMicrA B280	+	+	+	+	±	Colletotrichum sp. (ISO01)
	+	+	+	+	±	C. guaranicola (P01)
	+	+	+	+	±	Corysnepora cassiicola (ISO079)
	+	+	+	+	±	Pestalotiopsis sp. (3002R2)
	+	+	+	±	–	Sclerotium coffeicola (M01)
Acetate/methanol fraction (cell biomass)
Streptomyces sp. LaBMicrA B270	–	–	–	–	–	Colletotrichum sp. (ISO01)
	–	–	–	–	–	C. guaranicola (P01)
	+	+	±	–	–	Corysnepora cassiicola (ISO079)
	+	±	–	–	–	Pestalotiopsis sp. (3002R2)
	–	–	–	–	–	Sclerotium coffeicola (M01)
Streptomyces sp. LaBMicrA B280	+	+	±	–	–	Colletotrichum sp. (ISO01)
	+	±	–	–	–	C. guaranicola (P01)
	+	±	–	–	–	Corysnepora cassiicola (ISO079)
	–	–	–	–	–	Pestalotiopsis sp. (3002R2)
	–	–	–	–	–	Sclerotium coffeicola (M01)

Note: + = fungicidal; ± = Fungistatic – - = no activity

No competing interests reported.

SupplementarymaterialMS1.docx

Download PDF

Version 1

posted

You are reading this latest preprint version

Biodiversity and antifungal activities of actinomycetes isolated from the rhizosphere of Inga edulis in an urban forest fragment of the amazon

Status:

Version 1

Abstract

Figures

Introduction

Materials And Methods

Results

Discussion

Conclusion

Declarations

References

Tables

Additional Declarations

Supplementary Files

Status:

Version 1