1. Samples
C57BL/6 mice and SD rats were purchased from Cyagen Biosciences (Suzhou, Jiangsu, China). All the animal experimental protocols were reviewed and approved by the ethics committee of Jingzhou Hospital Affiliated to Yangtze University (No. 202003-001, Jingzhou, Hubei). Human samples were from biological sample bank of Peking University Shenzhen Hospital. Testis tissue array was bought from Bioaitech. com (Xi’an, China). The wild-type postnatal testes aged 1–8 weeks were collected from at least three C57BL/6 mice. Other organs samples of adult mice used in the study were from 8–9 weeks old C57BL/6 mice (n = 6). The experimental mice and rats were kept at stable SPF condition for at least 5 days with water and chow ad libitum. Light/dark cycle was set at 16-h/8-h, and room temperature att 22°C–25°C and relative humidity at 50–60%. Euthanasia was performed by cervical dislocation after intraperitoneal injection of pentobarbital sodium.
2. Reverse transcription–quantitative polymerase chain reaction
TRIzol (Thermo Fisher Scientific, Inc.) were used to extract total RNA from mouse testes, and the PrimeScript RT Master Mix kit (Takara Bio, Inc.) was applied to perform cDNA synthesis following the manufacturer's protocol. The SYBR Premix EX TaqTMⅡ PCR kit (Takara Bio, Inc.) was used to perform reverse transcription–quantitative polymerase chain reaction (RT‑qPCR), with gene-specific primers. The detailed information for the primers is listed in Table 1. The annealing temperature was 60°C, with 40 cycles. The data were calculated using the 2−ΔΔCq method [6].
Table 1
Primers for genes used in the study.
| Gene | Primer (5’-3’) | Product Size |
| Mouse C7orf61 | F: TCCTCAGTACCCGCAAGTCC | 206 bp |
| R: CCTGGCTTGGCTAGGTGTTT |
| Mouse β-Actin | F: GCAGATGTGGATCAGCAAGC | 102 bp |
| R: AGGGTGTAAAACGCAGCTCAG |
| Human C7ORF61 | F: CCAACAGGGCCAATCCCTAC | 160 bp |
| R: CAAAGGTGACTGCGTCCTCA |
| Human β-ACTIN | F: CCTTGCACATGCCGGAG | 112 bp |
| R: GCACAGAGCCTCGCCTT |
3. In vitro fertilization
Following a previous study[7], the cauda epididymitis of wild type mice was removed, and sheared in PBS to release sperm. Mouse sperm were collected by centrifuging. The capacitation of sperm was induced in a 200-µL drop of human tubal fluid (HTF; Millipore) supplemented with 10% BSA, which was covered by mineral oil (Sigma). After incubation in vitro for 1.5 h, 20 µg/ml anti-C7ORF61 antibody was added in to the dorp and incubated at 37°C for 1 h in cell culture incubator. Normal rabbit IgG (sc-2027, Santa Cruz Biotechnology) at the same concentration were used as controls. Then, 8- to 9-week-old C57BL/6J female mice were subjected to superovulation, which was induced by administering intraperitoneal (i.p.) injections of 7.5 units of pregnant mare serum gonadotropin (PMSG; Sigma), 48 h later i.p. injection of 7.5 units of human chorionic gonadotropin (hCG; Sigma). 13 h later, the cumulus-intact eggs were collected from the swollen ampulla. The eggs were washed, and inseminated with 1 × 106 sperm/mL for 6 h at 37°C. The eggs were transfer to the M16 medium (Sigma) drops containing 10% BSA, and cultivated undisturbed for 1 day. Progression to the two-cell stage was defined as developing embryos .
4. Immunofluorescence
The protocol was followed a previous study with minor revision[8]. Mouse and rat testes were removed and wash with phosphate-buffered saline (PBS), fixed with 4% paraformaldehyde at 4°C for 24–48 h. Then the tissue was embedded in paraffin, and cut into 3‑µm sections. The slides were subjected to dewaxing and rehydrating. For antigen retrieval, the sections were immersed in 10 mM sodium citrate (pH 6.0) and microwaved for 30 min (high for 5 min, and low for 25 min). After cool down to room temperature, the slides were treated with 0.05% Triton X-100 for 15 min, and then blocked in 10% BSA for 30 min. An anti‑C7ORF61 antibody (1:200; cat. no. NBP1-56948; NOVUS) was added to the sections and maintained at 4°C. After three washes with PBS, the slides were incubated with an anti‑rabbit Alexa Fluor 488 antibody (1:2000; cat. no. A‑27034; Thermo Fisher Scientific, Inc.) at 37°C for 1h. Hoechst 33342 (1:2000; Invitrogen; Thermo Fisher Scientific, Inc.) were added to the slieds for counterstaining for 5 min. With two additional PBS washes, the slides were mounted in SlowFade (Invitrogen; Thermo Fisher Scientific, Inc.), covered with nail polish. Finally, the slieds were observed using a fluorescent microscope (magnification, 200×; Zeiss GmbH).
5. Immunuhistochemistry
Immunuhistochemistry was conducted following the instruction provide by the DAB kit (PV-6000-D, ZSGB-Bio, China). The tissue array was subjected to dewaxing and antigen retrieval as decribled previously. The slides was incubated with endogenous peroxidase blocking solution for 15 min at room temperature. After three washes with PBS, anti‑C7ORF61 antibody (1:200; cat. no. NBP1-56948; NOVUS) was added and maintained at 37 C for 1 h. Then the slides was incubated with horseradish linked goat anti-rabbit IgG for 15 min. DAB staining regeant was added to the slides and incubated for 5 min following repeated washes with PBS. The slides was counterstained with haematoxylin, and then dehydrated, transparent, and mounted by neutral balsam mounting medium.
6. Western blot
Protein samples of different tissues including heart, liver, spleen, lung, kidney, brain, stomach, pancreas, testis, and epididymis from mouse, were extracted using RIPA lysis buffer (Beyotime), then 20 µg protein samples were loaded and run on 4–20% SDS‑PAGE. After transferred onto a polyvinylidene fluoride (PVDF) membrane, we used 10% (w/v) non‑fat milk in TBS buffer with 0.05% Tween‑20 (Sigma‑Aldrich) to block the membranes for 1 h at room temperature. After two washed with TBS, the membranes were incubated with primary antibodies targeting C7ORF61(51 kDa, Novus; cat. no.NBP1-56948; 1:1,000 dilution), GAPDH (37 kDa, Cell Signaling Technology, Inc.; cat. no. 5174; 1:1,000 dilution) overnight at 4˚C. The following day, with another three washed with TBS, the membranes were incubated with horseradish peroxidase‑labeled secondary antibody (anti‑rabbit; 1:1000; cat nos. 7074, Cell Signaling Technology, Inc.) for 1 h at room temperature. An enhanced chemiluminescence kit (Thermo Fisher Scientific, Inc.) was applied to detect the positive bands.
7. Statistical analysis
All of the experiments were performed at least three times. The data were expressed as mean ± standard deviation (SD). SigmaPlot 16.0 (Systat Software, Inc.) was applied to conduct statistical analysis, and statistical significance was evaluated using one‑way analysis of variance followed by Fisher's protected least‑significant difference post hoc test, unless otherwise specified. A P value < 0.05 was set as a statistically significant difference.