The association of the expression of RBX1 and BAMBI in polycystic ovarian syndrome patients' cumulus cells and oocyte maturation

doi:10.21203/rs.3.rs-3634802/v1

Download PDF

Research Article

The association of the expression of RBX1 and BAMBI in polycystic ovarian syndrome patients' cumulus cells and oocyte maturation

https://doi.org/10.21203/rs.3.rs-3634802/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 18 Jan, 2024

Read the published version in BMC Medical Genomics →

You are reading this latest preprint version

Background

As a prevalent endocrine illness, polycystic ovarian syndrome (PCOS) affects 6–20% of women who are at reproductive age. Follicular development can be impaired by hyperandrogenism, which is a PCOS symptom. Follicular growth disruptions in PCOS patients cause problems with oocyte development and embryonic growth. Nevertheless, the cause of PCOS remains ambiguous. By exploring the expression pattern of cumulus cells, which are important for the maturation and quality of oocytes, it might be possible to identify the genes that are associated with PCOS as well as oocyte maturation. A multi-subunit proteasome that includes RBX1 can indirectly activate APC/Cdc20, enabling oocytes to bypass the GV stage and advance to the MII stage. The WNT signaling pathway is critical for development, healthy ovarian function, and fertility. This pathway can be favorably activated by the BAMBI gene. This study seeks to examine how RBX1 and BAMBI relate to the development of PCOS and oocyte maturation.

Methods

In this experiment, we gathered the cumulus cells of mature (38 case and 33 control) and immature (38 case and 33 control) oocytes from women with/without PCOS. Besides, quantitative RT-PCR was used to assess the semi-quantitative expression of BAMBI and RBX1.

Results

According to our research, the expression of RBX1 and BAMBI in PCOS patients was significantly lower than that in non-PCOS patients. There also emerged a significant difference of expression between these two genes when they were considered in terms of their maturation stage.

Conclusion

This research raises the possibility of RBX1 and BAMBI involvement in oocyte quality in PCOS women.

BAMBI

Cumulus cells

Oocyte maturation

Polycystic ovarian syndrome

RBX1

Polycystic ovarian syndrome (PCOS) affects six to twenty percent of reproductive-age females. This syndrome, which is identified by the presence of at least two out of the three distinctive features of Rotterdam criteria including hyperandrogenism, oligo-anovulation, and polycystic ovaries (1), is one of the most common endocrine conditions in women. Additionally, there are clear connections between PCOS and other metabolic illnesses, including cancer, hypertension, diabetes mellitus, and cardiovascular diseases (2). Metabolic dysfunction in PCOS patients causes issues with oocyte maturation and embryonic development, which is caused by the change in the intrafollicular microenvironment during folliculogenesis (3).

The cumulus cells are located close to the oocyte and maintain communication with it by transzonal and gap junctions (4). In the cumulus-oocyte complex (COC), there is a bidirectional relationship between the oocyte and the cumulus, leading to oocyte maturation as well as cumulus expansion and differentiation. During the maturation of the oocyte, cumulus cells provide a gateway for the transfer of various substances, including nutrients, regulatory molecules, and paracrine factors (5). Furthermore, oocytes release substances that promote the differentiation and growth of cumulus cells (6). Evidence suggests that cumulus cells have an important role in oocyte quality, fertilization, as well as early embryonic development, and pregnancy. Therefore, investigating the expression profile of cumulus cells is a non-invasive way to evaluate the quality of oocytes (7, 8). There have been several attempts to figure out the gene expression profile of cumulus cells by microarray and RNA sequencing.

Among the genes that have the ability to favorably activate this pathway is BAMBI. Numerous investigations have demonstrated the critical function the SCF complex plays in oogenesis (9). The catalytic core of SCF, a multi-subunit proteasome, is formed by RBX1, one of its essential constituents (10). Indirect activation of APC/Cdc20 by RBX1 can cause an oocyte to bypass the GV stage and advance to the MII stage (11, 12). This study aimed to determine if these genes are involved in the etiology of PCOS or oocyte maturation, taking into account their role in ovulation.

1.1 Participants’ characteristics and experimental design

Participants who met the Rotterdam criteria for polycystic ovarian syndrome were the subjects of this investigation. They were infertile and referred to Yazd Reproductive Sciences Institute for treatment. Clinical information was gathered for all the study subjects. The exclusion criteria were androgen-secreting tumors, congenital adrenal hyperplasia, and Cushing's syndrome. Cumulus cell samples were collected from the PCOS and non-PCOS women. The control group included people who did not have PCOS and underwent ICSI treatment for male infertility. Based on the examination of the oocyte nucleus, the maturity stage was determined. The oocytes with an extruded polar body were considered mature (MII), but those with a fully developed germinal vesicle were considered immature (GV). The cumulus cells (CCs) were isolated from COCs at the GV (CCGV) and MII (CCMII) stages. We collected 38 CCMII and 38 CCGV for the PCOS group. Also, 33 CCMII and 33 CCGV were gathered from non-PCOS women as a control group.

1.2 Oocyte Retrieval and Isolation of CCs

Oocyte retrieval was carried out using ultrasonography 35–36 hours following HCG injection, and the COCs used in this investigation were identified with a stereomicroscope. Mechanical and enzyme methods were used to denude the CCs and oocytes from the COCs complex. After the CCs were separated from the COCs, the resulting CCs were washed with PBS. CCs were transferred to − 80°C in a TRIzol® Reagent (Yekta Tajhiz Azuma, Iran) to preserve RNA until the next step was initiated.

1.3 RNA extraction and cDNA synthesis

TRIzol® Reagent was used to extract the total RNA from the samples. The concentration and purity of RNA were also determined with a NanoDrop spectrophotometer (DeNovix, USA), the results were verified by agarose gel electrophoresis, and then the RNA was stored at -80°C until the next stage was initiated. Based on the manufacturer's instructions provided by the Parstous Easy cDNA Synthesis Kit (Parstous, Iran), cDNA was synthesized for both BAMBI and RBX1 genes.

1.4 Quantitative real-time PCR (qPCR)

The confirmation of the selected genes was carried out using quantitative real-time PCR (qPCR). The sequences of the primers utilized in this study are presented in Table I. With the use of the SYBR Green master mix (Yekta Tajhiz Azuma, Iran) and the Rotor Gene-Q device (Qiagen, Germany), the qPCR reaction was carried out to ascertain the relative expression of the genes. To eliminate manual mistakes, all reactions were done in duplicate. The initial denaturation was conducted for RT-PCR at 95°C for 5 minutes followed by 45 cycles of denaturation at 95°C for 20 seconds, annealing at 61°C for 20 seconds, and extension at 72°C for 30 seconds. As an endogenous control of normalization, we used the ACTB housekeeping gene. We used ACTB as the reference gene because, according to Jesús Cadenas and colleagues (2022), ACTB is a suitable reference gene for the study of cumulus cells and oocytes (13). To ensure the accuracy of the amplified products, they were run on 2% gel electrophoresis, and a melting curve analysis was performed to make sure there was no primer dimer or DNA contamination.

TableI The qPCR primers were employed in this research project.

primer	sequences	Annealing temperature (°C)	Amplicon size (bp)
F-RBX1	AACTGTGCCATCTGCAGGAA	59.89	170
R-RBX1	TCCAATGGACACACCTGTCG	59.97	170
F-BAMBI	CGCCACTCCAGCTACATCTT	59.82	104
R-BAMBI	CAGTGGGCAGCATCACAGTA	60.04	104
F-ACTB	GGGAAATCGTGCGTGACATT	59.20	183
R-ACTB	GGAAGGAAGGCTGGAAGAGT	59.01	183

qPCR: Quantitative polymerase chain reaction, RBX1: Ring box protein 1, BAMBI: Bone morphogenetic protein and activin membrane-bound inhibitor, ACTB: β-Actin, bp: Base pairs, F:

Forward, R: Reverse.

1.5 Statistical analysis

GraphPad Prism, version 8.4.3, and IBM SPSS Statistics, version 26 (SPSS Inc., Chicago, USA), were used to analyze the data. The analysis was done through one-way ANOVA and multiple t-tests to check whether there was a significant difference between the groups. The statistical significance was determined by P-values less than 0.05.

Table II reports the clinical data of the women with PCOS and those without PCOS who took part in this study. The result, as shown in Table II, indicates that no significant difference between age, BMI, and FSH ratio in the two groups. The women with PCOS displayed a greater ratio of basic LH (9.1 ± 1.6) and LH/FSH (1.38 ± 0.6) than the non-PCOS women with LH (4.1 ± 1.5) and FSH (0.6 ± 0.4). They achieved these values at P < 0.05 and P < 0.001, respectively.

Comparing the CCs of the PCOS women to that of the non-PCOS women revealed a significant difference in the relative expression of RBX1 (P = 0.0060) and BAMBI (P = 0.0002) (Fig. 1a, b). When compared to the non-PCOS patients, the PCOS women emerged to have a significantly lower expression of RBX1 in their CCs at the MII stage (P = 0.0019). Furthermore, the expression of RBX1 in the CCs of the non-PCOS women at the GV stage was significantly lower than that of the non-PCOS women at the MII stage (P = 0.0024) (Fig. 1c). The expression of BAMBI significantly was lower in the CCs of the PCOS patients at both the GV (P = 0.02) and the MII (P < 0.0001) stages, compared to that of the non-PCOS women. Additionally, the expression of BAMBI in the CCs of the PCOS women at the GV stage had significantly decreased compared to that in the CCs of the PCOS patients at the MII stage (P = 0.023). The expression of this gene was significantly lower in the CCs of the non-PCOS women at both stages (P = 0.011) (Fig. 1d).

Table II

Clinical characteristics of women with and without PCOS.

Parameters	Non-PCOS	PCOS	P-value
Age (year)	34.50 ± 4.00	32.58 ± 5.48	0.46
BMI (kg/m2)	26.55 ± 3.94	28.16 ± 5.53	0.38
FSH (IU/I)	6.8 ± 1.2	6.6 ± 1.8	0.25
LH (IU/I)	4.1 ± 1.5	9.1 ± 1.6	< 0.05
LH/FSH	0.6 ± 0.4	1.38 ± 0.6	< 0.001

Non-PCOS VS PCOS group. BMI: Body Mass Index. FSH: Follicle Stimulating Hormone. LH: Luteinizing Hormone. The values were obtained using a t-test and the results are reported as mean ± SD. *p < 0.05, **p < 0.001

E3 ligases serve to catalyze the transfer of ubiquitin to a particular substrate, which completes the ubiquitination process (14). One of the common families of E3 enzymes is the SCF complex, which is made up of three invariant components including Cullin (Cul), RBX1, and Skp1. The cataleptic core of the SCF complex is made up of RBX1 and Cul1 (15).

Yi and colleagues (16) showed that the inhibition of the proteasome complex keeps oocytes at the GV stage. A different morphology was observed by Kinterova and colleagues (12) for cumulus cells from oocytes matured in culture media containing an inhibitor of the SCF complex, which may cause problems during the expansion of cumulus cells. Cumulus expansion is an essential process involved in ovulation, oocyte maturation, and sperm capacitation. When cumulus cells expand, a change occurs in the junctional communication between them and oocytes, thus contributing to oocyte maturation (17). Studies have shown that the SCF complex is essential for the proper maturation of oocytes, cumulus cell expansion, spermatogenesis, embryogenesis, and fertilization (12)

Ring box protein 1 (RBX1) is an important component of the SCF complex that degrades EMI. EMI is an inhibitor of the anaphase-promoting complex/cyclosome (APC/C). Inhibition of this complex prevents the degradation of cyclin B and securin, which leads to stopping oocytes from progressing to the MII stage. Destruction of EMI by RBX1 activates APC/cdc20, allowing for chromosome separation and anaphase onset. Dysregulation of RBX1 can result in the accumulation of EMI and consequent inhibition of APC/cdc20, leading to anaphase arrest and keeping the cells in the GV stage (18).

In the present study, through a comparison of the MII stage groups, the CCs of the PCOS patients were found to have lower gene expression than those of the controls. The expression of RBX1 was also discovered to be lower in the CCs of the non-PCOS patients at the GV stage than in the MII stage. However, there was no significant difference in expression between the GV and MII stages in the PCOS group. This finding suggests that RBX1 may play a role in improving the quality of maturation. As Zhou and colleagues (18) found that RBX1 has an indispensable role in mouse oocyte meiotic maturation, embryonic development, and cell proliferation. To find further evidence, the outcomes were followed for these groups. In some cases, the mature oocytes taken from the PCOS women who underwent IVF failed to fertilize successfully and resulted in the loss of embryos, as opposed to the mature oocytes taken from non-PCOS women. This evidence, along with the molecular function of RBX1, can explain how this gene plays a role in oocyte quality in PCOS and why it can be a factor to consider in PCOS pathophysiology.

The WNT signaling pathway plays an imperative role in normal ovarian function, fertility (9, 19), and development of follicles (9, 20), as well as during embryogenesis (21). Akino and colleagues (22) showed that the dysregulation of this pathway in cumulus cells can result in follicle atresia, a reduced fertilization rate, and abnormal embryogenesis. The Wnt/β-catenin pathway is initiated when a ligand binds to the low-density lipoprotein receptor-related protein 5/6 (LRP5/6) and the Frizzled receptor. Without a suitable ligand, β-catenin is degraded by a destructive complex made up of GSK3B, Adenomatous Polyposis Coli (APC), and Axin (20). However, when a Wnt ligand attaches to its receptor, the destructive complex stops and β-catenin accumulates in the cytoplasm and is transported into the nucleus (23).

Bone morphogenetic protein and activin membrane-bound inhibitor (BAMBI) is shown to interact with Frizzled5 and Dishevelled2 receptors and positively activate the Wnt/β-catenin pathway. BAMBI knockdown impairs the Wnt signaling pathway, whereas its overexpression enhances cell cycle progression and transition from G1 to S phase by activating beta-catenin nuclear translocation and stimulating cyclin D1 and c-myc synthesis (24, 25)

Using microarray, Assou and colleagues (2006) showed that the BAMBI gene is overexpressed in human cumulus cells. They stated that the overexpression of the genes having a role in cell-to-cell communication helps the maturation of the oocyte-cumulus complex (26). Xinjian Li and colleagues (2020) performed high-throughput sequencing to identify candidate genes for reproductive traits in pigs. Their findings revealed that the BAMBI gene is related to reproductive traits (27). Long Bai and colleagues (2014) examined the role of BAMBI in porcine granulosa cells, finding that this gene can regulate the development of ovarian follicles and the maturation of oocytes (28). Lankford and colleagues (29) found that the relative expression of BAMBI was increased in the follicles that were competent to respond to the maturation-inducing hormone and also in mature follicles suggesting that BAMBI may contribute to the maturation process.

In the present study, it was discovered that the expression of the BAMBI gene was down-regulated in the cumulus cells of the patients compared to the controls, and this decrease in BAMBI expression in PCOS women can result in an arrested cell cycle in the primary stage, which may be the cause of lower oocyte quality in those patients. The result of the normal groups at various stages of differentiation revealed that this gene might be involved in the maturation process because its expression was downregulated in the immature group (GV) compared to the mature group (MII). Furthermore, a comparison of immature cumulus cells to mature cumulus cells showed a downregulation of expression among PCOS women. It seems that this gene not only may contribute to the pathophysiology of PCOS but also can help with oocyte maturation.

Gene expression analysis of cumulus cells provides a non-invasive method for examining oocyte conditions. An understanding of the gene expression pattern in cumulus cells can help us to develop IVF and IVM protocols. According to our research, RBX1 and BAMBI may be involved in oocyte quality in PCOS patients; however, more research is needed to validate this claim.

PCOS: polycystic ovarian syndrome

RBX1: Ring box protein 1

APC/Cdc20: anaphase-promoting complex/cyclosome;

GV: germinal vesicles

MII: metaphase II

WNT: Wingless/Integrated signaling pathway

BAMBI: Bone morphogenetic protein and activin membrane-bound inhibitor

RT-PCR: Reverse transcription polymerase chain reaction

COC: cumulus-oocyte complex

SCF complex: Skp, Cullin, F-box containing complex

ICSI: Intracytoplasmic sperm injection

CCs: cumulus cells

CCGV: COCs at the GV

CCMII: COCs at the MII

HCG: Human chorionic gonadotropin

PBS: Phosphate-buffered saline

ACTB: Actin beta

BMI: Body Mass Index

FSH: Follicle Stimulating Hormone

LH: Luteinizing Hormone

NM: non-PCOS at MII stage

NG: non-PCOS at GV stage

PM: PCOS at MII stage

PG: PCOS at GV stage

IVF: In vitro fertilization

Ethics approval and consent to participate

The Institutional Ethics Committee of the Shahid sadoughi University of Medical Sciences of Yazd approved the study design (IR.SSU.MEDICINE.REC.1401.022) and written informed consent was obtained from each participant before the collection of tissue samples.

Consent for publication

Patients signed informed consent regarding publishing their data.

Availability of data and materials

The data that support the findings of this study are available from the corresponding author, upon reasonable request.

Competing interests

The authors pronounced that they have no dispute interest.

Funding

No funding has been received for this experiment.

Authors' contributions

M.D. designed the study; F.A. and M.K. collected samples; K.M. and M.T. performed the experiments; M.V. and K.M. analysed data; K.M. wrote the manuscript in consultation with M.D.

Acknowledgements

We would like to thank our research colleagues from the Yazd Institute of Reproductive Sciences for their assistance to this project.

Alvandian F, Hosseini E, Hashemian Z, Khosravifar M, Movaghar B, Shahhosein M, et al. TGFß Gene Members and Their Regulatory Factors in Granulosa Compared to Cumulus Cells in PCOS: A Case-Control Study. Cell J. 2022;24(7):410–6.
Deswal R, Narwal V, Dang A, Pundir CS. The Prevalence of Polycystic Ovary Syndrome: A Brief Systematic Review. Journal of Human Reproductive Sciences. 2020.
Dehghan Z, Mohammadi-Yeganeh S, Rezaee D, Salehi M. MicroRNA-21 is involved in oocyte maturation, blastocyst formation, and pre-implantation embryo development. Dev Biol. 2021;
Uyar A, Torrealday S, Seli E. Cumulus and granulosa cell markers of oocyte and embryo quality. In: Fertility and Sterility. 2013.
Shen Q, Chen M, Zhao X, Liu Y, Ren X, Zhang L. Versican expression level in cumulus cells is associated with human oocyte developmental competence. Syst Biol Reprod Med. 2020;
Cillo F, Brevini TAL, Antonini S, Paffoni A, Ragni G, Gandolfi F. Association between human oocyte developmental competence and expression levels of some cumulus genes. Reproduction. 2007;
Turathum B, Gao EM, Chian RC. The function of cumulus cells in oocyte growth and maturation and in subsequent ovulation and fertilization. Cells. 2021.
Montazeri F, Kalantar SM, Fesahat F, Sheikhha MH, Omidi M, Shafienia H, et al. Association between cumulus cells—mRNA levels of AMHR2 and FSHR with oocyte maturity. Middle East Fertil Soc J [Internet]. 2022;27(1):26. Available from: https://doi.org/10.1186/s43043-022-00116-4
Hernandez Gifford JA. The role of WNT signaling in adult ovarian folliculogenesis. Reproduction. 2015;
Kim SH, Kim H. Inhibitory effect of astaxanthin on gene expression changes in Helicobacter pylori-infected human gastric epithelial cells. Nutrients. 2021;
Kinterová V, Kaňka J, Bartková A, Toralová T. SCF Ligases and Their Functions in Oogenesis and Embryogenesis—Summary of the Most Important Findings throughout the Animal Kingdom. Cells. 2022;11(2).
Kinterova V, Kanka J, Petruskova V, Toralova T. Inhibition of Skp1-Cullin-F-box complexes during bovine oocyte maturation and preimplantation development leads to delayed development of embryos. Biol Reprod. 2019;
Cadenas J, Pors SE, Nikiforov D, Zheng M, Subiran C, Bøtkjær JA, et al. Validating Reference Gene Expression Stability in Human Ovarian Follicles, Oocytes, Cumulus Cells, Ovarian Medulla, and Ovarian Cortex Tissue. Int J Mol Sci. 2022;
Berndsen CE, Wolberger C. New insights into ubiquitin E3 ligase mechanism. Nature Structural and Molecular Biology. 2014.
Bosu DR, Kipreos ET. Cullin-RING ubiquitin ligases: Global regulation and activation cycles. Cell Division. 2008.
Yi YJ, Nagyova E, Manandhar G, Procházka R, Sutovsky M, Park CS, et al. Proteolytic activity of the 26S proteasome is required for the meiotic resumption, germinal vesicle breakdown, and cumulus expansion of porcine cumulus-oocyte complexes matured in vitro. Biol Reprod. 2008;
Robker RL, Hennebold JD, Russell DL. Coordination of ovulation and oocyte maturation: A good egg at the right time. Endocrinology. 2018.
Zhou L, Yang Y, Zhang J, Guo X, Bi Y, Li X, et al. The Role of RING Box Protein 1 in Mouse Oocyte Meiotic Maturation. PLoS One. 2013;
Abedini A, Zamberlam G, Lapointe E, Tourigny C, Boyer A, Paquet M, et al. WNT5a is required for normal ovarian follicle development and antagonizes gonadotropin responsiveness in granulosa cells by suppressing canonical WNT signaling. FASEB J. 2016;
Mehdinejadiani S, Amidi F, Mehdizadeh M, Barati M, Pazhohan A, Alyasin A, et al. Effects of letrozole and clomiphene citrate on Wnt signaling pathway in endometrium of polycystic ovarian syndrome and healthy women. Biol Reprod. 2019;
Gonzalez-Ramiro H, Parrilla I, Miquel Cambra J, Gonzalez-Plaza A, Antonia Gil M, Cuello C, et al. Combined synchronization and superovulation treatments negatively impact embryo viability possibly by the downregulation of WNT/β-catenin and Notch signaling genes in the porcine endometrium. J Anim Sci. 2022;100(11):skac315.
Akino R, Matsui D, Kawahara-Miki R, Amita M, Tatsumi K, Ishida E, et al. Next-Generation Sequencing Reveals Downregulation of the Wnt Signaling Pathway in Human Dysmature Cumulus Cells as a Hallmark for Evaluating Oocyte Quality. Reprod Med. 2020;
Manolagas SC, Almeida M. Gone with the Wnts: β-catenin, T-cell factor, forkhead box O, and oxidative stress in age-dependent diseases of bone, lipid, and glucose metabolism. Molecular Endocrinology. 2007.
Zhao HJ, Chang HM, Klausen C, Zhu H, Li Y, Leung PCK. Bone morphogenetic protein 2 induces the activation of WNT/β-catenin signaling and human trophoblast invasion through up-regulating BAMBI. Cell Signal. 2020;
Liu K, Song X, Ma H, Liu L, Wen X, Yu J, et al. Knockdown of BAMBI inhibits β-catenin and transforming growth factor β to suppress metastasis of gastric cancer cells. Mol Med Rep. 2014;
Assou S, Anahory T, … VP-H, 2006 undefined. The human cumulus–oocyte complex gene-expression profile. academic.oup.com.
Li X, Ye J, Han X, Qiao R, Li X, Lv G, et al. Whole-genome sequencing identifies potential candidate genes for reproductive traits in pigs. Genomics. 2020;
Bai L, Chu G, Mai Y, Zheng J, Wang W, Zhang Q, et al. Identification and expression analyses of BAMBI mediated by FSH in swine luteinizing granulosa cells. Theriogenology. 2014;
Lankford SE, Weber GM. Temporal mRNA expression of transforming growth factor-beta superfamily members and inhibitors in the developing rainbow trout ovary. Gen Comp Endocrinol. 2010;

No competing interests reported.

Download PDF

Journal Publication

published 18 Jan, 2024

Read the published version in BMC Medical Genomics →

Editorial decision: Revision requested
24 Dec, 2023
Reviews received at journal
14 Dec, 2023
Reviewers agreed at journal
05 Dec, 2023
Reviewers agreed at journal
05 Dec, 2023
Reviewers invited by journal
27 Nov, 2023
Editor assigned by journal
26 Nov, 2023
Editor invited by journal
21 Nov, 2023
Submission checks completed at journal
21 Nov, 2023
First submitted to journal
19 Nov, 2023

You are reading this latest preprint version

The association of the expression of RBX1 and BAMBI in polycystic ovarian syndrome patients' cumulus cells and oocyte maturation

Status:

Journal Publication

Version 1

Abstract

Background

Methods

Results

Conclusion

Figures

Background

Methods

1.1 Participants’ characteristics and experimental design

1.2 Oocyte Retrieval and Isolation of CCs

1.3 RNA extraction and cDNA synthesis

1.4 Quantitative real-time PCR (qPCR)

1.5 Statistical analysis

Results

Discussion

Conclusion

Abbreviations

Declarations

References

Additional Declarations

Status:

Journal Publication

Version 1