Very recently, an interesting phenomenon was described in the common vole; vole parents with similar locomotor ability produced significantly larger litters. Positive assortative mating is a tendency to prefer individuals with similar phenotypes. We tested whether this also applies to smell similarity. Odor preference was tested in a T-maze, where each female was presented with two male odors, i. e. shavings together with feces and urine from home boxes. After female preference was established, the female was either paired with a preferred male (chosen) or paired with a non-preferred male (opposite choice). For analysis of the relationship to odour preference, genotyping of MHC Class II DRB was done using amplicon sequencing. In the set of 45 individuals from two populations, we recovered 38 nucleotide haplotypes (alleles). Similarity of alleles in parent pairs according to the indexes of Sørensen-Dice (S-D) and Jaccard were calculated. Values of these indexes in parental pairs with preferred males were higher (more similar) than in not preferred (S-D: F(1, 20) = 8.489, p =0.009, Jaccard: F(1, 20) = 6.563, p = 0.019). The number of offspring in parental pairs with preferred males were higher than in not preferred (F(1, 20 ) = 4.915, p = 0.038). However, the correlation between the mentioned indexes and the number of offspring was very low. The relationship between the success of reproduction and alleles is not clear-cut, this may be influenced by the measure of similarity we used, or by something that we could not detect.
Research Article
Odor preferred males led to a higher offspring number in the common vole
https://doi.org/10.21203/rs.3.rs-3603241/v1
This work is licensed under a CC BY 4.0 License
Journal Publication
published 26 Mar, 2024
You are reading this latest preprint version
Study of vole populations and their interactions with the environment is important not only for fundamental science (Lantová et al. 2011; Eccard and Herde 2013; Herde and Eccard 2013; Gracceva et al. 2014; Urbánková et al. 2020), but also for applied science such as pest management and conservation (Jacob et al. 2014, 2020; Heroldová et al. 2021). Variability in reproduction is an important subject to study. With regard to this, an interesting phenomenon was described in the common vole; vole parents with similar locomotor ability produced significantly larger litters (Urbánková et al. 2023). This is known as positive assortative mating. Positive assortative mating is a tendency to prefer individuals with similar phenotypes, while negative assortative mating is a preference for individuals with a different phenotype (Jiang et al. 2013). Thiessen et al. (1997) argued that positive assortative mating may be a successful strategy since couples sharing a similarity are likely to pass more than 50% of their genetic information onto their offspring. However, inbreeding depression can deteriorate the viability of the future reproductive line. Therefore, in the preference for partners with a different phenotype, there is the opposite tendency to maintain high genetic diversity, for example of the main histocompatibility complex (MHC) genes (Leclaire et al. 2017; Santos et al. 2016). This raises the question; Does negative assortative mating occur in the common vole as a counterbalance to the observed positive assortative mating, in order to sustain genetic polymorphism (Jiang et al. 2013, Hedric et al. 2018).
Negative assortative mating, also called disassortative mating, favours pairs formed by individuals with different phenotypes or genotypes, i.e., different sizes, different colours or with different MHC genes. Probably the most extensive occurrence of disassortative mating was found in the white-throated bunting (Zonotrichia albicollis) in connection with colour polymorphism. White-throated buntings have either a black head with a white stripe or a black head with a brown and white stripe. In 98.2% of cases, pairs were formed from differently coloured individuals (Hedrick et al. 2018). In mammals, we can encounter this phenomenon too, for example, in wolves in Yellowstone National Park (Hedrick et al. 2016). The examples mentioned are manifestations of disassortative pairing based on morphological characters.
The most frequent occurrence of negative assortative mating is associated with a preference for MHC genotype dissimilarity, which is presented by odour (see e.g., Yamazaki et al. 1999, Penn & Potts 1999). The more diverse the MHC, the better it can defend against a greater number of pathogens or parasites. Therefore, it is important to maintain this diversity. Zufall et al. (2005) and Boehm & Zufall (2006) found that MHC class I molecules are important for MHC genotype signalling, precisely in the epithelium of the vomeronasal organ, and are also necessary for the proper functioning of the adaptive immune system. MHC gene products are found in various secretions, which create a specific odour also aided by bacterial decomposition. This smell then conveys information about its owner to a mating partner (Heath & Carbone, 2001). Beyond this genetic distance, odour can inform, for example, about an individual's sex, age, reproductive condition and general viability (Manzini & Korsching 2011). All these components contribute to the constancy of an individual odour (Penn et al. 2007). The smell is even able to reveal whether the wearer is in a stressful or restful state (Cecchetto et al. 2019) and indirectly indicate their social status (Manzini & Korsching 2011).
Since females tend to invest more in gamete formation and care for the young, they are more sex-selective. Therefore, they choose sexual partners which have some direct or indirect advantages, for example good genes (Kirkpatrick 1996), which are then inherited by the offspring. Several studies show that the urine of sick individuals has a different smell and animals can identify these smells. In female house mice (Mus musculus domesticus), it was found that out of three samples, where one sample was the urine of a sick male, the second was the urine of a healthy individual and the third control sample was pure water, the females spent the least time with the urine of the infected male (Hurst 1990). Similar studies were also carried out with the prairie vole (Microtus ochrogaster) and the Pennsylvania vole (Microtus pennsylvanicus). The male voles were infected with the spiralworm (Trichenella spiralis), which it is not transmissible through contact between individuals. As expected, Pennsylvania voles preferred healthy individuals, but prairie voles did not. One possible explanation is the different mating systems of these two species, Pennsylvania voles are polygynous, while prairie voles are monogamous, so the value of health status may not have been decisive for them (Klein et al. 1999).
Based on the above, we decided to explore the mechanisms affecting the number of young in the common vole. In our latest study, it was found that the similarity of a behavioral personality trait in a parent pair increases the number of offspring produced (Urbánková et al. 2023). Here, we focused on odor preference, which is linked to MHC and investigated whether a pairing tendency with different or similar haplotypes prevails. First, we tested the odour preference for male common voles by females in the T-maze. We then paired both odour-preferred and non-preferred males with females. After that, we related the number of offspring to odour preference and finally we attempted to explain the results by similarity or dissimilarity of MHC alleles.
2.1 Vole individuals
Wild common voles (Microtus arvalis) were caught on agriculturally managed meadows from April to September 2021 using Sherman live traps for small mammals. The parental pairs came from two distant localities (about 30 km apart), locality 1: České Budějovice, 48.977821 N, 14.441390 E, locality 2: Veselí nad Lužnicí, 49.080373 N, 14.755786 E). In total 80 animals were captured, of which 78 individuals, 39 males and 39 females, were used for testing. To ensure that the animals were adults, sexual maturity was determined in males according to the scrotal position of the testes and in females according to the presence of a standard image of proestrus or oestrus based on a vaginal smear (Cora et al. 2015; Nubbemeyer 1999).
2.2 Breeding conditions
Voles were kept individually in polycarbonate breeding boxes 58 x 36 x 20 cm (T3 VELAZ Prague) with wood shavings, hay, and a plastic tube as a shelter (l = 15 cm, d = 4 cm). Commercial pellets for rats and mice, as well as pellets for guinea pigs and rabbits (VELAZ Prague), fresh carrots and water were available ad libitum. All individuals were individually marked on the breeding boxes. The laboratory conditions were stable, with room temperature about 19°C and humidity about 50% under a L:D 16:8 photoperiod.
The voles were bred and tested in accordance with the principles of animal welfare and guidelines of the Departmental Commission for Animal Protection of the Ministry of Education, Youth and Sports in Czechia (permit number 7945/2010-30). These guidelines on animal treatment also conform to the journal’s ethics guidelines. After the experiments, the voles were kept in the laboratory and were used for further breeding and behavioural tests.
1.3 Test T-maze
Odor preference was tested in the T-maze, which was made up of three parts: the main arm and two side arms – right and left. These arms were made of Plexiglas and had a square cross-section of 8 x 8 cm. The length of the main arm was 50 cm and the length of the side arms was 25 cm. A starting box (35 x 20 x 15) was attached to the main arm, into which the vole in the home tube was inserted. After insertion, this box was covered with a glass plate so that the animal could not possibly escape. Small boxes (20 x 15 x 14) were placed at the end of the side arms, into which the container with the odor was placed. These small boxes were separated from the side arms by a metal grid. The small odor boxes were covered with opaque Plexiglas sheets so that the embedded odor shavings would not interfere with the vole's perception of movement based on dark coloration by the tracking program (see EthoVision program). The resulting length of the assembled labyrinth was 90 cm and width 110 cm. The entire labyrinth was placed on a pedestal at a height of 80 cm. A camera was installed above the labyrinth to record the trials. The computer used by the experimenters to monitor the entire experiment was located in another room so that the voles would not be disturbed.
2.4 Odor preference test
The first series of experiments with 13 males and 13 females took place in June 2021. The second series, again with 13 males and 13 females, took place in August 2021, and the third series with the same number of individuals took place in October 2021. The test was always carried out at the same time of day in all phases and under the same conditions.
Odors were collected from all individuals. The shavings together with feces and urine were collected in a jar with a closable lid. Each animal was presented with two odors of the opposite sex. The jars were placed in small boxes at the end of the side arms and were separated from the labyrinth by a grid that prevented the animal from entering the odor jar directly, but at the same time allowed for the best presentation of the odor. Before the start of each trial, all parts of the labyrinth were cleaned with an alcohol solution and rinsed with water.
The test animal was placed in a tube in the starting box of the labyrinth. After inserting the transport tube with the vole and covering the starting box with a cover glass, recording was started in the EthoVision program. The trial duration was set to 3 minutes. This time limit was evaluated based on pilot tests as sufficient for the manifestation of odor preference. In sporadic cases, the individual did not climb out of the tube after 3 minutes, and then the interval was extended to 6 min.
For the evaluation of odor preference, the decisive parameter was the time spent on the right or left segment of the T-maze. The odor with which the individual spent more time was marked as preferred. The difference ranged between 7 and 54 s while the animals moved cautiously and switched sides several times. After the experiment, the individual was returned to the breeding box and moved to the breeding room. After testing all individuals in a given phase, pairs were formed on the basis of female selection, see Table. 1.
2.5 Formation of pairs
After female preference was established, the female was either paired with a preferred male (chosen) or paired with a non-preferred male (opposite choice). Parental pairs were created by adding a male to the female's larger breeding box (T4) according to the test result, - Table 1. They were left together for 6 days. During this interval, we watched to see if any of the partners tried to escape. After this time, the males were removed from the females’ boxes, and it was noted whether they were found together in the tube or shared a nest. After mating, males were returned to their original breeding boxes (size T3). A litter of young was expected after approximately 19–22 days. Most of the young were born exactly 21 days after the female and male were put together. Pups were counted and weighed after birth, their weight was checked weekly for three weeks. After three weeks, the female was separated from her offspring and placed in a separate T3 box.
| Test order | Male odour ID | Female preference ID | Male Odour ID | Preferred male | Pairs put together ID |
|---|---|---|---|---|---|
| 1 | M1 | ↖ F1 | M2 | chosen | M1F1 |
| 2 | M2 | ↗ F2 | M3 | opposite choice | M2F2 |
| 3 | M3 | ↗ F3 | M4 | chosen | M4F3 |
| 4 | M3 | ↖ F4 | M5 | opposite choice | M5F4 |
| 5 | M3 | ↖ F5 | M6 | chosen | M3F5 |
2.6 Genetic analysis of vole individuals
The voles tested in the summer season and partially also in the spring and autumn season (22 pairs in total, equally represented between the two localities) were subjected to DNA analysis. For analysis of the relationship to odour preference, genotyping of MHC Class II DRB was done (Meléndez-Rosa et al. 2018) using amplicon sequencing. A piece of tissue from finger and spleen from each individual after euthanasia was dissected and kept in pure ethanol. All DNA samples were extracted using DNeasy Blood and Tissue kit (QIAGEN) following the manufacturer’s instructions. Then a dual-indexed amplicon library was created to multiplex all samples in one sequencing run. Amplicon PCR was done for all samples in duplicates to control for amplification bias and included negative controls following the Illumina protocol (Illumina 16S metagenomic sequencing library preparation, 2017). DNA template concentration for every sample was at minimum 4 ng/µl for the first PCR step. Reactions contained: 2,5 µl of the DNA sample, 12,5 µl of KAPA HotStart ReadyMix (Roche), 5 µl of 1µM forward primer and 5 µl of 1µM reverse MioeL primers (Kloch et al. 2012) extended with Illumina overhang at the 5’ end (compatible with the indexing primers below). Thermocycler setup was as follows: initial denaturation at 95°C for 3 minutes, 25 cycles of: denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds and elongation at 72°C for 30 seconds, with final elongation at 72°C for 5 minutes.
PCR reactions were cleaned using AMPure XP beads (Beckman) and all samples were measured on a Qubit fluorometer using a dsDNA High Sensitivity kit. Gel electrophoresis was done using 1,5% agarose gel with GelRed (Biotium), GeneRuler 100 bp Plus DNA (ThermoFisher) ladder, and 6x Loading Dye (ThermoFisher). All samples produced visible bands, and concentrations above 0,223 ng/µl and were used for the second, indexing PCR step.
The indexing PCR mixture included: 5 µl of the Amplicon PCR product, 25 µl of KAPA HotStart ReadyMix (Roche), 10 µl of H2O, 5 µl of the 5µM forward index primer (S5: AATGATACGGCGACCACCGAGATCTACAC(indexS5)TCGTCGGCAGCGTC), and 5 µl of the 5µM reverse index primer (N7: CAAGCAGAAGACGGCATACGAGAT(indexN7)GTCTCGTGGGCTCGG).
PCR was run for 8 cycles using the same thermal profile as above. Also, the PCR reaction clean-up, measurement on a Qubit fluorometer, and gel electrophoresis procedures were identical. All samples were of high quality. They were adjusted to the same 30 nM concentration, pooled, and sent to Novogene (Cambridge, UK) for sequencing on the Illumina NovaSeq machine (1.5 million of 250 bp paired-end reads).
Adaptors and low-quality bases were removed from sequence reads by cutadapt (Martin 2011). Forward and reverse reads were assembled by PEAR (Zhang et al. 2014) and only reads with 169bp length were retained. Unique reads were collapsed and their frequency within an amplicon was used to distinguish error reads from true MHC alleles. We retained the first three to nine alleles per individual with frequency at least 1000, as we observed a clear bimodal distribution of coverage (Fig. 2). This straightforward filtering strategy was validated by comparison of genotypes between replicates that showed 100% repeatability. Population level analyses were done in DNA SP v. 6 (Rozas et al. 2017) and Arlequin (Excoffier et al. 2010) while haplotype network was constructed in Popart (Leigh & Bryant 2015).
2.7 Statistical processing
Recorded values of all behavioral parameters listed in section 2.4. were first evaluated by principal component analysis (PCA), using the CANOCO5 program (terBraak & Šmilauer 2012). Since a large number of strong correlations appeared here, in the second step we evaluated the total duration of the occurrence in a certain segment and the latency of leaving the tube. For comparison of two files, we used one way ANOVA in Statistica 13 (TIBCO Software Inc. 2017). Afterwards, generalized linear models (GLM) were set up to evaluate the effect of odor preference, annual phase (season), body weight, and lateral difference in preference (right – left) on the number of offspring using R 3.6.3 software program (R Core Team, 2020). To compare similarity of allele sets between parents, we assembled indexes according to Jaccard (Levandowsky & Winter 1971) and Sørensen–Dice (Ondov et al. 2016)
3.1 Odor preference parameters in the T-maze
Evaluation of odor preference was based on the occurrence of individuals at the odor source, i.e., occurrence on one side or the other of the maze, left or right. Several forms of occurrence were determined. PCA was used to clarify the relationship between these forms. Figure 3 presents the behavior of females when choosing males. Total duration was chosen for the evaluation of preference. Absolute difference between left and right side in this parameter ranged from 7 to 118 s.
3.2 Relationship between offspring number and independent variables
The best relationship was characterized by the following GLM: offspring ~ season + female choice + female weight, family = poisson. (Table 3, AIC = 147.47). The independent variable season (a - spring, b - summer, c - autumn) had the highest influence (Table 4, for “b” p = 0.0004, „c“ p = 0.0002, Fig. 4). A female with a preferred male (p), based on smell, had a significantly larger litter than with a not preferred male(n) (Table 4, p = 0.0156, Fig. 5). Following this, female body weight no longer had a statistically significant effect (Table 4, p = 0.09). The GLM with locality variable (offspring ~ season + female choice + parent locality, AIC = 152.24, Table 2), was a weaker model.
|
Reaction variable |
glm |
AIC |
|---|---|---|
|
offspring |
~season + f_choice + parent_loc + f_weight |
150.22 |
|
“ |
~season + f_choice + parent_loc |
152.24 |
|
“ |
~season + f_choice + f_weight |
147.47 |
|
“ |
~season + f_choice |
148.34 |
|
“ |
~season |
152.22 |
|
Coefficients |
Estimate |
Std. Error |
z value |
Pr(>|z|) |
|---|---|---|---|---|
|
Intercept |
0.49886 |
0.67758 |
0.736 |
0.4616 |
|
seasonb |
-0.93415 |
0.26352 |
-3.545 |
0.0004 |
|
seasonc |
-1.05802 |
0.28495 |
-3.713 |
0.0002 |
|
f_choicep |
-0.50520 |
0.20900 |
-2.417 |
0.0156 |
|
f_weight |
0.06174 |
0.03625 |
1.703 |
0.0885 |
Despite parent locations not being important components in the models, we also compared the offspring number in pairs with not preferred males from the same and different locations. If the not-preferred male came from the same locality as the female, this pair had a larger litter compared to pairs with a not-preferred male from another locality than the female (F(1, 16 ) = 3.802, p = 0.069). Conversely, a not-preferred male from a different locality than the female, resulted in lower offspring numbers.
3.3 MHC allelic set
In the set of 45 individuals from two populations, we recovered 38 nucleotide haplotypes (alleles). Number of alleles per individual ranged from three to nine, indicating several paralogous loci being amplified. The majority of individuals carried 6 alleles and the extremes of three and nine alleles were rare (two and two individuals, respectively). Most alleles − 18 alleles - were shared while 13 were unique to Veselí (V) and 7 unique to Budějovice (B). The unique alleles were low in frequency and the genetic differentiation between the populations estimated either by Fst (-0.0038) or Pxy (-0.109) was statistically non-significant. Total nucleotide diversity was 0.162 and was very similar for both populations. The same applies for haplotype diversity with values around 0.944 (Table 4).
|
Statistical parameters |
Locality Budějovice (B) |
Locality Veselí (V) |
Total |
|---|---|---|---|
|
No ind |
23 |
22 |
45 |
|
No alleles |
24 |
32 |
38 |
|
No polymorphic sites |
76 |
84 |
85 |
|
Nucletide diversity JC corrected |
0.16893 |
0.16745 |
0.16155 |
|
Haplotype diversity |
0.92272 |
0.95255 |
0.944 |
Similarity of alleles in parent pairs according to the indexes of Sørensen-Dice and Jaccard are presented in Table 5. Their values ranged between 0.0 and 1.0. Values of these indexes in parental pairs were compared between the female choice alternatives (S-D: F(1, 20) = 8.489, p = 0.009, Fig. 6; Jaccard: F(1, 20) = 6.563, p = 0.019) and correlated with the number of offspring (S-D: r = 0.09, p = 0.69; Jaccard: r = 0.07, p = 0.75), also presented in the Table 5. The relationship between the number of offspring and the female choice alternatives is only just significant (F(1, 20 ) = 4.915, p = 0.038), similar to the whole data set analysed by glm.
4.1 Seasonality
Common vole females produce about four litters of 1–13 young each year, averaging 5.5 young (Reichstein 1957, 1960 ex Niethammer and Krapp 1982). In laboratory conditions, it is an average of 4.2 young per litter. The stated decrease in value is explained by less suitable rearing conditions and embryonic mortality (Reichstein 1964 ex Niethammer & Krapp 1982). These authors calculated the average value based on the number of pups born only. In our case, the average value for all pairs was 2.6 offspring per litter, respectively 3.5 offspring for all fertile females. This shift could only be due to the fact that, in our organized mating, roughly half of the pairs consisted of females with non-preferred males.
The period in which the animals were caught and tested had a more significant influence on the offspring number (p < 0.001) than female choice, following pairing with preferred or non-preferred males. In the first test round in May-June, all pairs were reproductively successful with an average number of 4.2 young per litter. In the second test round, which took place in August, nine pairs were reproductively successful, and the average value was 2.8 young per litter. In the third test round, only seven pairs were successful, with an average of 3.3 young per litter. The observed trend is consistent with published data on the breeding intensity of the field vole in Central Europe during the growing season (Reichstein 1957, 1960, 1964 ex Niethammer and Krapp 1982, Tkadlec & Zejda 1998). It is not entirely clear whether the biological changes are controlled completely by the circadian endogenous rhythm, or whether the circannual endogenous rhythm is also involved. For a critical reassessment, see an inspiring overview of the issue by Kumar & Mishra (2018). In the laboratory, a summer light regime L:D 16:8 was set to maximally promote reproduction, but nevertheless, there was a gradual suppression of sexual activity. This could indicate endogenous rhythms of voles that continue even when the animals are placed in the stable conditions of a laboratory environment with sufficient lighting, food supply and constant temperature (Kumar & Mishra 2018). The observed seasonality in our results was in accordance with the recorded stages of the estrous cycle of females. The frequency of resting diestrus increases towards autumn (Tab. S1-3).
4.2 Behavioral evidence
If we start with the idea that the goal of reproduction is to pass on one's own genes to subsequent generations, it is generally accepted that females may be inclined to select males whose genomes are closely aligned with their own (Thiessen et al. 1997, Jiang et al. 2013). However, it is also necessary to consider that in this way, more isolated populations may tend to reduce heterozygosity and could be threatened by inbreeding depression (Charlesworth & Willis 2009), if there was also no preference for differences primarily represented by different MHC and mediated by smell (Yamazaki et al. 1999). Our experiment of pairing females with an odor-preferred male resulted in a higher number of young, by about one pup. These results suggest that common vole females are able to choose a male with which she will have greater reproductive success based on odor preference. Conversely, females are also able to avoid, if possible, an unsuitable male with whom she may have lower fitness.
Partner preference has also been studied in other small rodents, e.g., house mice (Mus musculus). In this polygynous to promiscuous species, higher litter numbers (93.3 against 71.1%) were also found in pairs with preferred individuals (Drickamer et al. 2000). Also, in the monogamous California hamster (Peromyscus californicus), females with a preferred male produced litters faster and had higher reproductive success than females with a non-preferred male (Gleason et al. 2012). Similarly, in mound-building mice (Mus spicilegus) pairs with preferred individuals based on behavioral similarity were more reproductively successful (Rangassamy et al. 2015). This species lives in monogamous pairs where the father helps raise the offspring. In such a social system, it is quite understandable that similarity in behavior is useful for reproduction. However, in the common vole a species characterized by promiscuity and by males and females living under completely distinct social conditions, higher parental similarity was also associated with incresed reproductive success (Urbánková et al 2023).
When considering the proximate mechanism of the influence of female odor preference, it is necessary to consider both the positive effect of the odor of the preferred male, as well as the negative effect of the odor of the non-preferred male. One mechanism of significant influence could be induced ovulation, which is convenient for random contact of partners at low population densities (Katandukila and Bennett 2016). Induced ovulation is apparently a general trait of voles of the genus Microtus. Proximity of a male behind mesh can lead to ovulation in females, and the exchange of the male behind the barrier can further promote the effect (Clulow and Mallory 1970, Milligan 1974). In the female vole, this neuro-hormonally controlled process could be supported by the positive perception of the male, but on the contrary also delayed or stopped by a negative odor stimulus. When testing sexual odor preference in females, it is important that they are in estrus. Since provoked ovulation should be considered here, proestrus was also included in the odor-sensitive state. On the contrary, in the case of metestrus or diestrus, the absence of preference should be expected (Egid & Brown, 1989).
Female rodents are very sensitive to reproductive odor communication and there are several interactions that need to be considered. Vandenbergh effect chemo-signals from male mice accelerate the onset of puberty in females and influence the onset of ovulation (Vandenbergh 1973). The Lee-Boot effect if females are placed in a larger group without the presence of a male, the estrous cycle is lengthened to the point of complete suppression of estrus (Lee-Boot effect; van der Lee & Boot 1955 in Kelliher & Wersinger 2009; Stopka et al. 2007). Whitten effect—if a male is placed next to the females or they are exposed only to his smell, then they experience a shortening of the estrous cycle, induction and usually synchrony of estrus (Whitten 1958 in Bronson & Whitten 1968). Bruce effect if a female after mating is exposed to a male other than the one she mated with, or just his smell, pregnancy is interrupted and within a week she returns to the estrus phase (Parkes & Bruce 1961).
As mentioned above, females are able to remember the odor of males and respond accordingly (Kelliher & Wersinger 2009). It is important for our study that the females became familiar with the odor of two males during the test and the female was subsequently paired with one of them. Thanks to the smell test, the females received information that there are several males, a higher population density, and can afford male selectivity. Subsequently the females meet a non-preferred male and try to avoid mating or minimize investment in this litter.. Thus, in the case of a non-preferred male, mating likely took place differently than with a preferred male. When interacting with a non-preferred male, activation of the hypothalamic-pituitary-adrenal (HPA) axis and glucocorticoids, as well as the hypothalamic-pituitary (gonadal) axis (HPG) and sex steroids, especially testosterone could apply (Ryan et al. 2014). Specifically, it was found in the ground squirrel (Urocitellus richardsonii) that as the total level of cortisol increases, the number of young in the litter decreases, and similarly, as the level of testosterone increases, the size of the litter decreases. On the other hand, the proportion of males in the litter increases with the level of bound cortisol. However, it is also possible to intervene in the number of pups per litter artificially with exogenous gonadotropic hormones, as was found in the red vole (Oksanen et al. 2002).
The regulation of reproduction in voles is directly linked to the population dynamics. The number of offspring is influenced by the population density almost directly (neuro-hormonally) via food supply. The condition of the female and the perspective of the litter also part ofthis regulation. During artificial enlargement of the bank vole litter, the survival and fertility of the mothers decreased. Litter enlargement did not increase the number of pups weaned per mother and significantly reduced the size of pups weaned (Koivula et al 2003). A negative phenotypic (and genotypic) correlation between the number and size of offspring at birth was also found (Mappes & Koskela 2004). In the bank vole there is higher investment in daughters compared to sons, as having a greater number of daughters appears to positively impact female reproductive success (Koskela et al 2009). This shifted ratio was observed in litters obtained from both females who mated with both preferred and non-preferred males.
4.4 Localities, genetic differences and similarities
To assess the influence of genetic differences on odor preference and reproductive success in the common vole, the tested individuals were captured in two locations, 30 km apart. It already follows from earlier findings that a 20 km distance in the Central European landscape generates a different frequency of neutral microsatellite alleles (genetic difference by distance, in a specific case along the highway) (Rico et al. 2009). Despite the lack of genetic differentiation between the populations B and V in MHC (Fst (-0.0038) or Pxy (-0.109)), there were still 13 alleles unique to V and 7 unique to B population. For a behavioural test may be sufficient.
In the GLM along season and preference, the location (Budějovice and Veselí) did not have a significant effect. However, selection of only parental pairs where the male was not preferred, in pairs assembled from different locations had a lower number of young (F(1, 16 ) = 3.8, p = 0.07)., This is likely to be evidence for an effect, albeit it rather weak evidence. Řičánková et al. (2007) showed that female common voles clearly prefer certain males, specifically known ones over unknown ones. In addition, they showed that females can be clearly agonistic against unknown males. This could very well correspond to the fact that non-preferred males from a location 30 km away represent very different individuals for females and mating with them is riskier.
The samples taken for MHC analysis yielded rather surprising results. It was quite clearly shown that preferred males had significantly higher allele composition similarity with females than non-preferred males. However, the studies published so far in this area show a prevalent disassortative pairing, i. e. a preference for a different MHC allelic composition (Penn et al. 2002, Radwan et al 2008). There is also a considerable number of studies that do not show straightforward maintenance of higher MHC allele variability, but a response to local pathogen load (Meléndez-Rosa et al. 2018) or a significant influence of genetic background, sexual differences, or early life experience (Jordan & Bruford 1998). Higher allele similarity, preferred by female voles, corresponds with behavioral personality similarity and correlated positively with offspring number (Urbánková et al 2023). So, in the common vole, odor preference corresponds with behavioral preference, however, allele similarity was not related to offspring number. This is understandable because these genes are mainly involved in pathogen defense and not directly in reproduction. But the question remains whether adequate parameters of allelic similarity were chosen. The indices according to Sørensen-Dice and Jaccard, although originally derived for the assessment of biological/ecological communities, are also used in genetic analyzes (Levandowsky & Winter 1971, Ondov et al. 2016). The procedure chosen by us does not evaluate molecular similarity of individual alleles, but considers them as an indicator of complex odour similarity.
In conclusion, odor preference is driven by MHC similarity and subsequently litter size is influenced by preference. The relationship between the success of reproduction and alleles is not clear-cut, this may be influenced by the measure of similarity we used, or by something that we cannot detect.
Funding
Partial financial support was received from the Ministry of Education, Youth and Sport of the Czech Republic (Grant 2370/2011/A)
Conflicts of interest/Competing interests
The authors have no relevant financial or non-financial interests to disclose.
Ethics approval
The voles were bred and tested in accordance with the principles of animal welfare and guidelines of the Departmental Commission for Animal Protection of the Ministry of Education, Youth and Sports, permit number 7945/2010-30. After the experiments, the voles stayed in the laboratory and were used for further breeding and behavioural testing.
Consent to participate
All authors agreed to participate in the study on the influence of behavioural traits on reproduction.
Consent for publication
All authors agreed with the content and gave explicit consent to submit this paper
Availability of data and material
The datasets generated during and/or analysed during the current study are available from the corresponding author on request.
Code availability
Not applicable
Authors' contributions
Pavlína Bílková: Conceptualization, Methodology, Investigation, Writing – Original draft preparation.
Jakub Vlček: Methodology, Genetic analysis, Writing – parts of methods
Tijana Cvetković - Genetic analysis, Writing – parts of methods
Jan Štefka: Evaluation of genetic analysis, Writing – parts methods, parts of discussion
František Sedláček: Supervising, Formal analysis, Validation, Writing – Review & Editing.
Acknowledgements
Our work was partly supported by the Ministry of Education Youth and Sport of the Czech Republic (Grant 2370/2011/A). We also thank R. Peskova for animal husbandry as well as our English language editor (XY).
- Boehm T, Zufall F (2006) MHC peptides and the sensory evaluation of genotype. Trends in neurosciences 29:100-107. https://doi:10.1016/j.tins.2005.11.006
- Bronson FH, Whitten WK (1968) Oestrus-accelerating pheromone of mice: assai, androgen-depending and presence in bladder urine. J. Reprod Fert 15:131–134. https://doi.org/10.1530/jrf.0.0150131
- Cecchetto C, Lancini E, Bueti D, Rumiati RI, Parma V (2019) Body odors (even when masked) make you more emotional: behavioral and neural insights. Scientific reports 9:5489. https://doi: 10.1038/s41598-019-41937-0
- Charlesworth D, Willis, J (2009) The genetics of inbreeding depression. Nat Rev Genet 10:783–796. https://doi.org/10.1038/nrg2664
- Clulow FV, Mallory FF (1970) Oestrus and induced ovulation in the Meadow vole, Microtus pennsylvanicus. Reproduction 23:341–343. https://doi.org/10.1530/jrf.0.0230341
- Cora MC, Kooistra L, Travlos G (2015) Vaginal cytology of the Laboratory Rat and Mouse: Review and criteria for the staging of the estrous cycle using stained vaginal smears. Toxicologic Pathology 43:776–93. https://doi.org/10.1177/0192623315570339
- Drickamer LC, Gowaty PA, Holmes CH (2000) Free female mate choice in house mice affects reproductive success and offspring viability and performance. Animal Behaviour 59:371-378. https://doi.org/10.1006/anbe.1999.1316
- Eccard JA, Herde A (2013) Seasonal variation in the behaviour of a short-lived rodent. BMC Ecology 13:43. https://doi.org/10.1186/1472-6785-13-43
- Egid K, Brown JL (1989) The major histocompatibility complex and female mating preferences in mice. Animal Behaviour 38:548-550.
- Excoffier,L, Lischer HEL (2010) Arlequin suite ver 3.5: A new series of programs to perform population genetics analyses under Linux and Windows. Molecular Ecology Resources 10:564-567. https://doi.org/10.1111/j.1755-0998.2010.02847.x
- Gleason ED, Holschbach MA, Marler CA (2012) Compatibility drives female preference and reproductive success in the monogamous California mouse (Peromyscus californicus) more strongly than male testosterone measures. Hormones and Behavior 61:100-107. https://doi.org/10.1016/j.yhbeh.2011.10.009
- Gracceva G, Herde A, Groothuis TGG, Koolhaas JM, Palme R, Eccard JA (2014) Turning shy on a winter’s day: effects of season on the personality and stress response in Microtus arvalis. Ethology 120:753–767. https://doi.org/10.1111/eth.12246
- Heath WR, Carbone FR (2001) Cross-presentation, dendrttic cells, tolerance and immunity. Annual Review of Immunology 19:47-64. https://doi:10.1146/annurev.immunol.19.1.47
- Herde A, Eccard, J (2013). Consistency in boldness, activity and exploration at different stages of life. BMC Ecology 13:49. https://doi.org/10.1186/1472-6785-13-49
- Heroldová M, Šipoš J, Suchomel J, Zejda J (2021) Interactions between common vole and winter rape. Pest Management Science 77:599-603. https://doi.org/10.1002/ps.6050
- Hurst JL (1990) Urine marking in populations of wild house mice Mus domesticus Rutty. III. Communication between the sexes (1990). Animal Behaviour 40:233-243. https://doi.org/10.1016/S0003-3472(05)80918-2
- Hedrick PW, Smith DW, Stahler DR (2016) Negative-assortative mating for color in wolves. Evolution 70:757-766. https://doi.org/10.1111/evo.12906
- Hedrick PW, Tuttle EM, Gonser RA (2018) Negative-Assortative Mating in the White-Throated Sparrow. Journal of Heredity 109:223-231. https://doi.org/10.1093/jhered/esx086
- Jacob J, Imholt C, Caminero‑Saldaña C. Couval G, Giraudoux P, Herrero‑Cófreces S, Horváth G, Luque‑Larena JJ, Tkadlec E, Wymenga E (2020) Europe‑wide outbreaks of common voles in 2019. Journal of Pest Science 93:703–709. https://doi.org/10.1007/s10340-020-01200-2
- Jacob J, Manson P, Barfknecht R, Fredricks T (2014) Common vole (Microtus arvalis) ecology and management: implications for risk assessment of plant protection products. Pest Management Science 70:869–878. https://doi.org/10.1002/ps.3695
- Jiang Y, Bolnick DI, Kirkpatrick M, (2013) Assortative Mating in Animals. The American Naturalist, pp E125-E138. https://doi.org/10.1086/670160
- Jordan W, Bruford M (1998) New perspectives on mate choice and the MHC. Heredity 81:239–245. https://doi.org/10.1038/sj.hdy.6884280
- Katandukila JV, Bennett NC (2016). Pattern of ovulation in the East African root rat (Tachyoryctes splendens) from Tanzania: induced or spontaneous ovulator? Canadian Journal of Zoology 94:345–351. https://doi.org/10.1139/cjz-2015-0217
- Kelliher KR, Wersinger SR (2009) Olfactory regulation of the sexual behavior and reproductive physiology of the laboratory mouse: effects and neural mechanisms. ILAR J 50:28-42. https://doi.org/10.1093/ilar.50.1.28
- Kirkpatrick M (1996) Good Genes and Direct Selection in the Evolution of Mating Preferences. Evolution 50:2125-2140. https://doi.org/10.2307/2410684
- Klein SL, Gamble HR, Nelson RJ (1999) Trichinella spiralis infection in voles alters female odor preference but not partner preference. Behavioral Ecology and Sociobiology 45:323-329. https://doi.org/10.1007/s002650050567
- Kloch A, Baran K, Buczek M, Konarzewski M, Radwan J (2012) MHC influences infection with parasites and winter survival in the root vole Microtus oeconomus. Evolutionary Ecology, 27:635–653. http://doi.org/10.1007/s10682-012-9611-1
- Koivula M, Koskela E, Mappes T, Oksanen TA (2003) Cost of reproduction in the wild: Manipulation of reproductive effort in the bank vole. Ecology 84:398-405. https://doi.org/10.1890/0012-9658(2003)084[0398:CORITW]2.0.CO;2
- Koskela E, Mappes T, Niskanen T, Rutkowska J (2009) Maternal investment in relation to sex ratio and offspring number in a small mammal – a case for Trivers and Willard theory? Journal of Animal Ecology 78:1007–1014. https://doi.org/10.1111/j.1365-2656.2009.01574.x
- Kumar V, Mishra I (2018) Circannual Rhythms. In: Skinner MK (ed) Encyclopedia of Reproduction, Academic Press: Elsevier, pp 442-450. http://dx.doi.org/10.1016/B978-0-12-801238-3.64613-5
- Lantová P, Šíchová K, Sedláček F, Lanta V (2011) Determining Behavioural Syndromes in Voles - The Effects of Social Environment. Ethology 117:124–132. https://doi.org/10.1111/j.1439-0310.2010.01860.x
- Leclaire S, Strandh M, Mardon J, Westerdahl H, Bonadonna F (2017) Odour-based discrimination of similarity at the major histocompatibility complex in birds. Proc R Soc B 284:20162466. https://doi.org/doi:10.1098/rspb.2016.2466
- Leigh JW, Bryant D (2015) PopART: Full-feature software for haplotype network construction. Methods Ecol Evol 6:1110–1116. https://doi.org/10.1111/2041-210X.12410
- Levandowsky M, Winter D (1971) Distance between sets. Nature 234:34–35. https://doi.org/doi:10.1038/234034a0
- Manzini I, Korsching S (2011) The peripheral olfactory system of vertebrates: molecular, structural and functional basics of the sense of smell. Neuroforum 2:68-77. https://doi.org/10.1007/s13295-011-0021-6
- Mappes T, Koskela E (2004). Genetic basis of the trade-off between offspring number and quality in the bank vole. Evolution 58:645-650. https://www.jstor.org/stable/3449256
- Martin, M (2011) Cutadapt removes adapter sequences from high-throughput sequencing reads. EMBnet.journal 17:10-12. https://doi.org/10.14806/ej.17.1.200
- Meléndez-Rosa J, Bi K, Lacey EA (2018) Genomic analysis of MHC-based mate choice in the monogamous California mouse. Behavioral Ecology 29:1167–1180. https://doi.org/10.1093/beheco/ary096
- Milligan SR (1974) Social environment and ovulation in the vole, Microtus agrestis. J Reprod Fert 41:35-47. https://doi.org/10.1530/jrf.0.0410035
- Niethammer J, Krapp F (eds) (1982) Handbuch der Säugetiere Europas. Band 2/I. Rodentia II (Cricetidae, Arvicolidae, Zapodidae, Spalacidae, Hystricidae, Capromyidae). Akademische Verlagsgesellschaft, Wiesbaden, 649 pp. ISBN 10: 3400004596
- Nubbemeyer R (1999). Progesterone and testosterone concentrations during oestrous cycle and pregnancy in the common vole (Microtus arvalis Pallas). Comparative Biochemistry and Physiology Part A 122:437–444.
- Oksanen T.A., Koskela E., Mappes T. (2002). Hormonal manipulation of offspring number: Maternal effort and reproductive costs. Evolution 56: 1530–1537. https://doi.org/10.1111/j.0014-3820.2002.tb01463.x
- Ondov BD, Treangen TJ, Melsted P, Mallonee AB, Bergman NH, Koren S, Phillippy AM (2016) Mash: fast genome and metagenome distance estimation using MinHash. Genome Biol 17:132. https://doi.org/10.1186/s13059-016-0997-x
- Parkes AS, Bruce HM (1961) Olfactory stimuli in mammalian reproduction. Science 134:1049-1054. DOI: 10.1126/science.134.3485.1049
- Penn DJ, Potts WK (1999) The evolution of mating preferences and major histocompatibility complex genes. The American Naturalist 153:145–164. doi: 10.1086/303166
- Penn D, Damjanovich K, Potts W (2002) MHC heterozygosity confers a selective advantage against multiple-strain infections. Proc Natl Acad Sci USA 99:11260-11264. https://doi.org/10.1073/pnas.162006499
- Penn DJ, Oberzaucher E, Grammar K, Fischer G, Soini HA, Wiesler D, Novotny MV, Dixon SJ, Xu Y, Brereton RG (2007) Individual and gender fingerprints in human body odour. J R Soc Interface 4:331-340. https://doi.org/10.1098/rsif.2006.0182
- Radwan J, Tkacz A, Kloch A (2008) MHC and Preferences for Male Odour in the Bank Vole. Ethology 114:827-833. https://doi.org/10.1111/j.1439-0310.2008.01528.x
- R Core Team (2020) R: A language and environment for statistical computing. R Foundation for Statistical Computing, Vienna, Austria. https://www.R-project.org/.
- Rico A, Kindlmann P, Sedláček F (2009) Can the barrier effect of highways cause genetic subdivision in small mammals? Acta Theriologica 54:297-310. https://doi.org/10.4098/j.at.0001-7051.068.2008
- Řičánková V, Šumbera R, Sedláček F (2007) Familiarity and partner preferences in female common voles, Microtus arvalis. J Ethology 25: 95-98. DOI: 10.1007/s10164-006-0211-9
- Rangassamy M, Dalmas M, Féron C, Gouat P, Rödel HG (2015) Similarity of personalities speeds up reproduction in pairs of a monogamous rodent. Animal Behaviour 103:7-15. https://doi.org/10.1016/j.anbehav.2015.02.007
- Rozas J, Ferrer-Mata A, Sánchez-DelBarrio JC, Guirao-Rico S, Librado P, Ramos-Onsins SE, Sánchez-Gracia A (2017) DnaSP 6: DNA Sequence Polymorphism Analysis of Large Datasets. Mol Biol Evol 34:3299-3302. https://doi.org/10.1093/molbev/msx248
- Ryan CP, Anderson WG, Berkvens CN, Hare JF (2014). Maternal Gestational Cortisol and Testosterone Are Associated with Trade-Offs in Offspring Sex and Number in a Free-Living Rodent (Urocitellus richardsonii). PLoS ONE 9:e111052. https://doi.org/10.1371/journal.pone.0111052
- Santos PSC, Michler F-U, Sommer S (2017) Can MHC-assortative partner choice promote offspring diversity? A new combination of MHC-dependent behaviours among sexes in a highly successful invasive mammal. Molecular Ecology 26:2392-2404. https://doi.org/10.1111/mec.14035
- Stopka P, Janotov K, Heyrovsky D (2007) The advertisement role of major urinary proteins in mice. Phys Behav 91:667–670. DOI: 10.1016/j.physbeh.2007.03.030 terBraak CJF, Šmilauer P (2012) Canoco Reference Manual and User's Guide: Software for ordination, version 5.0., Ithaca, USA: Microcomputer Power, 496 pp.
- Thiessen D, Young RK, Delgado M (1997) Social pressures for assortative mating. Personality and Individual Differences 22:157-164. https://doi.org/10.1016/S0191-8869(96)00181-X
- TIBCO Software Inc. (2017) Statistica (data analysis software system), version 13. http://statistica.io
- Tkadlec E, Zejda J (1998) Small rodent population fluctuations: the effects of age structure and seasonality. Evolutionary ecology 12:191-210. https://doi.org/10.1023/A:1006583713042
- Urbánková G, Riegert J, Mladěnková N, Dikošová T, Janochová L, Sedláček . (2023) Similarity of locomotor personality trait within parents improves their reproduction in the common vole (Microtus arvalis) under laboratory conditions. Mammal Research 68:27–36. https://doi.org/10.1007/s13364-022-00649-z
- Urbánková G, Šíchová K, Riegert J, Horsley R, Mladěnková N, Starck-Lantová P, Sedláček F (2020) Lifetime low behavioural plasticity of personality traits in the common vole (Microtus arvalis) under laboratory conditions. Ethology 126:812-823. https://doi.org/10.1111/eth.13039
- Vandenbergh JG (1973) Acceleration and inhibition of puberty in female mice by pheromones. J Reprod Fertil Suppl 19:411-419. PMID: 4522389
- van der Lee S, Boot LM (1955) Spontaneous pseudopregnancy in mice. Acta Physiol Pharmacol Neerl 4:442-444. PMID: 13301816
- Whitten WK (1958) Modification of the oestrus cycle of the mouse by external stimuli
associated with the male. Changes in the oestrus cycle determined by vaginal smears.
J Endocr 17:307-313. https://doi.org/10.1677/joe.0.0170307 - Yamazaki K, Beauchamp GK, Singer A, Bard J, Boyse EA (1999) Odortypes: their origin and composition. Proc Natl Acad Sci USA 96:1522–1525. https://doi.org/10.1073/pnas.96.4.1522
- Zhang J, Kobert K, Flouri T, Stamatakis A. (2014) PEAR: a fast and accurate Illumina Paired-End reAd mergeR. Bioinformatics 30:614-20. doi:10.1093/bioinformatics/btt593. https://doi.org/10.1093/bioinformatics/btt593
- Zufall F, Ukhanov K, Lucas P, Leinders–Zufall T (2005) Neurobiology of TRPC2: from gene to behavior. Pflügers Archiv – European Journal of Physiology 451:61-71. https://doi.org/10.1007/s00424-005-1432-4