Actinobacillus pleuropneumoniae infection activates IL-1β expression in porcine alveolar macrophage by promoting β-amyloid production

doi:10.21203/rs.3.rs-3634315/v1

Download PDF

Research Article

Actinobacillus pleuropneumoniae infection activates IL-1β expression in porcine alveolar macrophage by promoting β-amyloid production

https://doi.org/10.21203/rs.3.rs-3634315/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Actinobacillus pleuropneumoniae (A. pleuropneumoniae) is a porcine respiratory tract pathogen and causes porcine pleuropneumonia. Porcine alveolar macrophage plays an important role during A. pleuropneumoniae infection. Amyloid precursor protein (APP) can be cleaved by β- and γ-secretase to produce β-amyloid (Aβ). APP and Aβ are related with inflammatory response. They activate micriglia and astrocyte to secrete IL-1β, IL-6 and other cytokines. In present study, we find that during interaction of A. pleuropneumoniae and porcine alveolar macrophage, two component system CpxAR upregulates wecA expression to increase lipopolysaccharide production, lipopolysaccharide promotes amyloid precursor protein (APP) production and cleavage to generate Aβ; the Aβ activates NF-κB leading to increased IL-1β expression. We present a hypothesis about A. pleuropneumoniae infection porcine alveolar macrophage regulates APP production and cleavage to control the quantity of Aβ; different quantities of Aβ induce PAMs produce different quantities of cytokines and leading to different pathological process of porcine pleuropneumonia.

Actinobacillus pleuropneumoniae

CpxAR

lipopolysaccharide

Amyloid precursor protein

β-amyloid

IL-1β

porcine alveolar macrophage

Actinobacillus pleuropneumoniae (A. pleuropneumoniae) is Gram-negative bacterial pathogen that causes high economic losses globally. A. pleuropneumoniae infection mainly induces fibrino-haemorrhagic and necrotizing pleuropneumonia [1]. Increased interleukin (IL)-1β, IL-6, IL-8, IL-17, IL-21 and tumor necrosis factor-alpha (TNF-α) of A. pleuropneumoniae-infected pigs were observed [2–5]. Porcine alveolar macrophages (PAMs) play an important role in defense against A. pleuropneumoniae infection.

Amyloid precursor protein (APP) is a member of type I transmembrane protein. APP can be cleaved via amyloidogenic and non-amyloidogenic pathway [6]. In the non-amyloidogenic pathway APP is cleaved by α-secretase and produces soluble APP α (sAPPα) and a C-terminal fragment called CTF83 (83 amino acids in length). CTF83 is cleaved by γ-secretase and produces intracellular domain (AICD) and a small fragment called P3. In the amyloidogenic pathway APP is cleaved by β-secretase (BACE1) to release the large soluble ectodomain called sAPPβ and generate a membrane-tethered C-terminal fragment called CTF99 (99 amino acids in length). Finally the CTF99 is cleaved by γ-secretase to generate the APP intracellular domain (AICD) and the β-amyloid (Aβ). Subsequently, the Aβ is released into extracellular space. APP and Aβ are linked to inflammatory response in astrocyte and microglia leading to increase expression of IL-1β, TNF-α, IL-6, and IL-10[7–9]. Aβ can activate NF-κB pathway and increase inflammatory cytokines production [10–12]. Studies reported that Aβ increased resistance to bacteria and viruses [13].

IL-1β is a potent pro-inflammatory cytokine with multiple biological functions, playing an important role in inflammatory cascade. IL-1β can stimulate cells to produce IL-6, TNF-a and other inflammatory cytokines. IL-1β plays a critical role in the pathological process of porcine pleuropneumonia caused by A. pleuropneumoniae.

Bacteria sense and respond to extracellular stimuli by two-component systems (TCSs). TCS consists of sensor kinase and response regulator. The sensor kinase senses signals and autophosphorylates and then transfers phosphate group to response regulator. The response regulator regulates gene expression to adapt to various environments. Five TCSs were identified in the genome of A. pleuropneumoniae: ArcAB, QseBC, CpxAR, NarPQ and PhoBR. TCSs are critical for bacterial survival and are considered essential for bacterial infection [14, 15].

LPS increase APP expression in human mononuclear phagocytesa, glial and mouse model [16–19]. Previous studies showed that LPS promotes APP cleavage to generate Aβ via increase β- and γ-secretase activities [16, 20, 21].

In our previous study, we find that the APP level of immortalized porcine alveolar macrophage (iPAM) was different with that of A. pleuropneumoniae-infected iPAM. It is worthwhile to investigate whether and how APP participate the inflammation response in A. pleuropneumoniae-infected porcine alveolar macrophages.

Reagents

Dimethyl sulfoxide (DMSO, MP Biomedicals, USA); LY2811376 (MedChem Express, USA); Amyloid β Peptide (1–42) (Beyotime, China); Semagacestat (Beyotime, China); Pyrrolidinedithiocarbamate ammonium (APDC, MedChem Express, USA), Lipopolysaccharide (LPS, Beyotime, China).

Cell culture

Immortalized porcine alveolar macrophage (iPAM, 3D4/21), APP knock out iPAM and primary porcine alveolar macrophage (PAM) were store in liquid nitrogen. Cells were cultured in RPMI/1640 medium (Gibco, USA) containing 0.1mM non-essential amino acids (Gibco, USA), 1mM sodium pyruvate (Gibco, USA) and 10% fetal bovine serum (ExCell Bio, China) at 37°C in a humidified 5% CO2.

Bacterial Strains and Culture Conditions

A. pleuropneumoniae strains were preserved in our laboratory store at -80℃. A. pleuropneumoniae was cultured in tryptic soy broth (Difco Laboratories, United States) or tryptic soy agar (Difco Laboratories, United States) containing 10% (v/v) newborn bovine serum (AusGenex, Australia) and 10 µg mL^–1 nicotinamide adenine dinucleotide (BioFroxx, Germany) at 37°C.

Cells-bacteria interaction

Cells were seeded in 6-well plates. Bacteria were grown until OD₆₀₀ reached 0.6, harvested and washed 3 times in PBS, then added to cells. Bacteria and cells were collected at different time point (20 min, 1 h, 2 h, 3 h, 4 h, 5 h, 6 h).

Transfected

Vectors and siRNAs were transfected into cells using YosiTrans Y-40 Transfection Reagent (YOSHi, China) according to the manufacturer's specifications. Cells were cultured for 24 hours before using in experiments. The siRNA sequences were as followed: APP siRNA: 5′- GGAUGAUGAGGAUGGUGAU − 3′; Control siRNA: 5′- GGAUGAUGAGGAUGGUGAU − 3′.

Reverse Transcription Quantitative-PCR

Total RNA was extracted from porcine alveolar macrophages and A. pleuropneumoniae with the TRIzol reagent (Invitrogen, USA) and Bacteria Total RNA Isolation Kit (Sangon Biotech, China) respectively, then used for reverse transcription with the HiScript II Q RT SuperMix for qRT-PCR (+ gDNA wiper) (Vazyme, China). Quantitative real-time PCR was performed using SYBR Green Master Mix (Vazyme, China) in QuantStudio 6 Flex (ABI, USA). All operations complied with manufacturer's protocols. Primers for the quantitation RT-PCR are listed in Table 1.

Table 1

Primers used in this study
Primers		Source or reference
IL-1β-F/R	CCAACGTGCAGTCTATGGAG TGATCCCTAAGGTCACAGGT	This study
APP-F/R	CCAGGTTGCCATGTTCTGTG TGGATGGTCACTGGTTGGTT	This study
BACE1-F/R	CATCGCTACTACCAGAGGCA AGTGATGGCAGCAATGTTGG	This study
ADAM10-F/R	ACCAGCGTGCCAAAAGAG GTGTCCCTCTTCATTCGTAGG	This study
β-actin -F/R	TGGATGACGATATTGCTGCG AGGATGCCTCTCTTGCTCTG	This study
16SrRNA-F/R	CCATGCCGCGTGAATGA TTCCTCGCTACCGAAAGAACTT	[32]
WecA-F/R	ATACGCCGATGGTAGAGCA ATCGATATGGTGGCGGTCA	[24]

ELISA assay

Cells were plated in 6-well culture plates. The supernatant was collected and centrifuged at 10,000 g for 10 min at 4°C to remove insoluble materials after treatment. The concentrations of IL-1β in culture medium were measured by Mouse IL-1β ELISA Kits (4A BIOTECH, China) following the manufacturer's instructions. OD₄₅₀ was measured using Spark M10 plate reader (Tecan, Austria) after adding terminating solution.

Western blot

Cells and supernatants were collected after treatment. Cellular proteins were lysed in ice-cold RIPA buffer (Beyotime, China) with Phenylmethanesulfonyl fluoride (PMSF, Beyotime, China). Cells lysates were centrifuged at 10,000 g for 10 min at 4°C and the supernatant was collected. The proteins in the supernatants were extracted with trichloroacetic acid (TCA). The supernatants were added ice-cold TCA on ice to precipitate the proteins. After 30 min, the samples were centrifuged and the pellets were washed 5 times with ice-cold acetone. Allow the pellets to dry. Nuclear proteins were extracted by Nuclear Protein Extraction kit (Solarbio, China) following the manufacturer's instructions. After heating at 75°C for 10 min in loading buffer, equal amounts of protein samples were separated by 8–18% SDS-polyacrylamide gels and then transferred to polyvinylidene fluoride membranes(PVDF, Merck Millipore, Ireland). Nonspecific binding was blocked for 1 h with 10% bovine serum albumin (BSA, BioFroxx, Germany) in Tris-buffered saline including 0.1% (v/v) Tween 20 (BioFroxx, Germany) at room temperature. Then the membranes were probed overnight at 4°C with the following primary antibodies: amyloid precursor protein (1:2000, ABclonal, China), Aβ42 (1:1000, absin, China), Phospho-NF-κB p65 (1:1000, Cell Signaling Technology, USA), Histone H3 (1:1000, ABclonal, China), and β-actin (1:5000, ABclonal, China). The membranes were washed three times and incubated with HRP-conjugated secondary antibodies (1:5000, Cell Signaling Technology, USA) for 2 h at room temperature. The immunoblot signals were visualized by ECL kit (Abbkine, China).

Confocal immunofluorescence

Cells were treated with Aβ42 or DMSO for 24 h. After treatment, cells were fixed with 4% paraformaldehyde for 10 minutes, permeabilized with 0.5% Triton X-100 for 15 minutes, and blocked with 5% BSA for 1 hour. Phospho-NF-κB p65 antibody (1:200, Cell Signaling Technology, USA) was added for overnight incubation at 4°C. After three washes with PBS, cells were incubated with FITC Goat Anti-Rabbit IgG (H + L) secondary antibody (1:500, ABclonal, China) for 2 h at room temperature. Nuclei were stained with Propidium iodice (PI, BioFroxx, Germany). Fluorescence images were obtained with a LSM 880 confocal microscope (Carl Zeiss, Germany).

Statistical Analysis

The data are presented as the means ± SD of at least three independent experiments. Student’s t-test was used to compare differences between groups. ∗p < 0.05, ∗∗p < 0.01.

A. pleuropneumoniae infection interferes the levels of APP in iPAMs and PAMs

To examine the expression of APP during A. pleuropneumoniae infection, iPAMs and PAMs were cultured and infected with A. pleuropneumoniae at a multiplicity of infection (MOI) of 10, and cells were lysed in ice-cold RIPA buffer at different time points. APP levels first increased and then decreased (Fig. 1A, B).

Amyloid precursor protein upregulates IL-1β expression in A. pleuropneumoniae-infected porcine alveolar macrophages

Previous studies showed that APP upregulates IL-1β expression. To test whether APP is associated with IL-1β expression in iPAMs and PAMs, cells were transfected with plasmid pCAGGS-N-Flag encoding APP or siRNA against APP followed by infected with or without A. pleuropneumoniae. Cells and supernatants were collected at 3 h post infection. The expressions of IL-1β were determined by qRT-PCR.

The mRNA levels of IL-1β increased in APP overexpressing cells and A. pleuropneumoniae-infected APP overexpressing cells (Fig. 2A, B). The mRNA levels of IL-1β decreased in APP knockout iPAMs, APP knockdown PAMs and A. pleuropneumoniae-infected these cells (Fig. 2C, D).

Concentrations of IL-1β in the supernatants were determined by ELISA. Overexpressing APP promoted, but deleting or silencing APP inhibited, the secreation of IL-1β in cells infected with A. pleuropneumoniae (Fig. 2E-H). Overexpressing APP promoted the secreation of IL-1β in uninfected cells (Fig. 2E-F). No significant differences were observed between control cells and APP knockout or APP knockdown cells which uninfected with A. pleuropneumoniae (Fig. 2G-H).

A. pleuropneumoniae infection promotes APP cleavage in porcine alveolar macrophages

Previous studies showed that APP can be cleaved by different secretases to generate different fragments.

To investigate whether APP processing is altered during A. pleuropneumoniae infection, cells were transfected with APP-overexpression vector followed by infected with or without A. pleuropneumoniae. Results showed that the level of APP in infected cells was less than that of uninfected cells (Fig. 3A, B). The γ-secretase inhibitor (Semagacestat) was used to investigate whether the level of APP in infected cells decreased due to A. pleuropneumoniae infection promotes the cleavage of APP. Decreased APP levels in the infected cells was reversed in the presence of γ-secretase inhibitor (Fig. 3A, B).

A. pleuropneumoniae infection promotes APP cleavage and Aβ42 generation via increase β-secretase exprseeion in porcine alveolar macrophages

Before cleaved by γ-secretase, APP can be cleaved by α- or β-secretase. A disintegrin and metalloproteinase domain-containing protein 10 (ADAM10) is a key α-secretase. BACE1 is β-site APP cleaving enzyme (β-secretase). We measured ADAM10 and BACE1 mRNA levels in infected and uninfected cells. There was no significant difference in ADAM10 mRNA levels between infected and uninfected cells (Fig. 3C, E). The expression of BACE1 was increase in infected cells (Fig. 3D, F). LY2811376 is β-secretase inhibitor. The decreased APP levels of the infected cells were reversed in the presence of LY2811376 (Fig. 3G, H). These results indicate that A. pleuropneumoniae infection promotes APP cleavage by β-secretase.

Results showed that levels of Aβ42 increased in cell lysates and culture supernatants (Fig. 3I).

Aβ42 induce IL-1β expression in porcine alveolar macrophages through activation of NF-κB pathway

Aβ42 induce microglial activation and generation of IL-1β [22, 23].To investigate whether Aβ42 can induce IL-1β transcription and release in iPAMs and PAMs, cells were treated with Aβ42, the expression levels of IL-1β mRNA were measured by qRT-PCR and the concentrations of IL-1β in the supernatants were determined by ELISA. The expression and release of IL-1β were increased (Fig. 4A-D). Results indicated that Aβ42 induce IL-1β expression and release in iPAMs and PAMs.

Furthermore, the expression and release of IL-1β were reversed by β-secretase inhibitor and γ-secretase inhibitor in infected APP-overexpressing cells (Fig. 4E, F). These results indicated that APP is cleaved into Aβ42 via β-secretase and γ-secretase, and Aβ42 induce IL-1β production in A. pleuropneumoniae infected porcine alveolar macrophages.

Aβ can activate NF-κB pathway and increase inflammatory cytokines production.To investigate whether Aβ42 is able to activate NF-κB pathway in iPAMs and PAMs, cells were treated with Aβ42 for 24h. Results showed that P65 increased in nuclear (Fig. 5A, B, C). These results indicated that Aβ42 is able to activate NF-κB pathway in porcine alveolar macrophages. Furthermore, cells were pretreated with NF-κB inhibitor APDC, decreased the IL-1β production induced by Aβ42 (Fig. 5D, E).

CpxAR TCS and WecA contribute to A. pleuropneumoniae induce APP expression in porcine alveolar macrophages

TCSs play a crucial role in bacteria infection. To investigate whether TCSs of A. pleuropneumoniae influence the APP expression of iPAM during interaction of A. pleuropneumoniae and iPAM, iPAMs were treated with wild-type, ΔphoBR, ΔcpxAR,ΔnarPQ, ΔqseBC, and ΔarcA strains, the expression levels of APP were measured by western blot. The expression of APP in ΔcpxAR treated cells was less than that of other groups (Fig. 6A, B). A. pleuropneumoniae could increase β-secretase exprseeion to enhance APP cleavage. To exclude the influence of β-secretase, PAMs were pretreated with LY2811376 before incubate with strains. Similar results were obtained (Fig. 6C, D). These results indicated that CpxAR promotes APP expression during A. pleuropneumoniae interactive with iPAMs. Our previous studies showed that CpxAR could regulate the expression of wecA[24], pilM and apfA (unpublished).To investigate whether CpxAR promotes APP expression by regulates these genes expression, iPAMs were treated with wild type, ΔpilM, ΔwecA and ΔapfA strains. The expression of APP inΔwecA treated cells was less than that of other groups (Fig. 6E, F). Complementation strain CΔwecA treated iPAMs restored the expression level of APP (Fig. 6G, H). After interact with iPAM, the mRNA expression of wecA in A. pleuropneumoniae were increased (Figure S1). WecA is involved in lipopolysaccharide(LPS) O-antigen repeating unit biosynthesis[24]. These results indicated that CpxAR might be through increase LPS expression to induce APP expression during the interaction of A. pleuropneumoniae and iPAMs.

LPS modulates APP expression and metabolism

LPS caused an increase in APP level in iPAMs compared to control; when pretreated with LY2811376, the APP level in LPS treated iPAMs was higher than that of untreated with LY2811376 cells (Fig. 7A). Similar results were obtained in PAMs (Fig. 7B). Results of qRT-PCR showed that LPS enhanced BACE1 expression (Fig. 7D). The plasmid pCAGGS-N-Flag encoding APP was transfected into APP-KO iPAMs, 24 hours later, cells were treated with or without LPS. The APP level in LPS treated cells decreased compare to that of control and were reversed in the presence of LY2811376 (Fig. 7C). These results indicated that lipopolysaccharide can promote APP production and cleavage.

Macrophage is a vital player in the first line of defense against pathogens. Activated macrophages participate in the initiation and resolution of disease. Macrophage can regulate the inflammatory response via the secretion of interleukins, complements, growth factors, tumor necrosis factor, nitric oxide, etc. Exploring A. pleuropneumoniae and porcine alveolar macrophage interaction is necessary to understand the pathological process of porcine pleuropneumonia.

Previous studies have focused on APP and Aβ biological function in glial cell. Micriglia and astrocyte can be activated by Aβ or APP, subsequently product IL-1β, TNFα, IL-6 and other inflammatory cytokines. IL-1β, TNF-α, IFN-γ and other cytokines increase Aβ production by modulating APP expression or enzyme activity of β-secretase and γ-secretase [16, 25].

APP cleavage by β- and γ-secretase generates Aβ40 and Aβ42. Aβ40 is major Aβ species and Aβ42 is minor species [26]. Although the major isoform is Aβ40, Aβ42 exhibits stronger toxicity [27]. Previous studies showed that Aβ42 induces inflammatory cytokine generation [28, 29]. In the present study we focused on the production of Aβ42 in cells during A. pleuropneumoniae infection. A. pleuropneumoniae infection promotes APP cleavage and Aβ42 generation in porcine alveolar macrophages

Two-component systems play crucial role during host–pathogen interactions. Lipopolysaccharide is a main component of Gram-negative bacterial outer membrane and is a prominent virulence factor for Gram-negative bacteria. CpxAR involves LPS export in Escherichia coli [30]. Bengoechea et al. found that CpxAR was actived when overexpress the lipopolysaccharide O-antigen chain length regulator Wzz protein in Yersinia enterocolitica [31]. Our previous study revealed that CpxAR promotes O-antigen biosynthesis to contribute to A. pleuropneumoniae stress resistance, and virulence [24].

In present study, we found that A. pleuropneumoniae enable to through CpxAR and WecA unregulate LPS biosynthesis to induce APP expression, and that LPS promoted APP cleavage and Aβ42 generation via increase β-secretase exprseeion in porcine alveolar macrophages; Aβ42 activates NF-κB leading to increased IL-1β expression.

No significant difference was observed between APP overexpressing iPAMs and control in the BACE1 mRNA level (Figure S2). But the Aβ42 level slightly increased in APP overexpressing iPAMs (Figure S3). Maybe due to normal quantity of β-secretase can cleave more quantity of APP. Moreover, we find that the BACE1 mRNA increased later than the APP mRNA increased in infected iPAMs (Figure S2).

Here we present a hypothesis (Fig. 8). Post infected with A. pleuropneumoniae, PAMs upregulate APP expression, and then β-secretase cleaves APP to generate Aβ42; Aβ42 induce PAMs generate and release IL-1β; IL-1β stimulate PAMs to produce other inflammatory cytokines. PAMs maintains low level inflammatory response to clear A. pleuropneumoniae. If A. pleuropneumoniae was not cleared, and constantly stimulates PAMs; the β-secretase was upregulated and more Aβ42 was generated. The Aβ42 stimulates PAMs and triggers an exaggerated inflammatory response to produce amount of inflammatory cytokines. These cytokines form a positive feedback loop and worsen pathology of porcine pleuropneumonia.

In additional, we find that the mRNA level of γ-secretase showed irregular changes during A. pleuropneumoniae infection (data not show), but the Aβ42 generation was more than that of control until cell showed significant damage. It is possible that cell was attempt to regulate the production of Aβ at a range which is contribute to cell survival and avoid excessive Aβ to damage cell, but A. pleuropneumoniae and excessive cytokines continuous stimulation result in excessive Aβ generation in vitro. Furthermore, other forms of Aβ also possible increased, but we focused on Aβ42 in present study. Other forms of Aβ also have multiple functions. Therefore, it would be worthwhile to investigate the changes and functions in porcine alveolar macrophage during A. pleuropneumoniae infection. Our findings provide new insight into the pathology of porcine pleuropneumonia.

Funding

This work was supported by grants from the National Key Research and Development Program of China (2021YFD1800400), the National Key Research and Development Program of China (2022YFD1800905), the National Natural Science Foundation of China (32273039).

Sassu E.L., Bosse J.T., Tobias T.J., Gottschalk M., Langford P.R., Hennig-Pauka I., Update on Actinobacillus pleuropneumoniae-knowledge, gaps and challenges, Transbound Emerg Dis. (2018) 65 Suppl 1:72-90.
Gomez-Laguna J., Islas A., Munoz D., Ruiz A., Villamil A., Carrasco L., Quezada M., Infection dynamics and acute phase response of an Actinobacillus pleuropneumoniae field isolate of moderate virulence in pigs, Veterinary microbiology. (2014) 173:332-339.
Wyns H., Croubels S., Vandekerckhove M., Demeyere K., De Backer P., Goddeeris B.M., Meyer E., Multiplex analysis of pro-inflammatory cytokines in serum of Actinobacillus pleuropneumoniae-infected pigs, Res Vet Sci. (2015) 102:45-48.
Sassu E.L., Ladinig A., Talker S.C., Stadler M., Knecht C., Stein H., Frombling J., Richter B., Spergser J., Ehling-Schulz M., Graage R., Hennig-Pauka I., Gerner W., Frequency of Th17 cells correlates with the presence of lung lesions in pigs chronically infected with Actinobacillus pleuropneumoniae, Vet Res. (2017) 48:4.
Li N., Zhu J., Chen P., Bao C., Wang J., Abdelaal T., Chen D., Zhu S., Wang W., Mao J., Scicluna B.P., Koning F., Li F., Lei L., High-dimensional analysis reveals an immune atlas and novel neutrophil clusters in the lungs of model animals with Actinobacillus pleuropneumoniae-induced pneumonia, Vet Res. (2023) 54:76.
Wilkins H.M., Swerdlow R.H., Amyloid precursor protein processing and bioenergetics, Brain Res Bull. (2017) 133:71-79.
Eckfeld C., Schoeps B., Haussler D., Fradrich J., Bayerl F., Bottcher J.P., Knolle P., Heisz S., Prokopchuk O., Hauner H., Munkhbaatar E., Demir I.E., Hermann C.D., Kruger A., TIMP-1 is a novel ligand of Amyloid Precursor Protein and triggers a proinflammatory phenotype in human monocytes, J Cell Biol. (2023) 222.
Lau V., Ramer L., Tremblay M.E., An aging, pathology burden, and glial senescence build-up hypothesis for late onset Alzheimer's disease, Nat Commun. (2023) 14:1670.
Forloni G., Balducci C., Alzheimer's Disease, Oligomers, and Inflammation, J Alzheimers Dis. (2018) 62:1261-1276.
Fu Y., Jia J., Isoliquiritigenin Confers Neuroprotection and Alleviates Amyloid-beta42-Induced Neuroinflammation in Microglia by Regulating the Nrf2/NF-kappaB Signaling, Front Neurosci. (2021) 15:638772.
Jiao H., Jia J., Ginsenoside compound K acts via LRP1 to alleviate Amyloid beta42-induced neuroinflammation in microglia by suppressing NF-kappaB, Biochem Biophys Res Commun. (2022) 590:14-19.
Ikram M., Muhammad T., Rehman S.U., Khan A., Jo M.G., Ali T., Kim M.O., Hesperetin Confers Neuroprotection by Regulating Nrf2/TLR4/NF-kappaB Signaling in an Abeta Mouse Model, Mol Neurobiol. (2019) 56:6293-6309.
Gosztyla M.L., Brothers H.M., Robinson S.R., Alzheimer's Amyloid-beta is an Antimicrobial Peptide: A Review of the Evidence, J Alzheimers Dis. (2018) 62:1495-1506.
Brown A.N., Anderson M.T., Bachman M.A., Mobley H.L.T., The ArcAB Two-Component System: Function in Metabolism, Redox Control, and Infection, Microbiol Mol Biol Rev. (2022) 86:e0011021.
Mangalea M.R., Borlee B.R., The NarX-NarL two-component system regulates biofilm formation, natural product biosynthesis, and host-associated survival in Burkholderia pseudomallei, Scientific reports. (2022) 12:203.
Lee J.W., Lee Y.K., Yuk D.Y., Choi D.Y., Ban S.B., Oh K.W., Hong J.T., Neuro-inflammation induced by lipopolysaccharide causes cognitive impairment through enhancement of beta-amyloid generation, J Neuroinflammation. (2008) 5:37.
Sun J., Zhang S., Zhang X., Zhang X., Dong H., Qian Y., IL-17A is implicated in lipopolysaccharide-induced neuroinflammation and cognitive impairment in aged rats via microglial activation, J Neuroinflammation. (2015) 12:165.
Spitzer P., Herrmann M., Klafki H.W., Smirnov A., Lewczuk P., Kornhuber J., Wiltfang J., Maler J.M., Phagocytosis and LPS alter the maturation state of beta-amyloid precursor protein and induce different Abeta peptide release signatures in human mononuclear phagocytes, J Neuroinflammation. (2010) 7:59.
He P., Yan S., Zheng J., Gao Y., Zhang S., Liu Z., Liu X., Xiao C., Eriodictyol Attenuates LPS-Induced Neuroinflammation, Amyloidogenesis, and Cognitive Impairments via the Inhibition of NF-kappaB in Male C57BL/6J Mice and BV2 Microglial Cells, J Agric Food Chem. (2018) 66:10205-10214.
Ma L., Zhang H., Liu N., Wang P.Q., Guo W.Z., Fu Q., Jiao L.B., Ma Y.Q., Mi W.D., TSPO ligand PK11195 alleviates neuroinflammation and beta-amyloid generation induced by systemic LPS administration, Brain Res Bull. (2016) 121:192-200.
Farooq U., Sahibzada M.U.K., Khan T., Ullah R., Shahid M., Khusro A., Seidel V., Abdellattif M.H., Emran T.B., Folecitin Isolated from Hypericum oblongifolium Exerts Neuroprotection against Lipopolysaccharide-Induced Neuronal Synapse and Memory Dysfunction via p-AKT/Nrf-2/HO-1 Signalling Pathway, Evid Based Complement Alternat Med. (2022) 2022:9419918.
Wei L., Syed Mortadza S.A., Jiang L.H., Melastatin-related transient receptor potential 2 channel in Abeta42-induced neuroinflammation: implications to Alzheimer's disease mechanism and development of therapeutics, Neural Regen Res. (2018) 13:419-420.
Aminzadeh M., Roghani M., Sarfallah A., Riazi G.H., TRPM2 dependence of ROS-induced NLRP3 activation in Alzheimer's disease, Int Immunopharmacol. (2018) 54:78-85.
Yan K., Liu T., Duan B., Liu F., Cao M., Peng W., Dai Q., Chen H., Yuan F., Bei W., The CpxAR Two-Component System Contributes to Growth, Stress Resistance, and Virulence of Actinobacillus pleuropneumoniae by Upregulating wecA Transcription, Frontiers in microbiology. (2020) 11:1026.
Alasmari F., Alshammari M.A., Alasmari A.F., Alanazi W.A., Alhazzani K., Neuroinflammatory Cytokines Induce Amyloid Beta Neurotoxicity through Modulating Amyloid Precursor Protein Levels/Metabolism, Biomed Res Int. (2018) 2018:3087475.
Funamoto S., Tagami S., Okochi M., Morishima-Kawashima M., Successive cleavage of beta-amyloid precursor protein by gamma-secretase, Semin Cell Dev Biol. (2020) 105:64-74.
De Mena L., Smith M.A., Martin J., Dunton K.L., Ceballos-Diaz C., Jansen-West K.R., Cruz P.E., Dillon K.D., Rincon-Limas D.E., Golde T.E., Moore B.D., Levites Y., Ass40 displays amyloidogenic properties in the non-transgenic mouse brain but does not exacerbate Ass42 toxicity in Drosophila, Alzheimers Res Ther. (2020) 12:132.
Akhter R., Shao Y., Formica S., Khrestian M., Bekris L.M., TREM2 alters the phagocytic, apoptotic and inflammatory response to Abeta42 in HMC3 cells, Mol Immunol. (2021) 131:171-179.
Liu Y., Zhang H., Peng A., Cai X., Wang Y., Tang K., Wu X., Liang Y., Wang L., Li Z., PEG-PEI/siROCK2 inhibits Abeta42-induced microglial inflammation via NLRP3/caspase 1 pathway, Neuroreport. (2022) 33:26-32.
Klein G., Lindner B., Brabetz W., Brade H., Raina S., Escherichia coli K-12 Suppressor-free Mutants Lacking Early Glycosyltransferases and Late Acyltransferases: minimal lipopolysaccharide structure and induction of envelope stress response, The Journal of biological chemistry. (2009) 284:15369-15389.
Bengoechea J.A., Zhang L., Toivanen P., Skurnik M., Regulatory network of lipopolysaccharide O-antigen biosynthesis in Yersinia enterocolitica includes cell envelope-dependent signals, Molecular microbiology. (2002) 44:1045-1062.
Subashchandrabose S., Leveque R.M., Kirkwood R.N., Kiupel M., Mulks M.H., The RNA chaperone Hfq promotes fitness of Actinobacillus pleuropneumoniae during porcine pleuropneumonia, Infection and immunity. (2013) 81:2952-2961.

FigS1.png
Figure S1 The wecA levels were determined by qRT-PCR. A. pleuropneumoniae was cocultured with iPAMs and then wecA levels were determined by qRT-PCR.
FigS2.png
Figure S2 The BACE1 levels were determined by qRT-PCR. The iPAMs were transfected with empty vector or APP-overexpression vector for 24 h and then BACE1 levels were determined by qRT-PCR.
FigS3.png
Figure S3 The Aβ42 levels were detected by western blot. The iPAMs were transfected with empty vector or APP-overexpression vector for 24 h and then Aβ42 levels were detected by western blot.
FigS4.png
Figure S4 qRT-PCR analysis of APP and BACE1 expression in iPAMs infected with A. pleuropneumoniae. The iPAMs were infected with A. pleuropneumoniae and harvested at different times post infection. APP levels in iPAMs at different times post infection (A). BACE1 levels in iPAMs at different times post infection (B).

Download PDF

Version 1

posted

You are reading this latest preprint version

Actinobacillus pleuropneumoniae infection activates IL-1β expression in porcine alveolar macrophage by promoting β-amyloid production

Status:

Version 1

Abstract

Figures

Introduction

Materials and methods

Reagents

Cell culture

Cells-bacteria interaction

Transfected

Reverse Transcription Quantitative-PCR

ELISA assay

Western blot

Confocal immunofluorescence

Statistical Analysis

Results

Aβ42 induce IL-1β expression in porcine alveolar macrophages through activation of NF-κB pathway

LPS modulates APP expression and metabolism

Discussion

Declarations

References

Supplementary Files

Status:

Version 1