Decreased Intranuclear Cardiac Troponin I Impairs Cardiac Autophagy through FOS/ATG5 in Ageing Hearts

doi:10.21203/rs.3.rs-3603901/v1

Download PDF

Research Article

Decreased Intranuclear Cardiac Troponin I Impairs Cardiac Autophagy through FOS/ATG5 in Ageing Hearts

https://doi.org/10.21203/rs.3.rs-3603901/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 29 Apr, 2024

Read the published version in Journal of Cellular and Molecular Medicine →

Version 1

posted

You are reading this latest preprint version

Objective

In our previous study, intranuclear cardiac troponin I (cTnI) was demonstrated may function as a co-factor of YY1. Here, we aimed to explore the role of intranuclear cTnI in ageing hearts.

Methods and Results

Nuclear translocation of cTnI was demonstrated by using Wester-blot and Immunofluorencence. The potential nucleolar localization sequences (NLSs) of cTnI were predicted by a web server, and then verified in 293t cells by putative NLS-eGFP-GST and NLS-mutant transfection. Ratio of Nuclear cTnI/ Total cTnI (Nu/T) decreased significantly in ageing hearts, accompanied with ATG5-decline related impaired cardiac autophagy. RNA sequencing was performed in cTnI knockout hearts. The differential expressed genes (DEGs) were analyzed by overlapping with YY1 ChIP sequencing data. Those filtered DEGs’ expression level were determined by cTnI gain and loss experiments in vitro. A strong correlation was found between expression patterns cTnI and FOS. By using ChIP-q-PCR we demonstrated specific binding DNA sequences of cTnI were enriched in FOS promoter − 299~-157 region. It was further verified that pcDNA3.1 (-)-cTnI could increase the promoter activity of FOS by using luciferase report assay. At last, we found that FOS can regulate ATG5 (autophagy related gene 5) gene by using luciferase report assay.

Conclusion

Taken together, our results indicate that decrease of intranuclear cTnI in ageing hearts may cause impaired cardiac autophagy through FOS/ATG5 pathway.

intranuclear cTnI

FOS

Ageing

Autophagy

Ageing of population has already been becoming the global problem and leads to a remarkable increase in the prevalence of age-associated diseases, especially cardiovascular diseases (CVDs)¹. To understand the mechanisms of cardiac ageing will be helpful for reducing the incidence of CVD and providing potential interventions and treatments for cardiac ageing. Accumulating data suggests that multiple complex pathways involve in cardiac ageing, such as oxidative stress, autophagy, mTOR signaling, etc.² Autophagy, a highly conserved evolutionarily process, is essential for the maintenance of cellular homeostasis through the degradation of long-lived proteins and functionally redundant or damaged intracellular organelles in lysosomes^3,4. Cardiac autophagy is decreased with age, and dysfunctional mitochondria and misfolded proteins are accumulated in the ageing heart⁵. Therefore, autophagy represents a promising intervention target for ageing induced cardiac dysfunction. For example, autophagy related gene, ATG5 cardiac-specific deletion in the mouse induces age-related cardiac dysfunction⁶. In contrast, overexpression of ATG5 in mice activates autophagy and extends lifespan⁴.

The Fos gene family consists of 4 members: FOS, FOSB, FOSL1, and FOSL2. These genes encode leucine zipper proteins that can dimerize with proteins of the JUN family, thereby forming the transcription factor complex AP-1⁷. As such, the FOS proteins have been implicated as regulators of cell proliferation, differentiation, and transformation^7,8. In some cases, expression of the FOS gene has also been associated with apoptotic cell death and autophagy⁹.

In others and our previous studies, nuclear translocation of cTnI was found in mouse, human fetuses, and rat heart tissues^10–14. Moreover, intranuclear cTnI might regulate Apt2a2 transcription level through binding with a classic transcription factor YY1, and then affect cardiomyocytes contraction and relaxation¹⁴. However, the potential nucleolar localization sequences of cTnI, and more importantly, the role of intranuclear cTnI in cardiac pathological conditions remains unknown and worth substantial attention. We first found an interesting phenomenon that the proportion of intranuclear cTnI to total cTnI (Nu/T cTnI) in mouse ageing hearts decreased significantly compared with that in young adult mouse hearts. Moreover, cardiac autophagy levels in cTnI knock out heterogynous (cTnI-/+) mice were reduced significantly. Therefore, the objective of the present study was to determine the role of intranuclear cTnI in cardiac ageing. RNA sequencing was performed in cTnI knock out mice. As cTnI might function as a co-factor of YY1, we then analyzed DEGs by overlapping with YY1 ChIP sequencing data. Several ageing related genes, such as s100a8, FOS, FOSb, Erg1, were filtered by overlapping analysis. By cTnI gain and loss invitro experiments, a strong expression correlation was found between cTnI and FOS. By using ChIP-q-PCR and luciferase report assays, it was demonstrated that cTnI plasmid can enhance the promoter activity of FOS. At last, FOS was demonstrated could enhance transcriptional activity of ATG5 through dural luciferase report assay. Our data indicate that decrease of intranuclear cTnI may reduce cardiac autophagy level through regulating FOS/ATG5 expression.

Animals

4-week-old, 3-month-old and 24-month-old C57BL/6 male mice were purchased from the Experimental Animal Center of Chongqing Medical University (Chongqing, China). Heterozygous cTnI (+/–) mutant mice were described previously¹⁴^,¹⁵, and kindly provided by professor Huang (Florida Atlantic University) as a gift. All experimental procedures involving animals were approved by the Animal Care and Use Committee of Chongqing Medical University (2020-1102). Animal experiments were performed conform the NIH guidelines (Guide for the Care and Use of Laboratory Animals). All animals were euthanized by overdose administration of pentobarbiturate (100-120mg/kg).

Neonatal Mice Ventricular Myocytes (NMVMs) Isolation and Culture

As previously described¹⁴, NRVMs were isolated from day 1 mouse pups using enzymatic digestion. Briefly, the cells were digested by 0.05% collagenase II, centrifuged by density gradient and collected to seed at a density of 1×10^6 cells/well in a 6-well plate. The cells were grown in F12/DMEM (1:1) containing 10% FBS, penicillin and streptomycin (50 U/mL), 5-Fluorouracil(0.1g/L), at 37°C in humid air containing 5% CO2.After 48h of adhering，the culture medium was changing every day.

NLS prediction and Fusion Protein Construction

We employed a program, PSORTII (psort.nibb.ac.jp), designed to predict the protein sorting signals and the localization sites, to predict the potential NLSs of cTnI. In order to generate cTnI deletion mutants for expressing fusion protein, we inserted PCR generated cDNA fragments encoding cTnI amino acids 1–212, 1–170, 1-137,1-47,46-137,137-170 and 170-212 into the PCDNA3.1-GFP-GST expression plasmid. We generated WT cTnI by cloning the full-length cTnI (amino acids 1–212) into the pcDNA3.1 expression vector. The cTnI mutation at R21/R22 (lysine or arginine residue) in predicted NLS (amino acids 16-22) of the cTnI were created by using a Quik change site-directed mutagenesis kit (Stratagene), pcDNA3.1- cTnI was employed as templates. Plasmid PCDNA3.1 was kind gifts from Dr Xi Li (Biology Science Institutes, Chongqing Medical University, China).

RNA-sequencing and ChIP-sequencing Overlapping Data Analysis

RNA from the hearts of 20-day postnatal mice were prepared for gene expression profiling (3 biological replicates for each group). The KO and WT samples were sequenced on the cBot Cluster Generation System using TruSeq PE Cluster Kit v3-cBot-HS (Illumia). The sequencing data was filtered with SOAPnuke (v1.5.2) by removing reads containing sequencing adapter, reads whose low-quality base ratio (base quality less than or equal to 5) is more than 20%, and reads whose unknown base ('N' base) ratio is more than 5%. The resultant clean reads were obtained and stored in FASTQ format and mapped to the reference genome GRCm38.p6 using HISAT2 (v2.0.4). Bowtie2 (v2.2.5) was applied to align the clean reads to the reference coding gene set, and the expression level of genes was calculated with RSEM (v1.2.12). The differential expression analysis was performed using the DESeq2 (v1.4.5). GO enrichment analysis of differentially expressed genes was achieved by cluster Profiler (3.4.4) software, which corrected for gene length bias. GO terms with corrected P values of less than 0.05 were considered to be significantly enriched by differentially expressed genes. YY1 chromatin immunoprecipitation sequencing data were downloaded from Cistrome DB-57271. RNA-seq data and ChIP-seq data were overlapped analyzed.

Immunofluorescence

NMVMs cells were seeded in 12-well plates containing cover glasses (WHB scientific, #12-CS). Cells were fixed with 4% paraformaldehyde (15 mins at room temperature), and their membrane were permeabilized at room temperature with 0.5% Triton X-100 in phosphate buffered saline (PBS) buffer for 20 mins. After three washes with PBS, cells were blocked with 4% BSA (Solarbio, #SW3015) blocking solution at room temperature for 30 mins. Cells were incubated with the primary antibody (1:200) overnight at 4℃. And then, cells were incubated with the fluorescent secondary antibodies at room temperature for 1h after 3 times PBST washes. Next, cells were counterstained with DAPI (Beyotime, #C1006) for 5 mins to visualize nuclei. Immunofluorescence images were taken by using a confocal microscopy (Nikon C2 plus, Japan)

Total RNA Extraction and Quantitative RT-PCR

Total RNA of all samples was extracted with the Tissue RNA Extraction Kit (Bioflux, Beijing, China). cDNA was obtained by using the RevertAid First Strand cDNA Synthesis Kit (#No, RR047A, TaKaRa, Japan). The cDNA was amplified with SYBR® Green Master Mix kit (#204054, Qiagen, Germany). Analyses of relative mRNA expression were determined by using the 2-ΔΔCt method, normalized to the expression of housekeeping gene. Primers for the genes were synthesized by Life Technologies Corporation (Shanghai, China). Sequences of PCR primers used in this study are listed in Supplementary Table 1.

Western Blot Analyses

Western blot was carried as previously described¹⁴^,¹⁶. Briefly, protein lysate samples were prepared from heart tissues in RIPA buffer with proteinase inhibitors. Lysate samples (15–20 μg total protein for each) were separated by 10% or 12% SDS-PAGE, and electrophoretically transferred to PVDF membranes. cTnI protein was probed with mouse anti-cTnI antibodies (Santa, #sc-133117). HLC3B protein was probed with Rabbit anti-LC3B antibodies (CST, #12741), p62 protein was probed with Rabbit anti-p62 antibodies (CST, #23214), c-fos was probed with Rabbit anti-cfos antibodies (CST, 2250). GAPDH (Proteintech, #60004-1), β-actin (Proteintech, #81115-1) and Laminb1 (CST, #13435) antibodies served as loading controls for different protein analyses. The densitometric analysis was performed using ImageJ software.

RNA Interference (RNAi) Assays

Synthetic siRNA oligonucleotides specific for TNNI3 (5’-GAAGAUCUAUGACCUCCGUTT-3’) was synthesized by GenePharma (Shanghai, China). Stealth RNAi Negative Control Duplexes by GenePharma were used as negative controls. According to the manufacturer’s instructions, NMVMs were transiently transfected with TNNI3 siRNA or negative control (NC) siRNA using GP-transfection-Mate (GenePharma, Shanghai, China).

Over-expression of TNNI3

GV314Ad-TNNI3, and GV314AD-GFP adenoviral vectors were purchased from Gene-Chem Technology Co., Ltd. (Shanghai, China). NRVMs were plated onto slides in 6-well plates and allowed to reach 50–70% confluence at the time of transfection. The GV314Ad-GFP adenovirus was used as a control (negative control, NC). Adenoviral infection was performed according to the manufacturer’s instructions. NRVMs were incubated in growth medium with the adenoviruses at a multiplicity of infection of 40 for 12 h at 37 °C, and were then grown in new medium for another 60 h at 37 °C.

ChIP-qPCR

By following the previous steps, purified DNA was subjected to quantitative PCR by using primers specific to the FOS promoters. The primers (mouse) of involved DNA sequence were designed as below:

Site1: 5′- GGCGCTGTGTTGCTGTAAAC -3' (forward primer)

5′- CGGATGGATCTTTAGGGGCG -3' (reverse primer)

Site2: 5′- AGGGCAAGTAGGGGTGTGTT -3' (forward primer)

5′- GGGGACGGGAAGAAAGGTTC -3' (reverse primer)

Site3: 5′- AACATACGACCCCTTCAGGC -3' (forward primer)

5′- CACCTACTCCCCGACCCTTA -3' (reverse primer)

Site4: 5′- GGAACCGGGTCCACATTGA -3' (forward primer)

5′- AGGGATTGACGGGAACAGC -3' (reverse primer)

Site5: 5′- AATCCTACACGCGGAAGGTC -3' (forward primer)

5′- GTCTTGGCATACATCTTTCACCT -3' (reverse primer)

Site6: 5′- GCGTAGAGTTGACGACAGAG -3' (forward primer)

5′- ACTTCCTACGTCACTGGGC -3' (reverse primer)

Dural Luciferase Report Assay

-299~-157bp promoter regions of mouse FOS, which were detected by ChIP-Seq, were highly enriched with cTnI. In addition, these 2000bp bases were amplified via PCR from genomic DNA of C57BL/6 mouse and were cloned into PGL3-FOS-WT. 5’-CCAT-3’ were interchanged to 5’-AACC-3’ (-299 to -157bp), mutation vectors of pGL3- FOS-MUT were constructed. JASPAR website was used to predict the specific binding sequence of transcription factor FOS gene in the ATG5 promoter region. The fragments relative to the transcription start site of ATG5 genomic sequence (-2000bp to 0) were cloned into PGL3-ATG5-WT,The mutant plasmid was constructed by 5’-GCTC-3’ interchanged to 5’-AACA-3’. The TNNI3 and FOS expression vectors were prepared by cloning wild-type mouse TNNI3 cDNA (636bp) and FOS cDNA (1143bp) into a pcDNA3.1 (-) vector. 293T cells were plated in 24-well plate reached to 90-95% confluent. PGL3-FOS-WT/PGL3-FOS-MUT/PGL3-ATG5-WT/PGL3-ATG5-MUT promoter fused firefly luciferase (300ng/well), TK-renilla luciferase (2ng/well) and pcDNA3.1(-)-TNNI3 (300ng/well) or pcDNA3.1(-)-FOS were transfected by Lipofectamine 3000 (NO. L3000015, Invitrogen, USA). Luciferase activity was measured via a luciferase reporter assay (E1910, Promega, USA), with firefly luciferase activity normalized to renilla activity.

Statistics

Three biological replicates were used for mRNA-seq experiments. All other experiments have been repeated at least three times. Values are expressed as the mean ± SD. Student’s t-test was performed for paired analysis (two-tailed, adjusted for multiple comparisons).

3.1 Nuclear Localization of Cardiac Troponin I

To verify nuclear location of cTnI, we first detected cTnI protein expression in adult mice hearts. As illustrated in Figure 1A, a certain amount of TnI expressed in the nucleus in adult mice. By using confocal laser scanning microscope, three-dimensional reconstruction of neonatal mouse cardiomyocytes images showed that cTnI can be expressed in the nucleus (Figure 1B). As isoform switch of TnI, from ssTnI to cTnI during cardiomyocytes maturation after birth, cTnI is not the dominant isoform in neonatal cardiomyocytes¹⁶, it was over-expressed by using adenoviral plasmid. cTnI nuclear localization was also found in cTnI over-expressed cardiomyocytes (Figure 1C). These parts of results were consistent with our previous findings. We then asked if cTnI has nucleolar localization sequences (NLSs), 4 potential NLSs of cTnI were predicted by a web server (Figure 1D). PCR generated cDNA fragments encoding cTnI amino acids fragments, 1–212, 1–170, 1-137,1-47,46-137,137-170 and 170-212 were inserted into PCDNA3.1-GFP-GST expression plasmid, respectively (Figure 1E). As shown in Figure 1F, fusion protein that contain 16-22aa could be detected in the nuclear, and full length cTnI with mutant 21^st and 22^nd amino acids could not be detected in the nucleus (Figure 1F). Those data suggested that cTnI locates in the nuclei, and NLS of cTnI might locate on segment from 16-22 amino acids.

3.2 Intranuclear cTnI and Cardiac Autophagy Levels Decreased in Ageing Hearts

We then asked the role of intranuclear cTnI. Intranuclear cTnI levels were examined in ageing hearts. Interestingly, percentage of nuclear/total cTnI decreased significantly in ageing hearts (Figure 2A and 2B). Meanwhile, our data and other reports both indicated that cardiac autophagy levels reduced in ageing hearts, as autophagy markers LC3BII and ATG5 statistically declined in 24m mouse hearts (Figure 2C, 2D and 2H). Moreover, in cTnI knockout heterozygous (cTnI+/-) mouse hearts, cardiac autophagy was also impaired. It is found that levels of LC3BII and ATG5 decreased, p62 protein levels increased, as shown in Figure 2E, 2F, 2G and 2I. These data suggested that decreased nuclear/total cTnI might associated with impaired cardiac autophagy in ageing hearts.

3.3 Overlapping of RNA-sequencing and ChIP-sequencing Data, cTnI Gain and Loss invitro

Next, sequencing and bioinformatic analysis were used to explore the role of cTnI on cardiac autophagy. RNA-sequencing data in cTnI knock out homozygous mouse heart suggested 178 differential expressed genes, when log fold change was set up as 2. A total number of 152 genes were filtered by overlapping with YY1 ChIP-sequencing data. Volcano diagram indicated that genes such as Egr1, FOS, FOSb, etc were down-regulated, and Gstp2, Lrp8, Mmp9, etc were up-regulated (Figure 3A and 3B, Supplementary Table 2). Most of those genes’ expression pattern were verified by cTnI gain and loss invitro experiments, FOS was selected as candidate downstream gene of cTnI, as its expression patterns were consistent with data of cTnI gain and loss (Figure 3C and 3D).

3.4 FOS Expression in Ageing and cTnI+/- Hearts

Above mentioned data strongly suggested that FOS might mediate regulatory role cTnI on cardiac ageing. We then detected FOS expression levels in ageing and cTnI+/- hearts. FOS mRNA levels decreased significantly both in ageing and cTnI+/- hearts and (Figure 4A and 4B). c-fos, the protein encoded by FOS reduced in ageing cardiac tissues (Figure 4C and 4D).

3.5 cTnI Binding Affinity on FOS’s Promoter Reduced in Ageing Heart

cTnI could bind with “CCAT” motif as co-factor of YY1 has been proved in our previous study. Thus, binding levels of cTnI with FOS’s promoter region was detected by ChIP-q-PCR technology in the heart tissue. Specific binding DNA sequences of cTnI were enriched in FOS promoter -299~-157 region (Site 5, Figure 5A and 5B). cTnI binding levels with FOS promoter region declined significantly (Figure 5C). In 293T cells, pcDNA3.1 plasmid /TNNI3 over-expression plasmid and FOS promoter luciferase reporter gene plasmid were co-transfected. Compared with control group, the luciferase activities significantly increased in cells transfected with pcDNA3.1-TNNI3 plasmid (Figure 5D). This part of data indicates that cTnI could regulate FOS expression through binding with its promoter region.

3.6 FOS could Enhance Transcriptional Activity of ATG5

As a classic transcription factor, FOS has been reported as an important factor in multiple pathways. There are also studies found FOS could regulate autophagy in Parkinson disease by increasing Becn1expression. By using Jaspar website, “GTGAGCCA” was predicted as potential binding sequence of FOS on ATG5’s promoter. In 293T cells, pcDNA3.1 plasmid /FOS over-expression plasmid and ATG5 promoter luciferase reporter gene plasmid were co-transfected. Compared with control group, the luciferase activities significantly increased in cells transfected with pcDNA3.1-FOS plasmid (Figure 5E).

In the present study, we provide more evidence that cTnI could locate in the nucleus and NLS of cTnI might locate on segment of 16-22aa. Moreover, decreased cTnI might down-regulate FOS expression in ageing murine hearts, accompanied with declined ATG5. FOS was proved to be able to bind with ATG5 promoter, and was critical for ATG5 transcription decrease in ageing associated cardiac autophagy impairment.

Some studies have demonstrated that cTnI could be found in the nucleus^11,13,17, and our recently published paper¹⁴ showed that TnI is located in nuclear of fetal human hearts. We also found that levels of cTnI nucleoprotein in left ventricle are higher than that in right ventricle. Moreover, intranuclear cTnI proteins are declined in left ventricles of heart failure than that in controls¹⁴. Therefore, we speculate that contents of intranuclear of cTnI in cardiomyocytes may associate with heart functions. In this study, we focus on cardiac ageing, which is accompanied with impairment of autophagy. In ageing mouse cardiac tissue, intranuclear cTnI, ATG5 and cardiac autophagy levels were all decreased. Interestingly, cardiac autophagy levels declined in cTnI +/- mouse hearts, as autophagy markers LC3B II and ATG5 reduced, and P62 increased. There was no statistical difference of ATG7 expression level between young adult and ageing heart. ATG7-related reduced autophagy appears to have a negative effect on the vascular system¹⁸. Low levels of Atg7 have been reported in aged brain tissue¹⁹. Our data indicate that intranuclear cTnI decrease is associated with ATG5 related cardiac autophagy damage.

In our previous study¹⁴, genome wide sequence motifs targeted by cTnI in heart tissues by using ChIP-Seq analysis identified the sequence CCAT as cTnI’s binding motif, which is also required for YY1 binding to the promoter area of YY1 related genes^20,21. Moreover, binding abilities of cTnI and YY1 was confirmed. So, we believed that intranuclear cTnI play a regulatory role in cardiomyocytes as a co-factor of YY1. Thus, RNA-sequencing data of cTnI knockout heart tissues and YY1 ChIP-sequencing data were weighted analyzed. Overlapping data indicated some genes associated with cardiac ageing, such as s100a8^22,23, FOS^24,25, FOSb²⁶ etc. By cTnI gain and loss studies, FOS were filtered as a potential target of cTnI. FOS has been reported as an important factor in BECN1 induced autophagy in Parkinson Disease⁹. Meanwhile, several studies have demonstrated that YY1 could regulate FOS expression^27–29. By using Jaspar webserver, potential binding sites of FOS/AP1 were found in ATG5 promoter region. At last, Dural luciferase report assay results indicated FOS could regulate ATG5 transcriptional activity.

Taken together, our data demonstrated that decreased intranuclear cTnI might impair cardiac autophagy through down-regulating FOS/ATG5 pathway in ageing hearts. This reveals a novel understanding of intranuclear cTnI in regulation of cardiac ageing, and may also provide some clues for the interventions on autophagy dysregulation in ageing hearts.

Acknowledgements: The cTnI knockout mice used in the study are gift from Dr. Huang’s laboratory in Florida Atlantic University.

Availability of data and materials: All relevant data and materials are stored at Children’s Hospital of Chongqing Medical University and can be obtained from the first author and corresponding author.

Funding: This work was supported by Natural Science Foundation of China (Grant Number: 81700214 to BP, cstc2019jcyj-msxmX0866 to HCS, 81974030 to JT).

Conflict of Interest: none declared.

Author Contribution Statement：BP, RML and JT substantial contributions to the conception or design of the work; BP, SH, LJL and RML acquisition, analysis, or interpretation of data; BP drafting the work and revising it critically for important intellectual content. SH, RML, DHand LJL performed the experiments. All authors read and approved the final manuscript.

Ethical Approval

All experimental procedures involving animals were approved by the Animal Care and Use Committee of Chongqing Medical University (2020-1102). Animal experiments were performed conform the NIH guidelines (Guide for the Care and Use of Laboratory Animals).

Donato, A. J., Machin, D. R. & Lesniewski, L. A. Mechanisms of Dysfunction in the Ageing Vasculature and Role in Age-Related Disease. Circulation research 123, 825-848, doi:10.1161/CIRCRESAHA.118.312563 (2018).
Yan, M., Sun, S., Xu, K., Huang, X., Dou, L., Pang, J., Tang, W., Shen, T. & Li, J. Cardiac Ageing: From Basic Research to Therapeutics. Oxidative medicine and cellular longevity 2021, 9570325, doi:10.1155/2021/9570325 (2021).
Cuervo, A. M. Autophagy and ageing: keeping that old broom working. Trends in genetics : TIG 24, 604-612, doi:10.1016/j.tig.2008.10.002 (2008).
Pyo, J. O., Yoo, S. M., Ahn, H. H., Nah, J., Hong, S. H., Kam, T. I., Jung, S. & Jung, Y. K. Overexpression of Atg5 in mice activates autophagy and extends lifespan. Nature communications 4, 2300, doi:10.1038/ncomms3300 (2013).
Miyamoto, S. Autophagy and cardiac ageing. Cell death and differentiation 26, 653-664, doi:10.1038/s41418-019-0286-9 (2019).
Taneike, M., Yamaguchi, O., Nakai, A., Hikoso, S., Takeda, T., Mizote, I., Oka, T., Tamai, T., Oyabu, J., Murakawa, T., Nishida, K., Shimizu, T., Hori, M., Komuro, I., Takuji Shirasawa, T. S., Mizushima, N. & Otsu, K. Inhibition of autophagy in the heart induces age-related cardiomyopathy. Autophagy 6, 600-606, doi:10.4161/auto.6.5.11947 (2010).
Eferl, R. & Wagner, E. F. AP-1: a double-edged sword in tumorigenesis. Nature reviews. Cancer 3, 859-868, doi:10.1038/nrc1209 (2003).
Chinenov, Y. & Kerppola, T. K. Close encounters of many kinds: Fos-Jun interactions that mediate transcription regulatory specificity. Oncogene 20, 2438-2452, doi:10.1038/sj.onc.1204385 (2001).
Wang, J. D., Cao, Y. L., Li, Q., Yang, Y. P., Jin, M., Chen, D., Wang, F., Wang, G. H., Qin, Z. H., Hu, L. F. & Liu, C. F. A pivotal role of FOS-mediated BECN1/Beclin 1 upregulation in dopamine D2 and D3 receptor agonist-induced autophagy activation. Autophagy 11, 2057-2073, doi:10.1080/15548627.2015.1100930 (2015).
Bergmann, O., Bhardwaj, R. D., Bernard, S., Zdunek, S., Barnabe-Heider, F., Walsh, S., Zupicich, J., Alkass, K., Buchholz, B. A., Druid, H., Jovinge, S. & Frisen, J. Evidence for cardiomyocyte renewal in humans. Science 324, 98-102, doi:10.1126/science.1164680 (2009).
Sahota, V. K., Grau, B. F., Mansilla, A. & Ferrus, A. Troponin I and Tropomyosin regulate chromosomal stability and cell polarity. Journal of cell science 122, 2623-2631, doi:10.1242/jcs.050880 (2009).
Kehat, I., Kenyagin-Karsenti, D., Snir, M., Segev, H., Amit, M., Gepstein, A., Livne, E., Binah, O., Itskovitz-Eldor, J. & Gepstein, L. Human embryonic stem cells can differentiate into myocytes with structural and functional properties of cardiomyocytes. The Journal of clinical investigation 108, 407-414, doi:10.1172/JCI12131 (2001).
Asumda, F. Z. & Chase, P. B. Nuclear cardiac troponin and tropomyosin are expressed early in cardiac differentiation of rat mesenchymal stem cells. Differentiation; research in biological diversity 83, 106-115, doi:10.1016/j.diff.2011.10.002 (2012).
Lu, Q., Pan, B., Bai, H., Zhao, W., Liu, L., Li, G., Liu, R., Lv, T., Huang, X., Li, X. & Tian, J. Intranuclear cardiac troponin I plays a functional role in regulating Atp2a2 expression in cardiomyocytes. Genes & diseases 9, 1689-1700, doi:10.1016/j.gendis.2021.04.007 (2022).
Huang, X., Pi, Y., Lee, K. J., Henkel, A. S., Gregg, R. G., Powers, P. A. & Walker, J. W. Cardiac troponin I gene knockout: a mouse model of myocardial troponin I deficiency. Circulation research 84, 1-8 (1999).
Pan, B., Xu, Z. W., Xu, Y., Liu, L. J., Zhu, J., Wang, X., Nan, C., Zhang, Z., Shen, W., Huang, X. P. & Tian, J. Diastolic dysfunction and cardiac troponin I decrease in ageing hearts. Archives of biochemistry and biophysics 603, 20-28, doi:10.1016/j.abb.2016.05.008 (2016).
Kimura, A., Harada, H., Park, J. E., Nishi, H., Satoh, M., Takahashi, M., Hiroi, S., Sasaoka, T., Ohbuchi, N., Nakamura, T., Koyanagi, T., Hwang, T. H., Choo, J. A., Chung, K. S., Hasegawa, A., Nagai, R., Okazaki, O., Nakamura, H., Matsuzaki, M., Sakamoto, T., Toshima, H., Koga, Y., Imaizumi, T. & Sasazuki, T. Mutations in the cardiac troponin I gene associated with hypertrophic cardiomyopathy. Nat Genet 16, 379-382, doi:10.1038/ng0897-379 (1997).
Koutouroushis, C. & Sarkar, O. Role of Autophagy in Cardiovascular Disease and Ageing. Cureus 13, e20042, doi:10.7759/cureus.20042 (2021).
Lipinski, M. M., Zheng, B., Lu, T., Yan, Z., Py, B. F., Ng, A., Xavier, R. J., Li, C., Yankner, B. A., Scherzer, C. R. & Yuan, J. Genome-wide analysis reveals mechanisms modulating autophagy in normal brain ageing and in Alzheimer's disease. Proceedings of the National Academy of Sciences of the United States of America 107, 14164-14169, doi:10.1073/pnas.1009485107 (2010).
Nan, C. & Huang, X. Transcription factor Yin Yang 1 represses fetal troponin I gene expression in neonatal myocardial cells. Biochemical and biophysical research communications 378, 62-67, doi:10.1016/j.bbrc.2008.10.174 (2009).
Hyde-DeRuyscher, R. P., Jennings, E. & Shenk, T. DNA binding sites for the transcriptional activator/repressor YY1. Nucleic acids research 23, 4457-4465, doi:10.1093/nar/23.21.4457 (1995).
Sun, S. N., Ni, S. H., Li, Y., Liu, X., Deng, J. P., Chen, Z. X., Li, H., Feng, W. J., Huang, Y. S., Li, D. N., Xian, S. X., Yang, Z. Q., Wang, L. J. & Lu, L. G-MDSCs promote ageing-related cardiac fibrosis by activating myofibroblasts and preventing senescence. Cell death & disease 12, 594, doi:10.1038/s41419-021-03874-7 (2021).
Nakamura, Y., Iwata, H., Kuwayama, T. & Shirasuna, K. S100A8, which increases with age, induces cellular senescence-like changes in bovine oviduct epithelial cells. Am J Reprod Immunol 82, e13163, doi:10.1111/aji.13163 (2019).
Tong, L., Toliver-Kinsky, T., Edwards, M., Rassin, D. K., Werrbach-Perez, K. & Perez-Polo, J. R. Attenuated transcriptional responses to oxidative stress in the aged rat brain. Journal of neuroscience research 70, 318-326, doi:10.1002/jnr.10428 (2002).
Garau, C., Aparicio, S., Rial, R. V., Nicolau, M. C. & Esteban, S. Age related changes in the activity-rest circadian rhythms and c-fos expression of ring doves with ageing. Effects of tryptophan intake. Experimental gerontology 41, 430-438, doi:10.1016/j.exger.2006.02.003 (2006).
Kovacs, L. A., Furedi, N., Ujvari, B., Golgol, A. & Gaszner, B. Age-Dependent FOSB/DeltaFOSB Response to Acute and Chronic Stress in the Extended Amygdala, Hypothalamic Paraventricular, Habenular, Centrally-Projecting Edinger-Westphal, and Dorsal Raphe Nuclei in Male Rats. Frontiers in ageing neuroscience 14, 862098, doi:10.3389/fnagi.2022.862098 (2022).
Natesan, S. & Gilman, M. Z. DNA bending and orientation-dependent function of YY1 in the c-fos promoter. Genes & development 7, 2497-2509, doi:10.1101/gad.7.12b.2497 (1993).
Zhou, Q., Gedrich, R. W. & Engel, D. A. Transcriptional repression of the c-fos gene by YY1 is mediated by a direct interaction with ATF/CREB. Journal of virology 69, 4323-4330, doi:10.1128/JVI.69.7.4323-4330.1995 (1995).
Natesan, S. & Gilman, M. YY1 facilitates the association of serum response factor with the c-fos serum response element. Molecular and cellular biology 15, 5975-5982, doi:10.1128/MCB.15.11.5975 (1995).

No competing interests reported.

SupplementaryTable1.pdf
Supplementary Table 1 PCR primers used in this study. Please check in the supplementary files.
SupplementaryTable2.pdf
Supplementary Table 2 Gene’s list after overlapping analyze. Please check in the supplementary files.
originalblots.pdf

Download PDF

Journal Publication

published 29 Apr, 2024

Read the published version in Journal of Cellular and Molecular Medicine →

Version 1

posted

You are reading this latest preprint version

Decreased Intranuclear Cardiac Troponin I Impairs Cardiac Autophagy through FOS/ATG5 in Ageing Hearts

Status:

Journal Publication

Version 1

Abstract

Objective

Methods and Results

Conclusion

Figures

1. Introduction

2. Materials and Methods

3. Results

4. Discussion

Declarations

References

Additional Declarations

Supplementary Files

Status:

Journal Publication

Version 1