Molecular dynamics simulation and experimental study of the surface-display of SPA protein via Lpp-OmpA system for screening of IgG

doi:10.21203/rs.3.rs-36382/v1

Download PDF

Original article

Molecular dynamics simulation and experimental study of the surface-display of SPA protein via Lpp-OmpA system for screening of IgG

https://doi.org/10.21203/rs.3.rs-36382/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Staphylococcal protein A (SpA) is a major bacterial virulence factor of Staphylococcus aureus. S. aureus is capable of escaping from immune system recognition by the surface display of protein A. The SpA protein is broadly used to purify immunoglobulin G (IgG) antibodies. This study investigates the ability of the fusion of Lpp’-OmpA (46−159) to anchor and display five repeat domains of protein A with 295 residues length (SpA295) of S. aureus on the Escherichia coli cell surface to develop a novel bioadsorbent.

First, the binding between Lpp’-OmpA-SPA295 and IgGFc and anticipation of this structure was investigated using molecular dynamics simulation. Then high IgG recovery from human serum by the surface-displayed system of Lpp’-OmpA-SPA295 performed experimentally.

In silico analysis showed the binding potential of SPA295 to IgG after surface expression on LPP-OmpA. Surface-engineered E. coli displaying SpA protein and IgG-binding assay with SDS-PAGE analysis exhibited the high potential of the expressed complex on the surface of E. coli for IgG recapture from human serum which is applicable to conventional immune precipitation.

Applied & Industrial Microbiology

Protein A- IgG interaction

Surface-displayed OmpA

Protein interaction

Molecular dynamics

S. aureus protein A (SpA) is a surface component of the bacteria (Ton-That et al., 1999) which play a role as a key virulence factor for the S. aureus pathogenesis. This is achieved through tightly binding of the SpA to the Fcγ domain of various species of IgG (Sjodahl, 1977) and interaction of the Fab domain of VH3-type B cell receptors (Cary et al., 1999). A few of the SpA mutants unable to bind to the IgG-Fcγ, and cross-link B cell receptors have been previously used as a subunit vaccine thereby inducing protein A neutralizing antibodies and were protective against S. aureus infections in mice. (Kim et al., 2010). SpA is comprised of five Ig-binding domains arranged as (IgBDs) E, D, A, B, and C (Boyle, 1990). Protein A is able to bind, with high affinity, to most IgG subclasses of human, cows, pigs, hamsters, horses, pigs, and rabbits and with low affinity to chicken, goat, rat IgG subclasses (Hadji-Ghasemi et al., 2003). This protein has been widely used for quantitative and qualitative immunological techniques including different kinds of ELISA (Lofdahl et al 1983., Tashiro and Montelione, 1995).

Display of heterologous proteins on the bacterial surface has been demonstrated as a multi-strategy approach to develop an efficient vaccine for S. aureus development (Kalyanasundram et al., 2015), screening of antibody libraries (Cavallari, 2017), development of whole-cell bioadsorbents (Tafakori et al., 2012), and biosensors (Furst et al., 2017). Chimeric protein system of the Lpp′-OmpA is used as an anchor and loads heterologous proteins onto the Gram-negative bacterial surface (Yang et al., Georgiou et al., 1996). Lpp′-OmpA consists of the first nine aminoacids of the E. coli lipoprotein (Lpp) which is fused to the residues 46–159 of the OmpA porin protein family to anchor bacterial cell wall envelope (Francisco et al., Tafakori et al., 2014).

We examined the possibility of surface displaying of SpA295 via a Lpp′-OmpA system and its binding capability to IgG_FC using bioinformatics and computational tools, which was confirmed by the experimental methods. SpA protein was successfully immobilized on the E. coli surface using an Lpp’-OmpA (46 − 159) fusion system to develop an efficient method for purification and immunoprecipitation of IgG antibodies.

2.1. Construction of Computational Modeling

The structure of SpA protein according to the amino acid sequence in this study that comprises five repeat domains of 295 amino acid residues in length (SpA₂₉₅) was predicted by ModWeb server (Pieper at al., 2014). The Geometric coordinates of X-ray crystallography of IgG were obtained from RCSB protein data bank with the access code: 4ZNC.

2.2. Computational condition of docking and molecular dynamic simulation

To provide the stable structure of Lpp’-OmpA-SPA295, this complex was subjected to molecular dynamic simulation for 30 ns. MD simulation was performed by GROMACS 5.0.5 software (van Der Spoel et al., 2005) and OPLSAA force field similar to that the previous study (Ghahremanifard et al., Hashemzadeh et al., Fasehee et al., 2018) The molecules were placed in a dodecahedron box containing the water molecule in TIP3P model. In order to create the ionic conditions of 0.15 molar, water molecules were replaced with Na⁺ and Cl⁻ ions and the total charge of system was neutralized. The initial energy minimization was performed using the steepest descent algorithm. After that, the NVT simulation was performed for 50 ps and followed by the NPT ensemble for 30 ns. In order to maintain the temperature of 300° K and the pressure of 1 bar, nose-hover thermostat and berendsen barostat were used, respectively. r = 1.2 was considered for electrostatic and van der Waals interactions.

After the structure stabilized, HDOCK server (Yan et al., 2014) was employed to investigate SpA295-IgG interaction according to default parameters of protein–protein free docking hybrid algorithm of template-based modeling. The crystallography structure of the protein–protein complexes of SpA-IgG divided into individual files as a starting structure for docking simulation.

Then the complex obtained from the HDOCK server was subjected to 30 ns molecular dynamic simulation under the conditions mentioned above.

All structures visualized by the Discovery studio. The number of hydrogen bond (H-bond) formed between acceptor and donor atoms is measured by using the geometrical criteria of a donor-acceptor distance less than 3.5 Å by RING 2.0 web server (The RING 2.0 web server for high quality residue interaction networks).

2.3. Materials used in Experimental Model

List of the primer pairs, bacterial strains and plasmids which were used in this study are mentioned in Table 1. The SpA genes were PCR-amplified from the genomic DNA of S. aureus (ATCC 6538) as a template, the Pfu DNA polymerase (Fermentas, Germany) and primers shown in Table 1. For designing the growth curves and optimization tests, bacterial cultures were grown in Luria-Bertani (LB) medium containing of 50 mg/ml kanamycin sulfate. Isopropyl beta-D-thiogalactopyranoside (IPTG) was utilized for inducing recombinant protein expression. Human serum were used for binding analysis in this study.

2.4. Plasmids construction and protein expression

Lpp′-OmpA fragment was amplified by PCR using LPOA1 and LPOTA primers to make plasmid pLOAa, previously made plasmid pET-LOA, containing the fusion of the first nine amino acids of N- terminal the Lpp and amino acids 46 to 159 of OmpA were used as a template. The 381 bp product was digested with NdeI-EcoRI restriction Enzymes, followed by ligation into the pET26b vector previously digested. PCR was carried on as followed: for 5 min at 94 °C, 30 cycles of 45 s at 94 °C, 45 s at 68 °C, 60 s at 72 °C, and 10 min at 72 °C on an MWG AG, Biotech, Primus 96 system (Germany). For gene cloning, the truncated SpA gene was amplified using primers PAF, PAR from ~ 890 bp, S. aureus genome as a template (100 ng/25 µl), and purified. To prepare the final construct of plasmid, SpA fragment (890 bp) and pLOAa were digested by EcoRI and XhoI and followed by ligation into the plasmid pLOAa. The vector is called pLOA-PA. Transformation of the vector into E. coli was carried out. It used CaCl2-mediated procedure. Overnight cultures of recombinant bacterial inoculated into 1 liter of fresh LB medium which contains 50 µg/ml kanamycin sulfate. To express fusion proteins, cultures were induced by using IPTG 0.1 mM, for 16 h. Centrifugation was used at 10000 g for 2 minute to harvest the cells.

2.5. Preparation of surface-engineered E. coli displaying SpA protein

A single colony of the recombinant E. coli harboring plasmids pLOA-PA were grown overnight in the LB media containing 35 µg/ml of kanamycin and was then inoculated into the fresh medium and continued for 8hr further incubation.

The bacterial culture was collected by centrifugation at 5000Xg for 10 min followed by a washing step with 10 ml PBS buffer by resuspended in PBS following a washing step. This was repeated for three more times.

The last time the bacteria was resuspended in 10 ml of PBS + 0.02% sodium azide, transferred to a 250 mL erlenmeyer flask and stirred at room temperature. Formaldehyde solution was added to give 1.5% final concentration and stirring was continued for 80 minutes at room temperature. Formaldehyde was removed by washing the suspension with 15 ml of 1X PBS. After discarding the supernatant, the pellet was washed in PBS + 0.02% sodium azide as a 10% (w/v) followed by a 5 min centrifugation at 5000Xg. After resuspension of the bacterial pellet in a 100 mM Tris-HCl buffer pH 8 containing 10% glycerol, it was stored at 4 ºC.

2.6. IgG-binding assay

The affinity and IgG-binding ability of the protein A-displaying E. coli was examined using IgG-binding assay with rabbit sera. The surface-engineered E. coli were washed with 1 mL of suspension buffer (100 mM Tris-HCl pH 8). The pH of rabbit sera was increased to 7.5–8 by 1M Tris of pH 8 and it was then added to the bacterial suspension followed by incubation for one hour at 4°C. The surface-engineered bacteria were washed with 100 mM Tris-HCl of pH 8. Elution buffer (100 mM glycine of pH 3 containing 1M KCl was used to release the bound IgGs from surface of the bacterial. Eluted fraction was dialyzed in 10 mM Tris-HCl and then resolved on SDS-PAGE prepared according to Laemmli (1970) followed by staining with Coomassie Brilliant Blue R-250. The E. coli transformed with the parental plasmid pLpp’-OmpA without IgG-binding domains of SpA was used as a negative control.

3.1. Complex Binding of SpA with IgG_Fc

We analyzed and evaluated the complex formation of the pLpp’-OmpA-SpA₂₉₅-IgG_FC (Fig. 1) by a high-throughput computational approach. The root mean square deviation (RMSD) and the predicted structure of Lpp’-OmpA-SpA₂₉₅ presented in Fig. 2a. RMSD plot shows the stability of the system and this structure after 30 ns of MD simulation. Binding site of this complex obtained from molecular dynamic to IgG_FC determined by docking. The docking cluster scoring models are according to the energy range from the minimum energy interaction of protein-protein complexes. We chose low free energy of the IgG_Fc complexe with pLpp’-OmpA-SpA₂₉₅ from docking to subject to molecular dynamic simulation for 30 ns that the result structure is in Fig. 2b.

The H-bonds among SpA₂₉₅ with IgG_Fc were displayed in Fig. 3 for the respective predicted amino acid residues and crystallographic models. Vdw and ionic binding between IgG_Fc and SpA₂₉₅ are also seen in the Fig. 3. Hydrophobic sites on the surface of SpA in the region that interact with IgG (Fig. 4a) and the surface electrostatic potential of SpA are observed in Fig. 4b.

3.2. Construction of Plasmids, transformation and Protein Expression

Surface attachment of the protein A (SpA) containing E, D, A, B and C domains (Fig. 1S) on the surface of E. coli BL21 (DE3) was successfully done using the Lpp′-OmpA system. The construct of Lpp'-ompA-Spa in pET26b plasmid was made. DNA sequence of p Lpp'-ompA-Spa construct cloned in pET26b, and protein sequence of p Lpp'-ompA-Spa construct are in Fig. 2S.

Construction of the pET26b plasmid was verified by restriction enzyme digestions (Fig. 3S, 4S and 5S), and DNA sequencing.

Amplification of protein A performed using PCR reactions at different temperatures (Fig. 6S). detection of non-recombinant and recombinant plasmids pET26 was performed by enzymatic digestion (Fig. 7S) and electrophoretic mobility shift assay (Fig. 8s).

The expression of the fusion truncated SpA and the control protein was carried out using E. coli BL21 DE3 and IPTG as an inducer. The protein expression by E. coli transformed with recombinant plasmids pET-LOA and pLOA-PA was evaluated using SDS-PAGE analysis (Fig. 9S and Fig. 10S).

The recombinant truncated Protein A contains five Ig-binding regions of protein A and a 6x His-tag on the C-terminus. To prevent non-specific binding to IgG, the albumin binding region and other regions present in SpA was removed to ensure the specific IgG binding. Immobilized metal affinity chromatography (IMAC) was used to purify the recombinant C-terminus 6X his-tag fusion of the SpA. Meanwhile, using anti-His-tag antibody the fusion protein A can be detected. The recombinant Protein A is ideal for immunoprecipitation and purification of antibodies as it is able to binds to most human and mouse IgG subclasses of human and mouse.

3.3. Binding assay for SpA-displayed recombinant E. coli

The recombinant SpA-displaying E. coli adsorbent that developed in this work was used for purification of the IgG from rabbit serum. After binding and two steps of washing to remove nonspecific proteins, the protein A eluted from the bioabsorbent contained mainly IgG molecules.

The presence of the peptides corresponding to the IgG heavy and light chains (about 50 kDa and 25 kDa, respectively) on polyacrylamide gel further verifies that IgG has adhered to the protein A immobilized on the recombinant E. coli surface (Fig. 5). The results of the IgG purification were also comparable with that of the one achieved by commercial protein A- agarose in which the SpA is immobilized on the surface of this polymer (Fig. 6). Eluted IgG from protein A-agarose support prepared in this study was qualitatively comparable to purified IgG using immobilized protein A agarose matrix supports by SDS-PAGE analysis as shown in Fig. 6. It is notable that protein A bind and extracts the intact form of IgG from serum by attaching to its Fc region, without changing the conformation and structure of IgG as it occurs when a reducing agent such as DTT which breaks S–S bond is present in the buffers and cause dissociation of heavy chain and light chain of IgG.

The recombinant Protein A with five Ig-binding regions, lacking the cell wall- and albumin-binding region, and a 6x His-tag on its C-terminus was designed to assure the maximum specific IgG-binding and purification. The amount of uptake of the IgG using this five SpA repeat domains system is extremely high, with a capacity of at list two IgG binding. The analyses of protein precipitates by SDS-PAGE also exhibited high yield of IgG proteins devoid of most other human serum proteins which could be applied for conventional immune complex precipitation experiments. The 6x His-tag is used for purification of SpA using Ni-NTA sepharose and its detection using monoclonal anti-His-tag antibody. The bacterial surface-displayed form of SpA is a perfect whole cell bioadsorbent for primary purification of IgG antibodies.

Our bioinformatics analysis showed the SpA₂₉₅ structure and conformation after surface displayed by Lpp’-OmpA. Results showed that the surface expression of SpA₂₉₅ creates a stable structure and does not form undesirable bonds with the surface protein Lpp’-OmpA, and maintain its binding strength to IgG_Fc.

Furthermore, the analysis displayed in the binding of Lpp’-OmpA-SpA297 complex with IgG_Fc Vander Waals interaction, hydrogen binding and ionic binding plays the biggest role respectively.

Surface expression of this novel system of the recombinant protein by five repeat domains of protein A on the surface of Escherichia coli BL21 in the experimental work and the power of IgG separation confirmed computer simulation findings. The model equipped with 6x His-tag on C-terminus of SpA that can be used for affinity purification of SpA using nickel-conjugated sepharose beads or detection using a monoclonal anti-His-tag antibody. The amount of uptake immune under five SpA repeat domains system was extremely high. The higher IgG-binding yield demonstrated through SDS-PAGE analysis which can be used as a good replacement for the conventional immune precipitates.

Staphylococcus aureus protein A (SpA), immunoglobulin G (IgG), outer membrane protein A (ompA), truncated outer membrane protein A (Lpp'-ompA), isopropylthiogalactopyranoside (IPTG), Ig-binding domains (IgBDs), Luria–Bertani medium (LB medium).

Ethics approval and consent to participate: Not applicable

Consent for publication: Not applicable

Availability of data and material: Not applicable

Competing interests: not applicable

Authors' contributions: Fatemeh Ramezani performed computational simulation. Vahed conducted most of the experiments. Tafakori is contributed to this work by doing some experiments and data analysis. Najafi collected the bioinformatics data and helped as a technical assistant. Ahmadian (corresponding author) designed the experiments, supported the project, analyzed data and wrote the final manuscript t. All authors read and approved the final manuscript.

Acknowledgements: This research was supported by the National Institute of Genetic Engineering and Biotechnology, Tehran, Iran.

Ton-That H, Liu G, Mazmanian SK, Faull KF, Schneewind O (1999) Purification and characterization of sortase, the trans peptidase that cleaves surface proteins of Staphylococcus aureusat the LPXTG motif.Proc. Natl Acad Sci USA 96:12424–12429
Sjodahl J. Repetitive sequences in protein A from Staphylococcus aureus (1977) Arrangement of five regions within the protein, four being highly homologous and Fc-binding. Eur J Biochem 73:343–351
Cary S, Krishnan M, Marion TN, Silverman GJ (1999) The murine clan V(H) III related 7183, J606 and S107 and DNA4 families commonly encode for binding to a bacterial B cell superantigen. Mol Immunol 36:769–776
Kim HK, Cheng AG, Kim HY, Missiakas DM, Schneewind O (2010) Nontoxigenic protein A vaccine for methicillin-resistant Staphylococcus aureus infections. J Exp Med 207:1863–1870
Boyle MDP (1990) Bacterial Immunoglobulin-Binding Proteins. Applications in Immunotechnology, vol 2 (Boyle M (ed)) Academic Press, Inc., San Diego, pp 3–13
Hadji-Ghasemi F, Gharagozlou S, Ghods R et al (2003) Generation and characterization of a mouse monoclonal antibody withspecificity similar to staphylococcal protein A (SPA). Hybrid Hybridomics 22:33–39
Lofdahl S et al (1983) Gene for staphylococcal protein A. Proc Natl Acad Sci USA 80:697–701
Tashiro M, Montelione GT (1995) Structures of bacterial immunoglobulin-binding domains and their complexes with immunoglobulins. Curr Opin Struct Biol 5:471–481
Kalyanasundram J, Chia SL, Song AA, Raha AR, Young HA, Yusoff K (2015) Surface display of glycosylated Tyrosinase related protein-2 (TRP-2) tumour antigen on Lactococcus lactis. BMC Biotechnol 15:113–123
Cavallari M (2017) Rapid and Direct VHH and Target Identification by Staphylococcal Surface Display Libraries. Int J Mol Sci 18:1507–1524
Tafakori V, Ahmadian G, Amoozegar MA (2012) Surface display of bacterial metallothioneins and a chitin binding domain on Escherichia coli increase cadmium adsorption and cell immobilization. Appl Biochem Biotechnol 167:462–473
Furst AL, Hoepker AC, Francis MB (2017) Quantifying hormone disruptors with an engineered bacterial biosensor. ACS Cent Sci 3:110–116
Yang C, Zhu Y, Yang J, Liu Z, Qiao C, Mulchandani A et al (2008) Applied Environmental Microbiolog 74:7733–7739
Georgiou G, StephensD L, Stathopoulos C, Poetschke HL, Mendenhall J, Earhart CF (1996) Protein Eng 9:239–247
Francisco JA, Earhart CF, Georgiou G (1992) Transport and anchoring of betalactamase to the external surface of Escherichia coli. Proc Natl Acad Sci USA 89:2713–2717
Tafakori V, Zadmard R, Tabandeh F, Amoozegar MA, Ahmadian G (2014) Equilibrium isotherm, kinetic modeling, optimization, and characterization studies of cadmium adsorption by surface-engineered Escherichia coli. Iran Biomed J 21:380–391
Pieper U, Webb BM, Dong GQ, Schneidman-Duhovny D, Fan H, Kim SJ, Khuri N, Spill YG, Weinkam P, Hammel M, Tainer JA, Nilges M, Sali A (2014) Nucleic Acids Res 42:336–346
Van Der Spoel D, Lindahl E, Hess B, Groenhof G, Mark AE, Berendsen HJ (2005) GROMACS: Fast, Flexible, and Free. J Comput Chem 16:1701–1718
Ghahremanifard P, Rezaeinezhad N, Rigi G, Ramezani F, Ahmadian G (2018) Designing a Novel Signal Sequence for Efficient Secretion of Candida Antarctica Lipase B in E. Coli: The Molecular Dynamic Simulation, Codon Optimization and Statistical Analysis Approach. Int J Biol Macromol 119:291–305
Hashemzadeh S, Ramezani F, Rafii-Tabar H (2018) Study of Molecular Mechanism of the Interaction Between MEK1/2 and Trametinib With Docking and Molecular Dynamic Simulation. Interdiscip Sci: Comput Life Sci 1:115–124
Fasehee H, Rostami A, Ramezani F, Ahmadian G (2018) Engineering E. Coli Cell Surface in Order to Develop a One-Step Purification Method for Recombinant. Proteins AMB Express 1:107
Yan Y, Zhang D, Zhou P, Li B, Huang SY (2017) HDOCK: a web server for proteinprotein and protein-DNA/RNA docking based on a hybrid strategy. Nucleic Acids Res 45:365–373
Laemmli UK (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680–685

Table 1. Primers, plasmids and strains used in this study

Primer, plasmid or strains	Description or Genotype	Source or reference
Primer PAF - EcoRI	GGGG G AAT TC T GCA AAT GCTGCGCAACAC	MWG
PAR - XhoI	GGGG CTCGAG TTTTGGTGCTTGAGCATCGT	MWG
P1 (LPO1-F) NdeI	GGGGCATATGAAAGCTACTAAACTGGTACTGGGCAACCCGTATGTTGGCTTTGAAATGGG	Tafakori et al. (2012)
LPOTA, EcoRI	GGGGGAATTCGCTCCCGGAATGCCGTTGTCCGGACGAGTG CC	Tafakori et al. (2012)
PET 26b PET 26b-lOAE (pLOAa)	T7 promoter, an N-terminal pelB signal sequence for potential periplasmic localization, plus optional C-terminal His·Tag Vector for construction and expressing of chimeric protein containing lpp′-ompA, Elongatus and Chitin Binding domain	Qiagen Novagene Constructed in this study Constructed in this study
Strain BL21 DE3	F– ompT gal dcm lon hsdSB (rB- mB-) λ (DE3 [lacI lacUV5-T7 gene 1 ind1 sam7 nin5]	Stratagene
Top 10 Staphylococcus aureus	F′[lacIq Tn10 (tetR)] mcrA Δ (mrr-hsdRMS-mcrBC) _ϕ 80lacZΔM15 ΔlacX74 deoR nupG recA1 araD139 ∆(araleu) 7697 galU galK rpsL(StrR) endA1 λ−	Invitrogen

SupplementaryFile.docx

Download PDF

Version 1

posted

You are reading this latest preprint version

Molecular dynamics simulation and experimental study of the surface-display of SPA protein via Lpp-OmpA system for screening of IgG

Status:

Version 1

Abstract

Figures

1. Introduction

2. Materials And Methods

2.1. Construction of Computational Modeling

2.2. Computational condition of docking and molecular dynamic simulation

2.3. Materials used in Experimental Model

2.4. Plasmids construction and protein expression

2.5. Preparation of surface-engineered E. coli displaying SpA protein

2.6. IgG-binding assay

3. Results

3.1. Complex Binding of SpA with IgG_Fc

3.2. Construction of Plasmids, transformation and Protein Expression

3.3. Binding assay for SpA-displayed recombinant E. coli

4. Discussion

Abbreviations

Declarations

References

Table

Supplementary Files

Status:

Version 1

Molecular dynamics simulation and experimental study of the surface-display of SPA protein via Lpp-OmpA system for screening of IgG

Status:

Version 1

Abstract

Figures

1. Introduction

2. Materials And Methods

2.1. Construction of Computational Modeling

2.2. Computational condition of docking and molecular dynamic simulation

2.3. Materials used in Experimental Model

2.4. Plasmids construction and protein expression

2.5. Preparation of surface-engineered E. coli displaying SpA protein

2.6. IgG-binding assay

3. Results

3.1. Complex Binding of SpA with IgGFc

3.2. Construction of Plasmids, transformation and Protein Expression

3.3. Binding assay for SpA-displayed recombinant E. coli

4. Discussion

Abbreviations

Declarations

References

Table

Supplementary Files

Status:

Version 1

3.1. Complex Binding of SpA with IgG_Fc