The possible effects of the MTOR polymorphisms on Preeclampsia susceptibility, severity, and onset: A case-control study and in silico analysis

doi:10.21203/rs.3.rs-3598679/v1

Download PDF

Research Article

The possible effects of the MTOR polymorphisms on Preeclampsia susceptibility, severity, and onset: A case-control study and in silico analysis

https://doi.org/10.21203/rs.3.rs-3598679/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 23 Feb, 2024

Read the published version in Molecular Biology Reports →

You are reading this latest preprint version

Background

Preeclampsia (PE) is a gestational complication with developed hypertension and proteinuria. Evidence showed the role of mTOR in various cellular processes. Therefore, this study aimed to evaluate the effects of MTOR polymorphisms on susceptibility, severity, and onset of Preeclampsia (PE).

Methods and Results

A total of 250 PE pregnant women and 258 age-matched control subjects were recruited in this study. To genotype MTOR polymorphisms, the PCR-RFLP method was used. The SpliceAid 2 and PROMO tools were used for in silico analysis. The maternal MTOR rs17036508T/C polymorphism was associated with PE risk in various genetic models. There was no relationship between rs2536T/C and rs2295080T/G polymorphisms and PE. The TTC and TGC haplotypes of rs2536/ rs2295080/ rs17036508 polymorphisms were significantly higher in PE women. Subgroup analysis revealed the association between the MTOR rs2295080 variant and an increased risk of Early-onset PE (EOPE). However, the MTOR rs17036508 was associated with a higher risk of EOPE and Late- Onset PE. In addition, the MTOR rs2295080 could increase the risk of severe PE. The results of the in silico analysis showed that rs17036508 disrupted several binding motifs in the mutant sequence. The PROMO database revealed that the T to C substitution leads to the loss of TFII-I binding site in the mutant allele.

Conclusion

The MTOR rs17036508T/C polymorphism was associated with PE risk. There was an association between the MTOR rs2295080 variant and an increased risk of EOPE. The MTOR rs17036508T/C and rs2295080T/C variants could disrupt several binding motifs and TFII-I binding respectively.

In silico analysis

MTOR

Polymorphism

Preeclampsia

During pregnancy, pre-eclampsia (PE) is manifested by an increase in blood pressure after the 20th week or a further increase in blood pressure based on the initial blood pressure along with proteinuria or other multi-organ injuries [1]. This problem which affects 3–8% of pregnant women is considered as a major reason for maternal and neonatal morbidity and mortality and can lead to the disruption of various organs[2]. Intravascular inflammatory responses, abnormal trophoblast invasion and differentiation, angiogenic impairment, expanded dysfunction in endothelial cells, oxidative stress, improper apoptosis and autophagy, and imbalance in placental perfusion are factors or mechanisms involved in PE pathogenesis[3].

Autophagy is one of the important processes that can provide nutrients and energy in times of various pressures as an adaptive response and also removes misfolded proteins and damaged organelles[4]. The important role of autophagy in fertilization, placentation, and delivery through gestation as well as trophoblast functions are established. Evidence showed the role of autophagy in the pathophysiology of PE and improper autophagy is illustrated as the main reason for this complication. Regarding the role of autophagy in normal embryogenesis and placentation, the key components of this process could be involved in PE development[5].

The phosphoinositide-3 kinase-AKT-mammalian target of the rapamycin pathway, or PI3K/AKT/mTOR, is a key pathway that regulates cell growth and proliferation in response to different stimulators[6, 7]. In addition, this pathway involves other functions, such as cell motility, cell survival, protein, lipid, nucleotide synthesis, autophagy, and transcription[8].

Evidence showed that the PI3K/Akt/mTOR downregulation is related to PE development[9]. According to both in vivo and in vitro evidence, the mTOR is an important downstream effector of the PI3K/AKT/mTOR pathway and acts as a key regulator of pivotal cellular pathways like proliferation, cell growth, migration, metabolism, apoptosis, and autophagy[10, 11].

The expression of MTOR can occur in the human placenta trophoblast, with a major performance in the development of the placenta[12, 13]. A prior study demonstrated that inhibiting the mTOR signaling pathway increases the risk of PE by reducing the invading capacity of trophoblast cells[14]. It has been shown that the level of mTOR protein in the placenta tissue of mice with PE was significantly decreased compared to normal mice[15]. These results indicated that silencing GNG7 activates the mTOR signaling pathway, leading to cell proliferation and differentiation and inhibition of cytotrophoblast apoptosis in PE mouse placenta. Evidence indicated the role of genetic variants that influence the components of these pathways in various pathogenic conditions like PE[15].

The human MTOR gene is mapped on the long arm of chromosome 1 (1q36.2). There are various single nucleotide polymorphisms (SNPs) in this gene, and also the rs17036508 (T.C) in the splicing site, rs2536 T > C in the 3ʹ-untranslated region (3ʹ-UTR), and rs2295080 (T > G) in the promoter region are among the most studied of them. Regarding the role of mTOR in various functions, different reports showed the effects of MTOR variants on different complications[16, 17]. It has been shown that the rs2295080 T/G substitution affects the transcriptional activity of the MTOR gene, and greater mRNA levels of the MTOR gene are indicated in TT genotypes[18]. Furthermore, it has been suggested that the rs2536 polymorphism influences the miRNA binding site activity[17].

To the best of our knowledge, no study has been conducted to evaluate the potential impacts of placental MTOR (rs2536, rs2295080, and rs17036508) polymorphisms on PE development. Therefore, the present study aimed to evaluate the impacts of MTOR (rs2536, rs2295080, and rs17036508) polymorphisms on PE development as well as In silico analysis.

Subjects

This Case-Control study was carried out on 252 PE women and 258 healthy pregnant women, who were referred to Ali-ibn-Abitaleb Hospital of Zahedan University of Medical Sciences, Iran. The ethics committee of Zahedan University of Medical Sciences approved the study protocol and all research units were explained about the study protocols and objectives. The inclusion and exclusion criteria of the study were according to our previous work[19].

Genetic analysis

After taking 2 ml of blood from all participants, the samples were stored in a -20°C freezer until DNA extraction. The salting-out protocol was followed to extract genomic DNA from venous blood. The MTOR rs2536, rs2295080, and rs17036508 variants were genotyped by PCR-RFLP analysis. Table 1 illustrates the data of primers, restriction enzymes, length of amplified fragments, and digestion products. The reaction mixture (15 µL) of PCR contained genomic DNA (1µL), primer (1 µL), Taq DNA polymerase 2X Master Mix Red (10 µL), and distilled water (2µL). The digestion was done by restriction enzymes to obtain digested products. The visualization of fragments was explored on 3% agarose gel containing DNA safe stain under ultraviolet radiation.

Table 1

The primer sequences, restriction enzymes and length of fragments for PCR-RFLP of *MTOR* polymorphisms
Polymorphism	Forward Primer 5´ 3´	Reverse Primer 5´ 3´	Restriction enzymes	PCR product and digestion product bp
MTOR rs2295080	GTGGGTCTGGACATTACGCC	CAGTCCATCTTCTCCCTATACCTG	FokI	GG:222 TT:167,55 GT:222,167,55
MTOR rs17036508	TGGACAGAGTCTCTCATGGAT	CCTCTGTCACTGCTCACCCTC	HPYCH4IV	TT:241,124 CC:241,89,35 TC:241,124,89,35
MTOR rs2536	TGCAGCAGGGTTCTGGGATGTTT	TTTAGTTGAGTATTTGTTCTGCTCAGAATT	EcoRI	TT:149 CC:121,28 TC:149,121,28

In silico analysis

The SpliceAid 2 and PROMO tools were used for in silico analysis of rs17036508 and rs2295080 polymorphisms, respectively. To evaluate the impact of rs17036508 on protein binding affinity to the target RNA sequence in our analysis, the SpliceAid 2 web tool was used. This tool searches the motifs using a database of RNA sequences. The results of the spliceAid2 show information about the strengthening splice sites or creation of splice sites[20]. Since most of the transcriptional regulatory signals are probably in the promoter and enhancer/silencer regions of genes, we used the PROMO tool to predict the effect of rs2295080 on potential transcription factor binding sites in the studied DNA sequence[21, 22].

Statistical analysis

The SPSS V.23 was applied to analyze the obtained data. The independent t-test and chi-square tests were conducted whenever appropriate. Differences in the genotypes and alleles distribution between the PE and control groups and subgroups were computed using SNPStats[23] (https://www.snpstats.net/start.htm) in the various genetic models by acquiring the odds ratio (OR). The statistical significance level was a P value less than 0.05.

Table 2 shows the clinical and general data of patients and controls.

Table 2

Demographic and clinical characteristics of PE women and controls
Variable	Controls n = 258	PE n = 252	P-value
Maternal age(mean ± SD, years)	27.4 ± 6.3	27.8 ± 6.1	0.467
Gestation age(mean ± SD, weeks)	38.1 ± 2.7	37.5 ± 2.6	0.002
Birth weight (mean ± SD, g)	3136 ± 343	2995 ± 564	< 0.0001
SBP(mean ± SD, mmHg)	107 ± 7.7	145 ± 18	< 0.0001
DBP(mean ± SD, mmHg)	67 ± 7.7	92 ± 13	< 0.0001
Primiparity, n (%)	70(27.1)	112(44)	< 0.0001
SD: Standard Deviation, NS: Not Significant

Table 3 displays the allelic and genotypic frequencies of maternal MTOR variants in PE women and controls. No relationship between MTOR rs2536 and rs2295080 polymorphisms and PE susceptibility was observed in any genetic models. The significant association was detected between MTOR rs17036508 and PE under codominant (OR = 1.45, 95% CI = 0.96–2.21, P = 4e-04), dominant TC + CC vs TT (OR = 1.81, 95% CI = 1.24–2.65, P = 0.002), recessive CC vs TC + TT (OR = 3.60, 95% CI = 1.67–7.77, P = 4e-04), and Log-additive CC vs TC vs TT (OR = 1.73, 95% CI = 1.29–2.33, P = 2e-04) patterns. Reduced risk of PE was related to rs17036508 T allele (OR = 2, 95% CI = 1.4–2.7, P = 3e-05).

Table 3

Allelic and genotypic frequency of maternal *MTOR* polymorphisms in PE women and control group
	Control (N = 258)	PE (N = 252)	P-value	OR (95% CI)
rs2536
TT, n(%)	244(94.6)	244(96.8)		1
TC, n(%)	13(5)	8(3.2)
CC, n(%)	1(0.4)	0(0)
Codominant			0.28	0.62 (0.25–1.51)
			0.28	-
Dominant (TC + CC vs TT)			0.21	0.57 (0.24–1.39)
Recessive (CC vs TC + TT)				-
Overdominant (TC vs TT + CC)			0.29	0.62 (0.25–1.52)
Log-additive(CC vs TC vs TT )			0.16	0.56 (0.24–1.30)
Allele
T, n(%)	501(97)	496(98.4)		1
C, n(%)	15(3)	8(1.6)	0.16	0.54(0.23–1.3)
rs2295080
TT, n(%)	131(50.8)	127 (50.4)
TG n(%)	98 (38.0)	84(33.3)
GG, n(%)	29(11.2)	41(16.3)
Codominant			0.21	0.88 (0.60–1.29)
			0.21	1.46 (0.85–2.49)
Dominant (TG + GG vs TT)			0.93	1.02 (0.72–1.44)
Recessive (GG vs TG + TT)			0.10	1.53 (0.92–2.56)
Overdominant (TG vs GG + TT)			0.27	0.82 (0.57–1.17)
Log-additive(GG vs GT vs TT )			0.78	1.11 (0.87–1.42)
Allele
T, n(%)	360(70)	338(67)		-
G, n(%)	156(30)	166(33)	0.35	1.1(0.87–1.48)
rs17036508
TT, n(%)	195(75.6)	159(63.1)
TC n(%)	54(20.9)	64(25.4)
CC, n(%)	9(3.5)	29 (11.5)
Codominant			4e-04	1.45 (0.96–2.21)
			4e-04	3.95 (1.82–8.59)
Dominant (TC + CC vs TT)			0.002	1.81 (1.24–2.65)
Recessive (CC vs TC + TT)			4e-04	3.60 (1.67–7.77)
Overdominant (TC vs TT + CC)			0.23	1.29 (0.85–1.94)
Log-additive( CC vs TC vs TT )			2e-04	1.73 (1.29–2.33)
Allele
T, n(%)	444(86)	382(76)	3e-05	2(1.4–2.7)
C, n(%)	72(14)	122(24)
Bold values are statistically significant (p < 0.05).

Haplotype analysis revealed that the frequencies of TTC and TGC haplotypes of rs2536/ rs2295080/ rs17036508 polymorphisms were significantly increased in PE women(Table 4), and also these haplotypes were associated with 1.84- to 2 folds increased risk of PE, respectively (OR = 1.81, 95% CI = 1.24–2.65, P = 0.002 and OR = 1.81, 95% CI = 1.24–2.65, P = 0.002)

Table 4

The association of the *MTOR* polymorphisms haplotypes and preeclampsia susceptibility
rs2536/ rs2295080/ rs17036508	Case	control	P-value	OR (95% CI)
TTT	0.481	0.571	-	1
TGT	0.261	0.266	0.341	1.15(0.86–1.55)
TTC	0.174	0.101	0.004	1.84(1.23–2.77)
TGC	0.068	0.033	0.044	2.00(1.02–3.93)
CTT	0.016	0.021	0.760	0.86(0.34–2.2)
CTC	0.0	0.005	-	-
CGT	0.0	0.003	-	-
Bold values are statistically significant (p < 0.05).

The MTOR rs2295080 could increase the risk of Early- onset PE (EOPE) compared to Late-onset PE(LOPE) and controls (Table 5) in the recessive model (OR = 2.08, 95%CI = 1.04–4.14, P = 0.035, OR = 2.14, 95%CI = 1.20–3.82, P = 0.01 respectively). This variant was also associated with EOPE risk in the codominant model (OR = 2.14, 95%CI = 1.15–3.95, P = 0.04). In addition, The MTOR rs17036508 was associated with higher risk of EOPE compared to controls in codominant, dominant and recessive models(OR = 4.68, 95%CI = 1.98–11.06, P = 8e-04, OR = 2.01, 95%CI = 1.27–3.18, P = 0.003, OR = 4.18, 95%CI = 1.79–9.75, P = 7e-04, respectively). The MTOR rs17036508 could also increase the risk of LOPE compared to controls in codominant, dominant, and recessive models (OR = 3.31, 95%CI = 1.36–8.05, P = 0.02, OR = 1.64, 95%CI = 1.03–2.59, P = 0.036, OR = 3.07, 95%CI = 1.28–7.40, P = 0.011, respectively).

Table 5

The association between maternal *MTOR* polymorphisms and PE Onset
	Early Onset PE (N = 122)	Late Onset PE (N = 130)	Control (N = 258)	Model	Between EOPE and LOPE P-value OR (95% CI)		Between EOPE and Controls P-value OR (95% CI)		Between LOPE and Controls P-value OR (95% CI)
rs2295080
TT, n(%)	55 (45.1)	72(55.4)	131(50.8)
TG n(%)	41(33.6)	43(33.1)	98 (38.0)	Codominant	0.08	1.25 (0.72–2.17)	0.04	1.00 (0.62–1.61)	0.63	0.80 (0.50–1.26)
GG, n(%)	26(21.3)	15(11.5)	29(11.2)		0.08	2.27 (1.10–4.69)	0.04	2.14 (1.15–3.95)	0.63	0.94 (0.47–1.87)
				Dominant	0.1	1.51 (0.92–2.49)	0.30	1.26 (0.82–1.94)	0.39	0.83 (0.54–1.27)
				Recessive	0.035	2.08 (1.04–4.14)	0.01	2.14 (1.20–3.82)	0.93	1.03 (0.53-2.00)
rs17036508
TT, n(%)	74(61)	85(65)	195(75.6)
TC n(%)	32(26)	32(25)	54(20.9)	Codominant	0.66	1.15 (0.64–2.05)	8e-04	1.56 (0.94–2.61)	0.02	1.36 (0.82–2.26
CC, n(%)	16(13)	13(10)	9(3.5)		0.66	1.41 (0.64–3.13)	8e-04	4.68 (1.98–11.06)	0.02	3.31 (1.36–8.05)
				Dominant	0.44	1.23 (0.73–2.05)	0.003	2.01 (1.27–3.18)	0.036	1.64 (1.03–2.59)
				Recessive	0.44	1.36 (0.62–2.96)	7e-04	4.18 (1.79–9.75)	0.011	3.07 (1.28–7.40)
Bold values are statistically significant (p < 0.05).

The frequencies of MTOR gene polymorphisms in women with severe and mild PE and the control group are shown in Table 6. The MTOR rs2295080 could increase the risk of severe PE compared to mild PE in the dominant model (OR = 1.72, 95%CI = 1.04–2.84, P = 0.03). In addition, the MTOR rs17036508 was associated with a higher risk of severe PE compared to controls in codominant and recessive models (OR = 3.43, 95%CI = 1.42–8.26, P = 0.02, OR = 3.43, 95%CI = 1.42–8.26, P = 0.006, respectively). The MTOR rs17036508 could also increase the risk of mild PE in codominant, dominant and recessive models (OR = 4.39, 95%CI = 1.86–10.34, P = 5e-04, OR = 2.15, 95%CI = 1.38–3.37, P = 8e-04, OR = 3.75, 95%CI = 1.61–8.74, P = 0.02, respectively).

Table 6

The association between maternal *MTOR* polymorphisms and PE severity
	Severe PE (N = 118)	mild PE (N = 134)	control (N = 258)	Model	Between Severe and Mild PE P-value OR (95% CI)		Between Severe PE and Control P-value OR (95% CI)		Between Mild PE and Controls P-value OR (95% CI)
rs2295080
TT, n(%)	51(43.2)	76(56.7)	131(50.8)
TG n(%)	45(38.1)	39(29.1)	98 (38.0)	Codominant	0.10	1.72 (0.99-3.0)	0.13	1.18 (0.73–1.90)	0.20	0.69 (0.43–1.09)
GG, n(%)	22(18.6)	19(14.2)	29(11.2)		0.10	1.73 (0.85–3.51)	0.13	1.95 (1.03–3.70)	0.20	1.13 (0.59–2.15)
				Dominant	0.03	1.72 (1.04–2.84)	0.17	1.36 (0.87–2.10)	0.26	0.79 (0.52–1.20)
				Recessive	0.34	1.39 (0.71–2.71)	0.06	1.81 (0.99–3.31)	0.40	1.30 (0.70–2.43)
rs17036508
TT, n(%)	39(62.9)	40(63.5)	195(75.6)
TC n(%)	18(29)	15(23.8)	54(20.9)	Codominant	0.30	0.63 (0.35–1.14)	0.02	1.13 (0.66–1.94)	5e-04	1.78 (1.09–2.90)
CC, n(%)	5(8.1)	8(12.7)	9(3.5)		0.30	0.80 (0.36–1.78)	0.02	3.52(1.45–8.56)	5e-04	4.39 (1.86–10.34)
				Dominant	0.15	0.68 (0.41–1.14)	0.12	2.15 (1.38–3.37)	8e-04	2.15 (1.38–3.37)
				Recessive	0.82	0.91 (0.42–1.99)	0.006	3.43 (1.42–8.26)	0.02	3.75 (1.61–8.74)

In silico analysis

The results obtained from SpliceAid2 showed that rs17036508 T > C has disrupted several binding motifs related to Sam68, hnRNP G, SLM-2, and ETR-3 proteins in the mutant sequence (Fig. 1). The PROMO database revealed that the binding site for transcription factor II-I, which is absent in the wild type, is lost in the rs2295080 mutant type. The length of each box of the transcription factor specifies the predicted binding sequence (Fig. 2).

PE is one of the leading problems of pregnancy that endangers the health of the mother and fetus. This complication leads to uterus and placenta insufficiency, which causes the restriction of fetal growth and low birth weight. In addition, due to impaired angiogenesis and the formation of incomplete spiral arteries, placental vascular lesions like placental infarction occur[24]. Evidence showed that both the invasion of trophoblast and impairment of placental vessel regeneration, which are the main causes of preeclampsia, were also observed in the autophagy-deficient extravillous trophoblast (EVT )cell line[4]. Indeed, the role of physiological cell death mechanisms in the establishment of vascular changes in hypoxic and stressful environmental conditions in trophoblasts has been established [25]. Therefore, any condition that leads to oxidative stress could affect cellular homeostasis and cause improper cellular death, leading to insufficient spiral artery remodeling and maternal–fetal interface, which is observed in preeclampsia [26]. Elevated rates of apoptosis and autophagy have been shown in the preeclamptic placenta [25].

Autophagy is a main event in cellular homeostasis protection and is involved in placentation and embryogenesis. Considering the effect of autophagy in normal gestation, disrupted autophagy in gestational problems is predictable[5]. mTOR is one of the central proteins in autophagy regulation and controls this process by phosphorylation and deactivation of target substrates and finally prevents the initiation of autophagy[15]. Different studies were conducted to assay the MTOR expression in PE women; however, their results are contrary. Lower MTOR expression was indicated by Tsai et al. preeclamptic women[13]. However, Weel et al. showed increased expression of the MTOR gene in the placenta of preeclamptic women[27]. Considering the vital role of mTOR in regulating the autophagy process, it is acceptable that MTOR genetic variations could be related to various diseases like PE. Evidence showed that the genetic variants in the genes of the pTEN/AKT/mTOR pathway can affect the transcription and expression of these genes, resulting in altered function of the pathway [18, 28]. Therefore, they could play a main role in the pathogenesis of different diseases. Several variants have been indicated in the MTOR gene that may have effects on the regulation of transcriptional activity, splicing, and miRNA binding. For example, the polymorphisms located in the 3ʹ- UTR region (rs2536), promoter region (rs2295080), and splicing sites (rs17036508) may affect the structure and function of gene transcription as well as their expression level[16, 17].

The findings of this study for the first time indicated the effects of maternal MTOR rs17036508 T/C polymorphisms on increased PE risk in codominant, dominant, recessive, Log-additive, and allelic models. However, no association was observed between rs2295080 T/G and rs2536 T/C polymorphisms and PE risk. The MTOR TTC and TGC haplotypes of rs2536/ rs2295080/ rs17036508 polymorphisms were associated with increased PE development. Stratified analysis revealed the association between the MTOR rs2295080 variant and increased risk of EOPE in recessive and codominant models. However, the MTOR rs17036508 was associated with an increased risk of EOPE and LOPE in various genetic models. In addition, the MTOR rs2295080 could increase the risk of severe PE in the dominant model. However, the MTOR rs17036508 variant was not associated with a greater risk of PE severity.

To the best of our knowledge, there is no published report on the effects of MTOR variants on PE; however, several studies investigated the relation between these variants and several diseases.

Xiang et al. (2015) indicated the relationship between the rs17027478 SNP and Recurrent Spontaneous Abortion (RSA) risk. In addition, they revealed lower MTOR mRNA expression in RSA women[29]. In their study, Yin et al. (2017), did not find a significant relationship between the MTOR rs17036508 and the chance of type II diabetes mellitus in the Chinese population[30]. However, in another study, Zhu et al showed the effect of rs7212142 polymorphism on type 2 diabetic nephropathy[31]. A study conducted by Husen et al. showed the relation between the MTOR rs2295080CC genotype and the development of diabetes mellitus in liver transplant recipients after receiving inhibitor Everolimus medication[32]. In another investigation, Saravani et al. (2020) indicated the role of rs2295080 TT genotype and T allele on systemic lupus erythematosus[33]. Xin et al. (2015), found no significant relationship between rs229508 and rs2536 variants and epilepsy. However, they showed a higher frequency of rs2536 G allele in children with epilepsy[34].

In addition, several studies have been conducted to investigate the relationship between MTOR polymorphisms and different types of cancer, and several meta-analyses have also been conducted on them. In a systematic review conducted by Zining et al. (2016), the MTOR rs1034528, rs1883965, and rs17036508 variants were associated with cancer susceptibility only in the over-dominant model. In addition, they found a higher risk of acute leukemia and a lower risk of genitourinary cancers in the presence of the rs2295080 G allele in recessive and dominant models, respectively. However, they did not show a significant relationship between rs2536 polymorphism and these cancers[35]. Another meta-analysis performed by Qi et al. (2020) on eighteen articles from China, the MTOR rs2295080 polymorphism was associated with a reduced risk of cancer. Similar results were observed in urinary system tumors and prostate cancer. However, an increased risk of leukemia was indicated in their study. Indeed, they indicated a significant relationship between rs2536 polymorphism of MTOR gene[28]. Min et al. (2022) showed that the MTOR rs2295080 G allele could lead to lower risk of cancer development. Similar findings were observed in urinary tract cancer and breast cancer. However, this allele (G allele) was associated with increased leukemia risk[36].

The results of in silico analysis showed that rs17036508 T > C substitution has disrupted several binding motifs related to Sam68, hnRNP G, SLM-2, and ETR-3 proteins. In addition, the rs2295080T to C conversion could lead to loss of the binding site for transcription factor II-I. The length of each box of the transcription factor specifies the predicted binding sequence (Fig. 2).

Previous research showed that biochemical activities related to sam68 were involved in carcinogenesis, and also the function of this protein might be related to the initiation and progression of endocrine tumors. Some studies have also identified the expression of sam68 as an important factor in the expression of VEGFR1 in the placenta [37, 38]. Other study indicated that the slm2 protein involved in several processes, such as actin cytoskeleton organization and mTOR signaling, could be considered as an effective factor that facilitates the phosphorylation[39]. As a multifunctional transcription factor, TFII-I plays a significant role in regulating gene expression. This factor also plays a role in DNA damage repair. The inhibition of MCF-7 growth by TFII-I also demonstrated the anti-tumorigenic effect of this protein [40].

Although this study showed that the effects of MTOR polymorphisms on PE susceptibility were noble, it suffered from some limitations. First, the low sample in subgroup size leads to a low number of mutant homozygotes that could affect the analysis. Second, lack of mTOR assay, so if we could compare the mTOR levels between MTOR polymorphisms, the study could be more valuable. Further studies in other countries are necessary to confirm or refute these results.

In conclusion, the current study indicated the effects of maternal MTOR rs17036508 T/C polymorphism on increased PE risk. However, rs2295080 T/G and rs2536 T/C polymorphisms were not associated with PE susceptibility. The MTOR TTC and TGC haplotypes of rs2536/ rs2295080/ rs17036508 polymorphisms were associated with higher PE risk. The MTOR rs2295080 and rs17036508 variants were associated with an increased risk of EOPE and EOPE / LOPE, respectively. In addition, the MTOR rs2295080 but not rs17036508 polymorphism was associated with risk of PE severity. The in silico analysis showed that rs17036508 T/C polymorphism can disrupt several binding motifs and the rs17036508T/C substitution can remove the binding site for transcription factor

Preeclampsia

PCR-RFLP

Polymerase Chain Reaction- Restriction Fragment Length polymorphism

EOPE

Early-onset Preeclampsia

LOPE

Late-onset Preeclampsia

Sam68

Src associated in mitosis, of 68 kDa

hnRNP G

heterogeneous nuclear ribonucleoprotein G

ETR-3

Elav-type RNA-binding protein

TFII-I

Transcription factor II-I

PI3K/AKT/mTOR

Phosphoinositide-3 kinase-AKT-Mammalian target of the rapamycin

SNP

Single Nucleotide Polymorphism

EVT

Extravillous Trophoblast

Acknowledgments

This article was extracted from a PhD dissertation at Zahedan University of Medical Sciences (IR.ZAUMS.REC.1399.349). Financial support was received from Iran National Science Foundation (INSF, project No 98023121) to conduct this study.

Author Contributions

All authors contributed to the study's conception and design. Material preparation, data collection and analysis were performed by [Mahnaz Rezaei], [Marzieh Ghasemi], [Fatemeh Ghahghayi], [Mohsen Saravani] and [Saeedeh Salimi]. In silico analysis was performed by [Hossein Shahraki-Ghadim]. The first draft of the manuscript was written by [Mahnaz Rezaei] and [Saeedeh Salimi]. All authors commented on previous versions of the manuscript. All authors read and approved the final manuscript.

Conflict of Interest

All authors declare no conflict of interest to disclosure.

Ethical approval

This study was performed in line with the principles of the Declaration of Helsinki. The study protocol was approved by the ethics committee of Zahedan University of Medical Sciences (IR.ZAUMS.REC.1399.349).

Data Availability Statement

The data that support the findings of this study are available from the corresponding author, upon reasonable request.

Bibbins-Domingo K, Grossman DC, Curry SJ, Barry MJ, Davidson KW, Doubeni CA, Kurth AE (2017) Screening for preeclampsia: US preventive services task force recommendation statement. JAMA 317(16):1661–1667
Jahan F, Vasam G, Green AE, Bainbridge SA K.J. Menzies,(2023) Placental Mitochondrial Function and Dysfunction in Preeclampsia, Int J Mol Sci 24(4) 4177
Jena MK, Sharma NR, Petitt M, Maulik D, Nayak NR (2020) Pathogenesis of preeclampsia and therapeutic approaches targeting the placenta. Biomolecules 10(6):953
Nakashima A, Aoki A, Kusabiraki T, Shima T, Yoshino O, Cheng SB, Saito S (2017) Role of autophagy in oocytogenesis, embryogenesis, implantation, and pathophysiology of pre-eclampsia. J Obstet Gynecol Res 43(4):633–643
Nakashima A, Cheng S-B, Ikawa M, Yoshimori T, Huber WJ, Menon R, Sadovsky Y (2020) Evidence for lysosomal biogenesis proteome defect and impaired autophagy in preeclampsia. Autophagy 16(10):1771–1785
Vivanco I, Sawyers CL (2002) The phosphatidylinositol 3-kinase–AKT pathway in human cancer. Nat Rev Cancer 2(7):489–501
Moore T, Beltran L, Carbajal S, Strom S, Traag J, Hursting SD, DiGiovanni J (2008) Dietary energy balance modulates signaling through the Akt/mammalian target of rapamycin pathways in multiple epithelial tissues. Cancer Prev Res 1(1):65–76
Saxton RA, Sabatini DM (2017) mTOR signaling in growth, metabolism, and disease. Cell 168(6):960–976
Yuan Y, Shan N, Tan B, Deng Q, Liu Y, Wang H, Zhang H (2018) SRC-3 plays a critical role in human umbilical vein endothelial cells by regulating the PI3K/Akt/mTOR pathway in preeclampsia. Reproductive Sci 25(5):748–758
Yang Q, Guan K-L (2007) Expanding mTOR signaling. Cell Res 17(8):666–681
Patel PH, Chadalavada RS, Chaganti R, Motzer RJ (2006) Targeting von Hippel-Lindau pathway in renal cell carcinoma. Clin Cancer Res 12(24):7215–7220
Arroyo JA, Brown LD, Galan HL (2009) Placental mammalian target of rapamycin and related signaling pathways in an ovine model of intrauterine growth restriction, Am J Obstet Gynecol 201(6) 616. e1-616. e7.
Tsai K, Tullis B, Jensen T, Graff T, Reynolds P, Arroyo J (2021) Differential expression of mTOR related molecules in the placenta from gestational diabetes mellitus (GDM), intrauterine growth restriction (IUGR) and preeclampsia patients. Reprod Biol 21(2):100503
Wu D, Hong H, Huang X, Huang L, He Z, Fang Q, Luo Y (2016) CXCR2 is decreased in preeclamptic placentas and promotes human trophoblast invasion through the Akt signaling pathway. Placenta 43:17–25
Lai WS, Ding YL (2019) GNG7 silencing promotes the proliferation and differentiation of placental cytotrophoblasts in preeclampsia rats through activation of the mTOR signaling pathway. Int J Mol Med 43(5):1939–1950
Shao J, Li Y, Zhao P, Yue X, Jiang J, Liang X, He X (2014) Association of mTOR polymorphisms with cancer risk and clinical outcomes: a meta-analysis. PLoS ONE 9(5):e97085
Li Q, Gu C, Zhu Y, Wang M, Yang Y, Wang J, He J (2013) Polymorphisms in the mTOR gene and risk of sporadic prostate cancer in an Eastern Chinese population. PLoS ONE 8(8):e71968
Cao Q, Ju X, Li P, Meng X, Shao P, Cai H, Yin C (2012) A functional variant in the MTOR promoter modulates its expression and is associated with renal cell cancer risk. PLoS ONE 7(11):e50302
Rezaei M, Eskandari F, Mohammadpour-Gharehbagh A, Teimoori B, Yaghmaei M, Mokhtari M S. Salimi,(2018) The Drosha rs10719 T > C polymorphism is associated with preeclampsia susceptibility, Clin Exp Hypertens 40(5) 440–445
Piva F, Giulietti M, Burini AB, Principato G (2012) SpliceAid 2: a database of human splicing factors expression data and RNA target motifs. Hum Mutat 33(1):81–85
Hannenhalli S, Levy S (2001) Promoter prediction in the human genome. Bioinformatics 17(suppl1):S90–S96
Farré D, Roset R, Huerta M, Adsuara JE, Roselló L, Albà MM, Messeguer X (2003) Identification of patterns in biological sequences at the ALGGEN server: PROMO and MALGEN. Nucleic Acids Res 31(13):3651–3653
Solé X, Guinó E, Valls J, Iniesta R, Moreno V (2006) SNPStats: a web tool for the analysis of association studies. Bioinformatics 22(15):1928–1929
Baltajian K, Hecht JL, Wenger JB, Salahuddin S, Verlohren S, Perschel FH, Rana S (2014) Placental lesions of vascular insufficiency are associated with anti-angiogenic state in women with preeclampsia. Hypertens Pregnancy 33(4):427–439
Lokeswara AW, Hiksas R, Irwinda R, Wibowo N (2021) Preeclampsia: From Cellular Wellness to Inappropriate Cell Death, and the Roles of Nutrition. Front Cell Dev Biol 9:726513
Aouache R, Biquard L, Vaiman D, Miralles F (2018) Oxidative Stress in Preeclampsia and Placental Diseases, Int J Mol Sci 19(5)
Weel I, Ribeiro V, Romão-Veiga M, Fioratti E, Peraçoli J, Peraçoli M (2023) Down-regulation of autophagy proteins is associated with higher mTOR expression in the placenta of pregnant women with preeclampsia, Braz J Med Biol Res 55
Qi G-H, Wang C-H, Zhang H-G, Yu J-G, Ding F, Song Z-C, Xia Q-H (2020) Comprehensive analysis of the effect of rs2295080 and rs2536 polymorphisms within the mTOR gene on cancer risk. Biosci Rep 40(7):BSR20191825
Xiang H, Liu S, Zong C, Li Z, Liu Y, Ma X, Cao Y (2015) A single nucleotide polymorphism in the MTOR gene is associated with recurrent spontaneous abortion in the Chinese female population. Syst biology reproductive Med 61(4):205–210
Yin X, Xu Z, Zhang Z, Li L, Pan Q, Zheng F, Li H (2017) Association of PI3K/AKT/mTOR pathway genetic variants with type 2 diabetes mellitus in Chinese, diabetes research and clinical practice 128 127–135
Zhu A, Yang X, Sun M, Zhang Z, Li M (2015) Associations between INSR and MTOR polymorphisms in type 2 diabetes mellitus and diabetic nephropathy in a Northeast Chinese Han population. Genet Mol Res 14(1):1808–1818
Husen P, Straub K, Willuweit K, Hagemann A, Wedemeyer H, Bachmann HS, Herzer K (2019) SNPs within the MTOR gene are associated with an increased risk of developing de novo diabetes mellitus following the administration of everolimus in liver transplant recipients, Transplantation Proceedings, Elsevier, pp. 1962–1971
Saravani M, Shahraki-Ghadimi H, Maruei-Milan R, Mehrabani M, Mirzamohammadi S, Nematollahi MH (2020) Effects of the mTOR and AKT genes polymorphisms on systemic lupus erythematosus risk. Mol Biol Rep 47:3551–3556
乐鑫, 赵培伟, 刘智胜, 吴革菲, 涂飞, 胡家胜, 何学莲,(2015) mTOR 基因多态性与小儿癫癎易感性的相关性, 中国当代儿科杂志 17(6) 560-564.
Zining J, Lu X, Caiyun H, Yuan Y (2016) Genetic polymorphisms of mTOR and cancer risk: a systematic review and updated meta-analysis. Oncotarget 7(35):57464
Min Z, Mi Y, Lv Z, Sun Y, Tang B, Wu H, Lu C (2022) Associations of genetic polymorphisms of mTOR rs2295080 T/G and rs1883965 G/a with susceptibility of urinary system cancers, Disease Markers 2022 1–16
Bielli P, Busà R, Paronetto M, Sette C (2011) The RNA-binding protein Sam68 is a multifunctional player in human cancer. Endocrine-related Cancer 18(4):R91–R91
Awe O, Sinkway JM, Chow RP, Wagener Q, Schulz EV, Jeremy YY, Lee K-H (2020) Differential regulation of a placental SAM68 and sFLT1 gene pathway and the relevance to maternal vitamin D sufficiency. Pregnancy Hypertens 22:196–203
Fadri M, Daquinag A, Wang S, Xue T, Kunz J (2005) The pleckstrin homology domain proteins Slm1 and Slm2 are required for actin cytoskeleton organization in yeast and bind phosphatidylinositol-4, 5-bisphosphate and TORC2. Mol Biol Cell 16(4):1883–1900
Tanikawa M, Wada-Hiraike O, Nakagawa S, Shirane A, Hiraike H, Koyama S (2011) Multifunctional transcription factor TFII-I is an activator of BRCA1 function. Br J Cancer 104(8):1349–1355. K. Nagasaka,

No competing interests reported.

Download PDF

Journal Publication

published 23 Feb, 2024

Read the published version in Molecular Biology Reports →

Editorial decision: Revision requested
27 Nov, 2023
Reviews received at journal
27 Nov, 2023
Reviewers agreed at journal
14 Nov, 2023
Reviewers invited by journal
14 Nov, 2023
Submission checks completed at journal
14 Nov, 2023
Editor assigned by journal
14 Nov, 2023
First submitted to journal
12 Nov, 2023

You are reading this latest preprint version

The possible effects of the MTOR polymorphisms on Preeclampsia susceptibility, severity, and onset: A case-control study and in silico analysis

Status:

Journal Publication

Version 1

Abstract

Background

Methods and Results

Conclusion

Figures

Introduction

Materials and Methods

Subjects

Genetic analysis

In silico analysis

Statistical analysis

Results

In silico analysis

Discussion

Abbreviations

Declarations

References

Additional Declarations

Status:

Journal Publication

Version 1