Materials and Methods
Patients and Sampling
Forty patients presenting with acute (n=10), chronic lupoid (n=14), and chronic non-lupoid (n=16) forms of CL who attended the Dermatopathology Department of Afzalipour Hospital (2010-2013) were selected to participate in our study. It should be noted that the study design, consent form, and sampling procedure were approved by the Ethics Committee of Afzalipour Hospital and patient selection was performed after evaluation of inclusion/exclusion criteria. The patients were considered to be included in the study if they presented with parasitologically confirmed CL with long-term illness (≥3 years), had received at least 3 times glucantime treatment, and were able to give contact information for the follow-up. We excluded patients with other skin diseases or with small biopsy samples. Informed consent was obtained from all the participants prior to enrolment.
Histopathology:
After making diagnosis for three different clinical forms based on Azadeh classification (18):
I- Anergic macrophage reaction
II- Focalized histiocytic reaction
III- Diffuse necrotizing reaction
IV- Diffuse lympho-histiocytic reaction
V- Lupoid granulomatous reaction
We also did Ridley scoring for parasite loads as follows from 0 to +4: (19)
+1: one or more amastigotes
+2: 10 or more amastigotes
+3: 100 or more amastigotes
+4: 1000 or more amastigotes
DNA extraction
For DNA extraction, 5 μm sections from paraffin-embedded blocks were cut using disposable blades and deparaffinized by hot xylene and then, they were hydrated (descending grades of alcohol) and incubated in proteinase K (20 μg/μL, at 60ºC). After digestion completed (3 days), the DNA was isolated using a QIAamp® DNA Mini Kit (QIAGEN, 51304), according to the manufacturer′s protocol.
Real-time PCR assay
We applied a probe-based assay targeting rRNAITS region to detect and quantify parasites in the samples. PCR amplification reaction was fulfilled using ABI StepOne system (Applied Biosystems, USA) and in a 25 μL of reaction mixture, containing 12.5 μL of master mix, 2 μL of forward and reverse primers for beta-actin and rRNAITS regions, 1.5 μL probe, 2 μL of H2O, and 5 μL of extracted DNA. Thermal cycling conditions started at 95°C for 2 minutes followed by 95°C for 20 seconds (denaturation), and 60°C for 30 seconds (annealing and extension), which were programmed for 45 cycles. A cycle threshold (Ct) for each sample was determined based on the required cycles for the fluorescent signal to cross the background level.
Table 1: Primers used in our study
Primers
|
Sequences (5’-3’)
|
L.ITS.F
|
5’-CAAATACACGCATGCACTCTC-3’
|
L.ITS.R
|
5’-TTTAATAATCCTGGTCACAGCC-3’
|
L.ITS.P
|
FAM-5’AGCGTCGAAACTCCTCTCTGGTGC3’-TAMRA
|
Actin.F
|
5'-ACCACCTTCAACTCCATCATG-3'
|
Actin.R
|
5'-CTCCTTCTGCATCCTGTCG-3'
|
Actin.P
|
JOE-5' ACATCCGCAAAGACCTGTACGCC 3'-TAMRA
|
F=Forward, R=Reverse, P=Probe, L.ITS=Leishmania ITS (internal transcribed spacer) gene
Quantification of parasite DNA load
For absolute quantification, the standard strain (MHOM/Sudan/58/OD) of L. tropica was cultured in RPMI1640 medium and serial dilutions (10 to 107) were prepared. Subsequently, a standard curve was set by plotting the Ct values against each standard of known concentration of the parasite’s DNA.
Statistical analysis
The differences between experimental groups were analyzed using the ANOVA (Tukey test) and Spearman's rank correlation coefficient was used for evaluation of the relationship between real-time PCR and histopathological results. SPSS software (version 22) was used in this study.