eDNA reveals the ecology and seasonal migration of a rare sturgeon species in the Ural River

doi:10.21203/rs.3.rs-3643693/v1

Download PDF

Research Article

eDNA reveals the ecology and seasonal migration of a rare sturgeon species in the Ural River

https://doi.org/10.21203/rs.3.rs-3643693/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Environmental DNA (eDNA) technology is an essential tool for monitoring living organisms in ecological research. The combination of eDNA methods with traditional methods of ecological observation can significantly improve the study of the ecology of rare species. Here we present the development and application of an eDNA approach to identify rare sturgeons in the lower reaches of the Ural River (Zhaiyk) (~ 1084 km). The presence of representatives of the genus Sturgeon was detected at all sites in spring (nine sites) and autumn (ten sites), while they were absent during the summer period, consistent with their semi-anadromous ecology. Detection in spring and autumn indicates the passage of spring and winter forms to the lower and upper spawning grounds respectively. This study confirms the difficulties of species-specific identification of Eurasian sturgeon and provides the first documented eDNA detection of specimens of the genus Sturgeon in the Ural River. It also provides a biogeographic snapshot of their distribution, experimentally confirming their seasonal migrations in the lower reaches of the river. The successful detection of sturgeon motivates further eDNA surveys of this and other fish species for accurate species identification and population assessment, opening up prospects for the management of these threatened species.

Caspian sturgeons

conservation

environmental DNA

eDNA isolation

spawning

Ural River

Sturgeons (Acipenseriformes) are ancient fish dating back to the early Jurassic (approx. 200 MYBP) [1]. All 27 species are listed on the IUCN Red List as vulnerable to critically endangered (IUCN 2023), with 23 under CITES control. Between 1970 and 2016, global sturgeon specimens decreased by around 91% [2, 3]. Factors like intensive fishing, poaching, habitat loss, and pollution have greatly affected sturgeon stocks worldwide (IUCN 2023) [4]. Sturgeons, with their long lifespan, serve as flagship species reflecting ecosystem quality. Their fate is critical in European rivers, where the Atlantic sturgeon became extinct in the 1960s in the Danube basin [5]. Ship sturgeon population was functionally extinct by 2002 [5]. Sterlet is the only sturgeon species in the Upper Danube, with only 20 individuals recorded in 2020. Russian sturgeon, stellate sturgeon, and beluga are restricted by dams, and their extinction is predicted in the Lower Danube. Conservation efforts like the Action Plan for the Conservation of the Sturgeons [6] and the "Sturgeon 2020" program aim to protect sturgeons in the Danube. The LIFE-Sterlet Project (2015–2022) and LIFE-Boat 4 Sturgeon (2022–2030) focus on strengthening populations through hatchery breeding. Despite global IUCN Red List inclusion, only three sturgeon species in the Republic of Kazakhstan's Red Data Book—ship sturgeon, Syr Darya shovelnose, and Siberian sturgeon—are categorized as endangered or extinct. Historically, Kazakhstan hosted eight sturgeon species, ranging from vulnerable to critically endangered (Table 1, IUCN Red List of Threatened Species (IUCN 2023). The Ural-Caspian basin has five non-commercial sturgeon species: Russian and Persian sturgeons, beluga, stellate, and ship sturgeons, along with one potamodromous species—sterlet.

Table 1

Representatives of *Acipenseridae* family in Kazakhstan.
Scientific Name	Common Name	Location	IUCN Status	Status in Kazakhstan
Huso huso (Linnaeus, 1758)	Beluga	Ural-Caspian basin	Critically Endangered (CR)	-
Acipenser gueldenstaedtii Brandt, 1833	Russian sturgeon	Ural-Caspian basin	Critically Endangered (CR)	-
Acipenser persicus Borodin, 1897	Persian sturgeon	Ural-Caspian basin	Critically Endangered (CR)	-
Acipenser baerii Brandt, 1869	Siberian sturgeon	Irtysh river basin	Critically Endangered (CR)	Endangered (Category ІІ)
Acipenser stellatus Pallas, 1771	Stellate sturgeon	Ural-Caspian basin	Critically Endangered (CR)	-
Acipenser nudiventris Lovetsky, 1828	Ship sturgeon	Ural-Caspian, Aral-Syrdarya, and Ili-Balkhash basins	Critically Endangered (CR)	Extinct (Category I) (Aral and Ili populations)
Acipenser ruthenus Linnaeus, 1758	Sterlet	Ural-Caspian, Tobol and Irtysh rivers basins	Vulnerable (VU)	-
Pseudoscaphirhynchus fedtschenkoi Kessler, 1872	Syr Darya shovelnose sturgeon	Syr Darya river basin	Critically Endangered (CR)	Extinct (Category I)

The Caspian Sea and rivers flowing into it are the last of the preserved natural habitats and hence in need of conservation; they are also the habitats in which most of the worldwide sturgeon populations on the verge of extinction [4] are currently found. Most sturgeons, as migratory fish, spend some periods of their life in rivers after migrating from the sea between early spring and late autumn; beluga do not stop migrating, even in winter. Spawning begins at the onset of spawning temperatures from May to June, and their juveniles move downstream shortly thereafter [7]. Rivers are convenient for studying sturgeon biology and ecology, as well as for counting migrating individuals during the spawning period. The Ural River is the only river in the Caspian basin with unregulated flow in the lower and middle reaches, which currently has preserved – albeit not sufficiently qualitative – natural spawning grounds. Another unique feature of this river is that it is inhabited by roughly 11 anadromous and potamodromous endangered fish species (The Red Data Book, IUCN 2023). The Ural River is the third longest river in Europe, with an average annual water flow of 380 m³/s near the Kushum village, flowing through the territory of two countries with different cultural, political, and environmental heritage.

Currently, the number of populations have reduced to critical values, biological parameters of individuals have reached a minimum, and only single spawners pass for spawning. As a result, no annual juvenile sturgeon is observed in the river. The spawner catch for artificial reproduction is also one of the reasons for the absence of sturgeon. Winter forms have not been found in the spawning populations of the Ural River since the mid-90s, which disrupted the intraspecific differentiation in populations, except for a small amount of winter stellate sturgeon. According to various studies, the effectiveness of natural reproduction of sturgeons in the river Ural has now been reduced to zero, past the point of no return [7]. The Persian sturgeon has also disappeared from catches since 1990. Since 2008, the spawners of the ship sturgeon have not been found in the river. The last sturgeon of its juveniles was recorded in 2007, and migrations of beluga and sturgeon juveniles only occurred until 2010. Currently, there are irregular reports of sturgeon of juvenile stellate sturgeon and sterlet by single specimens because single anadromous spawners pass to spawning grounds. During 2010–2016, 220 specimens of juvenile stellate sturgeon were reported to be migrating (156 in 2014 and 64 in 2016). In 2018, only 56 specimens of sterlet and stellate sturgeon juveniles were caught. Moreover, during the period from 2007–2021 in the West Kazakhstan region, only a single sterlet fry was registered between 2010 and 2012 [8]. To reduce the anthropogenic load on the Ural-Caspian basin, it is necessary to consolidate the integrated management of water resources of all the Caspian littoral countries by applying the principles outlined by the Integrated Water Resources Management (IWRM) and Ramsar Convention [4]. In June 2007 in Orenburg (Russia), the First International Ural River Basin Workshop (NATO Advanced Research Workshop) was organized with participation of researchers from Russia and Kazakhstan, FAO, the Secretariat of the Ramsar Convention on Wetlands (RAMSAR), the International Association for Danube Research and many others. As an outcome of the conference, a resolution “Rescue of Sturgeon Species by Means of Transboundary Integrated Watershed Management in the Ural River Basin” was adopted.

To understand the biology of sturgeons, and for many production processes in Kazakhstan, telemetry methods are applied by using sensors to tag sturgeons grown in hatcheries [9]. In the early 2000s, studies of Ural sturgeon were conducted using high-tech satellite and acoustic tagging, emphasizing beluga as an object of profitable fishing at the time of the survey. However, these works have faced many problems including insufficient salinity of the Caspian Sea, radio-frequency interference, the stress for incubated sturgeons, and frequent poaching nets in the northern Caspian Sea and Ural River delta, despite the ban on sturgeon fishing in the sea. Furthermore, these studies are expensive and only applicable when the number of sturgeons is sufficient for the study. Modern means of monitoring water areas, such as unmanned aerial vehicles (UAVs) and satellite imagery have recently been proposed as methods to optimize the protection regime on the river. In addition, to restore natural reproduction, patent works have been developed for the creation of artificial spawning grounds for sturgeons.

An important aspect of effective management of rare species is non-invasive environmental monitoring using the molecular method of environmental DNA analysis, successfully applied and superior to the traditional fish survey (TFS) [10–14]. The success of this method can be attributed to the fact that it is rapid and accurate, non-invasive and sensitive, relatively inexpensive and less labor-intensive than other methods, facilitating the detection and management of specific species – including rare ones [15–20] – as well as identification of entire communities [21–24]. It has also been used as a tool for the relative quantitative assessment of target species [25], fish communities reflecting internal ecological interactions [26], and restoring shifts in their spatial structure throughout lotic ecosystems [27]. Despite the vast amount of research in the field of fish eDNA, there is a clear gap in the detection of rare sturgeon species. Dejean et al. (2011) [28] were the first to use the sturgeon – namely the Siberian sturgeon – in an experiment on the persistence of eDNA in the aquatic environment.

The geography of eDNA studies of rare species of Acipenseridae is currently expanding, providing information on the identification, distribution, and relative abundance of populations. For example, in North America, green sturgeon DNA has been found at sites of their known presence in the Sacramento River [29], as well as outside its established range [20]. The Gulf sturgeon and extremely rare Alabama sturgeon have been found to be able to overcome dams during migration in the Mobile River Basin [30]. A follow-up study of the Alabama sturgeon recommended using a convenient precipitation method due to small volumes and additional sampling instead of water filtration. As a result, logistics are simplified, increasing the spatial and seasonal coverage of rare species. Moreover, additional samples of benthic water can be included; sturgeons are bottom-dwelling animals, thus the likelihood of obtaining false negatives is reduced [31]. Conventional and quantitative PCR eDNA assays have also been developed and tested for lake and Atlantic sturgeons protected in Canada and the USA [32–35]. Analysis of eDNA in the diets of piscine predators can be used to reveal information on the ecology of lake sturgeon larvae. For example, a study showed the predominance of their numbers on sandy transects rather than on gravel ones, reflecting the survival strategy for juveniles [36]. In China, eDNA was used to monitor the spatio-temporal distribution of Chinese sturgeon in the Yangtze [37], where changes in eDNA concentrations were correlated with breeding seasons [38]. In addition to targeted detection, Acipenseridae species in fish communities have been detected through metabarcoding [38, 39]. In a tracer experiment, Fremier et al [40] used in situ injections of eDNA from white sturgeon not native to streams with different hydrology and geomorphology. As a result, these authors recommended increasing sampling in low-slope areas where eDNA is retained and removed to the benthic zone.

Despite the ongoing development of species-specific primers for sturgeons, their reliable species identification remains questionable. The difficulty in their genetic determination lies in the high degree of similarity between different species of Eurasian sturgeon (for example, only one base differentiates Acipenser stellatus from A. ruthenus) and consequently their frequent interspecific hybridization [11, 41], leading to the appearance of various mitochondrial haplotypes and maternal mtDNA inheritance (mtDNA). A recent study of sturgeon eDNA conducted in Iran by Jafroudi et al [42] using primers developed by Waraniak et al. [36] also highlighted the challenges of distinguishing Caspian sturgeons.

Specific primers are being developed for the unique mitochondrial haplotypes of the target species within this family. Thus, the existing test systems for distinguishing native (A. sturio and A. oxyrinchus) and non-native (A. baerii, A. gueldenstaedtii, A. ruthenus, and A. stellatus) sturgeon species in Danish marine waters have proven to be efficient in both in silico and in vivo sampling. However, these primers are not able to distinguish among Ponto-Caspian species, namely the Siberian and Russian sturgeons, and sterlet [43]. Schenekar et al [44] developed an assay for A. ruthenus and possibly Huso, but this also amplified other non-target sturgeons. According to the approach proposed by Farrington and Lance [45], positive detection of North American species using common markers, in combination with the absence of positive detection by species-specific markers makes it possible to determine the occurrence of other sturgeon species with an overlapping range. As an alternative to species-specific detection, metabarcoding using universal “teleo” primers amplifying the 12S mtDNA fragment successfully detected Danube sturgeons [11, 46]. This study proposes an efficient eDNA isolation technique and demonstrates the effective use of eDNA as a tool for detecting and obtaining a snapshot of the seasonal distribution of rare and endangered Ural-Caspian sturgeons in the Lower Ural River (~ 1084 km).

Study Area and eDNA sampling

The main habitat of sturgeons is the lower reaches of the river to Uralsk city. We selected 9–10 sites along the river for our study (Fig. 1). Sampling sites were grouped to cover the upper and lower regions of the Lower Ural River; average distance between the upper sites was 110.5 km and 7 km between the lower sites. Water sampling was carried out from April 22 - October 4, 2021. The sampling period was divided into three seasons: spawning migration of spring forms (the month of April represents the peak of the run), after the spring run (July is the month with no adults or juveniles in the river), and spawning migration of winter forms (the beginning of October represents the end of the autumn run).

A total of 29 water samples were collected from inflatable and power boats at sites in the Lower Ural River (Supplemental Table S1). Sampling was carried out from upstream to downstream. In the upper section of the river, three samples for each season (nine in total) were taken at the Yanvartsevo, Uralsk, and Kushum gauging stations (West Kazakhstan region). In the lower section, six samples were taken in spring and seven samples were taken both in summer and autumn (20 in total) at the mouth of the river at intermediate stations and fishing grounds along the Golden Arm main channel: Hillocks, Water Intake, Institute, Balykshy, Lower Dam, Seventh station, and Peshnoyskaya (Atyrau region). A 2L sample of surface water was taken at each site using sterile dark plastic bottles (sterility in this context means the absence of DNA of the target species), either by wading or from a boat with measures taken to avoid contamination following [17]. Extraction from summer and autumn environmental water samples was performed within 4–7 days from sampling, while spring samples were frozen immediately and stored at -20°C until DNA extraction several months later. This work resulted in an eDNA collection of 29 samples from spring, summer, and autumn collections.

eDNA isolation and targeting amplification

We proposed a method for the direct isolation of eDNA from river water. The principle of the method is based on the use of hexadecyltrimethylammonium bromide (CTAB) cationic detergent, which precipitates DNA from an aqueous solution with a low concentration of inorganic salt. Precipitation of free eDNA was performed from filtered samples of river water by mixing the samples with CTAB buffer to a final concentration of 0.02%, followed by filtration. This method allows for the isolation of free eDNA from high-volume, highly diluted aqueous samples comprising nucleic acids. For this, 500 ml of river water samples were mixed with 20 ml of a 0.5% (w/v) aqueous CTAB solution and filtered through a cellulose nitrate membrane filter (0.22 µm) (Merck Millipore) using a glass vacuum filtration distillation apparatus (Microyn) and vacuum pump. The membranes were stored at -20°C in 15 ml Falcon tubes until further DNA extraction. The filters with free eDNA, proteins and other components deposited on them were also stored until further DNA extraction and purification. Specifically, a small fragment (5x5 mm) from each filter was placed in 2 ml tubes, and further processed according to the protocol. DNA isolation from filters was performed using two protocols to compare their efficiency (Supplementary Material). The first protocol is based on the use of 1% CTAB solution in the presence of 1 M NaCl [47] and treatment with chloroform. The second protocol uses SDS as the main component for DNA extraction from the filter, followed by chloroform treatment. The DNA precipitate was dissolved in 200 µl of 1× TE solution (0.1 mM EDTA, 10 mM Tris-HCl, pH 8.0), and total DNA concentration was determined using a NanoDrop1000 spectrophotometer (Thermo Fisher Scientific Inc.). The obtained eDNA was visualized on a 1% agarose gel using the ChemiDoc-It2 system. PCR reactions were performed in a 40 µL reaction mixture. Each reaction mixture contained 50 ng of template DNA, 1× Phire Hot Start II PCR buffer with 1.5 mM MgCl₂, 0.2 µM each primer (Table 2), 0.2 mM each dNTP, and 0.4 µL Phire Hot Start II DNA polymerase (Thermo Fisher Scientific Inc., Waltham, MA, USA). PCR amplification was carried out in a SimpliAmp™ Thermal Cycler (Thermo Fisher Scientific Inc.) under the following conditions: initial denaturation step at 98°C for 1 min, followed by 35 amplifications at 98°C for 5 s, extension at 60–65°C (depending on primer sequence) for 20 s, and 72°C for 10 s, followed by a final extension at 72°C for 3 min. DNA isolated from sturgeons was used as a positive control, and sterile water was used as a negative control. PCR products were separated by electrophoresis at 70 V for 12 h in 1.5% agarose gel with 1x TBE buffer. A Thermo Scientific (100 − 10,000 base pairs) GeneRuler DNA Ladder Mix (#SM0332) was used as a standard DNA ladder. The PCR products were visualized with a PharosFX Plus Imaging System (Bio-Rad Laboratories Inc.) with a resolution of 50 µm after staining with ethidium bromide. For amplification, universal primers for the ITS region and Acipenser species-specific primers were used. The sequence and source of primer pairs used are listed in Table 2. DNA sequencing was performed using an ABI3700 capillary sequencer (Applied Biosystems Thermo Fisher Scientific) and the Sanger method (BigDye Terminator chemistry). The obtained sequences were visualized and analyzed using UGENE and NCBI Blast software.

Table 2

Primers used for amplification of eDNA samples, including sequences of general primers for detection of representatives of the genus Acipenser.
Scientific name	Locus	Primer ID	Sequence (5′-3′)	Expected size of products (bp)	Reference
Acipenser spp. (A. baerii, A. gueldenstaedtii, A. ruthenus, and A. stellatus)	Control Region	Acibae_CR_F02	CAGTTGTATCCCCATAATCAGCC	214	[43]
	Control Region	Acibae_CR_R03	TTATTCATTATCTCTGAGCAGTCGTGA	214
Acipenser spp. (A. baerii, A. gueldenstaedtii, A. ruthenus, and A. stellatus)	cytb	Acibae_cytb_F11	TTCCACCCGTACTTCTCATAC	180–216
	cytb	Acibae_cytb_R16	GGCGTAGGCGAAGAGAAAGTA	180–216
A. ruthenus*	16S rRNA	AruF	TCTACCGTCACCCAGGTCAT	vary	[44]
A. ruthenus*	16S rRNA	AruR	CGCCTGTTAAGGTTGTGTTCTTTT	vary	[44]
Universal primers for the ITS region		ITS1	GGAAGTAAAAGTCGTAACAAGG	200–400	[71]
Universal primers for the ITS region		ITS4	TCCTCCGCTTATTGATATGC	200–400	[71]
DNA amplification of all sturgeon species and Huso h*uso is possible.

Optimization of eDNA extraction methodology from river water samples

We used our adapted protocol for extraction of free eDNA directly from river water on filters after sample filtration. In addition, we used protocols using saline CTAB and SDS methods [47] to isolate DNA (Supplementary Material) from the filter surface. To assess the performance of the protocols used to extract DNA from the filter surface, the criteria were the extraction frequency (%) and the characteristics of the DNA samples (Table S2). Evaluation of the efficiency of these methods showed that the highest concentration and purity of isolated eDNA was obtained using protocols based on CTAB salt solution and SDS [47]. As a positive control for the presence of genomic DNA in eDNA samples, amplification was performed with universal ITS primers for rRNA sections of genes of plant and animal organisms, including fungi and protists. The universal PCR with ITS primers showed the presence of a target amplification product of the expected size (600 bp). ITS sequences were detected in all analyzed summer eDNA samples, indicating that the quantity and quality of the extracted total DNA was sufficient for detection of the tested species (Figure S1). Further testing of spring and autumn eDNA samples using primers for the ITS region also showed amplification of 600 bp in all samples (Figure S2).

Amplification of eDNA samples isolated from river water with primers common to the genus Acipenser

The next step was to perform targeted amplification of eDNA samples using genus-specific primers. We used genus-specific primers aimed at distinguishing Eurasian members of the genus Acipenser occurring in the waters of the Ural River and the Caspian Sea, from other species of the genus, particularly North American sturgeon (Table 2). The primers used were designed to amplify mitochondrial genes CR and cytb, which distinguish representatives of Acipenseriformes to the genus Acipenser (and possibly Huso huso), as well as a set of universal ITS primers for detection of rRNA fragments of all fish species as a positive control. Analysis of summer eDNA samples with Acipenser genus-specific primers showed no amplification of sequences of the desired size (200 bp) (Figure S3), despite the relatively high concentration of total genomic eDNA (20–70 ng/µl) (Table S3). In contrast, spring and autumn samples revealed target products of expected sizes (~ 200 bp) (Figure S4, S5). DNA isolated from sturgeon (Russian sturgeon) was used as a positive control. Thus, all 19 river samples collected in spring and autumn were effective for the isolation of representatives of the sturgeon genus, demonstrating positive identifications.

Targeted detection of species-specific nuclear DNA markers in eDNA specimens isolated from river water

A combination of species-specific nuclear primers designed to detect beluga (Huso huso), sterlet (Acipenser ruthenus), and their interspecific hybrid bester (H. huso × A. ruthenus) were used for targeted amplification from the eDNA samples (Table 3). However, we did not identify these fish species in the studied samples. The maximum spawning migration is known to occur in April. Fry cannot be detected in July and August, since the juveniles roll into the sea by early summer. This absence was confirmed by traditional methods and eDNA metabarcoding [48], as well as a TaqMan qPCR protocol for Acipenser ruthenus [44] conducted in August in the upper Volga River of the Caspian Basin. One could assume the presence of a potamodromous (riverine) species of sterlet in the river, but [49] noted that it rarely enters the Ural River. On the other hand, the detection of sturgeon eDNA in early October confirms the arrival of winter representatives of populations. For example, although recently questioned, the passage of a small number of winter starred sturgeon individuals in the autumn was recorded. Consequently, September and October may also be an optimal period to collect eDNA samples for the purpose of monitoring Ural sturgeon. In general, the successful detection of sturgeons in the lower reaches of the river raises the possibility of their representatives migrating downstream to the middle reaches of the Ural, Ilek and Sakmara tributaries until the upper reaches of the river in the Orenburg region of the Russian Federation, where the most productive sturgeon spawning grounds are located.

Table 3

Sequences of species-specific primers for detection of beluga and sterlet and their bester hybrid.
Scientific name	Locus	Primer ID	Sequence (5′-3′)	Expected size of products (bp)	Reference
Huso huso	Nucleotide base C in reference contig (216845)	153_HHp	GATCTGAACATCAGCCACTGC	153	[60]
		153_uni	TACTGTGCCTGTATGTCTCC	153
		153_HHn	GATCTGAACATCAGCCACTGG	153
		153_uni	TACTGTGCCTGTATGTCTCC	153
Acipenser ruthenus	AG nucleotide bases in reference contig n. (140238)	247_ARp	TAAGGGTCCATGCATGCAG	247
		247_uni	TTTTAGCTGCACCGTGGC	247
		247_ARn	TAAGGGTCCATGCATGCCT	247
		247_uni	TTTTAGCTGCACCGTGGC	247

Environmental factors such as temperature and lotic geomorphology, as well as the condition of the eDNA and extraction methods, are known to influence the efficiency of eDNA technology [40, 50–52]. Consequently, we anticipated degradation of DNA due to high summer water temperatures (28–29°С) and the long time before sample filtration (4–7 days including transportation, instead of the recommended 24 h after sampling). However, the use of PCR with universal ITS primers showed sufficient concentration of isolated total eDNA for PCR. Moreover, the quantitative and qualitative properties of genomic DNA from summer specimens exceeded those of spring and autumn samples, indicating rich species diversity and resistance of eDNA to degradation in the environment, namely high temperature and long storage (up to one week) of river samples before filtration. Estimating the distribution of individuals on temporal and spatial scales requires experimental confirmation. The exact location of the target species is quite difficult to determine, and many studies have yielded varying results. Thus, while Pont et al. [53] suggest the possibility of DNA drift over distances up to 130 km, Xu et al. [37] suggest that eDNA of low-density species is unlikely to drift hundreds of km in flowing waters using sampling sites 30–50 km apart. Berger et al. [12] also demonstrated that target eDNA for fish is detectable 40–50 km downstream of the source. Furthermore, recent quantitative eDNA metabarcoding studies in the St. Lawrence River (Canada) indicated a strong local detection signal for coho salmon at a resolution of 10 to 100 m from the source population, with relative amounts of eDNA mixtures up to 13%, sufficient to cluster the fish community [54]. Previous results from metabarcoding analyses of eDNA samples from the transect of the aforementioned river (1,300 km long) also highlighted the possibility of capturing changes in fish species composition of lotic ecosystems despite potential eDNA transport [27]. The upper and lower groups of sampling points in our study were 723 km apart, with an intermediate distance of 91–130 km between the inner points in West Kazakhstan Province and 3–16 km in Atyrau Province. Hence, our positive detections from these sites will not be able to indicate the exact location of individuals; we only know that at the time of sampling, they were distributed along the entire length of the river. A series of quantitative analyses using qPCR or NGS analysis will be required to determine their exact location [54]. Regarding the timing, while the beginning of the sturgeon spawning migration period can be considered to the accuracy of days with the initial detection of target eDNA, the last eDNA detection signal indicating the end of spawning or juvenile rays is unclear, also requiring experimental confirmation. To this end, researchers are evaluating the degradation rate of free eDNA [55] and quantifying fish abundance using a mass balance model of eDNA concentration [56]. Although Yates et al. [57] state that under natural conditions, organism abundance is correlated with eDNA concentration by approximately 50%. It is known that under mesocosm conditions, eDNA can be detected for up to two or three weeks [10, 16], or even 58 days according to one study [58]. Target sturgeon eDNA was detected in low numbers (two replicates among 25 eDNA samples) for a single individual from the reservoir within a week after the individual was removed [11, 58]. For marine systems, a period of up to 48 hours has been suggested for optimal processing before eDNA starts to degrade [59]. The lack of successful identification in our study based on biallelic nuclear DNA markers of H. huso, A. ruthenus, and bester can be explained by the fact that these DNA markers are effective for testing species by eDNA, the source of which is usually the remains of fish eggs in water bodies [60]. Nuclear marker copy number in cells is known to be significantly inferior to mitochondrial DNA copy number, hence species detection using nuclear markers may be inefficient. On the other hand, the copy number of nuclear ITS sequences exceed that of CytB genes by up to 150-fold. Therefore, high copy number ITS sequences allow for increased sensitivity of eDNA detection, and with the use of smaller volumes of water samples for analysis [61]. In this study, ribosomal gene sequences also showed sufficient amplification of the nuclear ITS regions of all samples. It is known that detection of rare species requires the most sensitive protocol to avoid false negative results [62]. In this study, we used the liquid-phase extraction methods based on eDNA precipitation from a salt-free aqueous solution with CTAB detergent on a membrane, followed by extraction with CTAB salt solution and chloroform. This resulted in an excellent yield of membrane-bound eDNA. Previous work also confirms the advantage of CTAB protocols over commercial kits [63, 64], despite their common use [65, 66], including in sturgeon detection [31]. The main reason for the loss of DNA in commercial kits is the inhibition of PCR by organic contaminants during extraction of genomic DNA from the sample [67]. Dilution of DNA solutions used in this process further inhibits PCRs, and contributes to an even lower detection of target DNA [68]. Regarding the volume, our 500 mL river samples showed successful detection of target sturgeon DNA, indicating sufficient eDNA of these rare fishes in the samples and the efficiency of our proposed method. The mesocosm experiment of Thomsen et al. [16] and the studies of Janosik et al. [31] in a lotic system also demonstrate the sufficiency and convenience of small water samples (15 mL) for both searching for eDNA of endangered species and increasing the range of coverage of target species. However, contrary reports also exist – according to Shaw et al. [69], 2L of water samples are insufficient for detection of rare species by metabarcoding with prior isolation by commercial kits, requiring even 5L of water samples for 100% detection rate. Increasing the volume of filtered water is particularly relevant for maximizing biodiversity coverage, for example in marine ecosystems [70], whereas small volumes are quite effective when searching for target species in lotic ecosystems, as our study confirms.

Our studies represent the first known case of documented presence of sturgeons in the Ural River using eDNA methods. Moreover, the presence of sturgeons in all spring and autumn samples may indicate their sufficient abundance, although species affiliation remains questionable. As identification of sturgeon species by classical species-specific detection is currently challenging, total eDNA analysis with high-throughput sequencing may be a solution [11, 26]. Thus, our experimental studies contribute to the methodology of free eDNA analysis and expand the potential for monitoring sturgeon fishes of the Ural River basin creating prerequisites for location mapping and quantitative assessment of population status using eDNA.

Our analysis of river samples and the proposed method of eDNA isolation and purification from river samples is a highly efficient, sensitive, and relatively inexpensive method for detecting rare species in environmental samples. This study presented the first biogeographic analysis of sturgeon distribution and evidence of seasonal migration of their representatives in the Lower Urals. We have shown that the presence of fish species of interest was detected in all spring and autumn samples detected, but not in summer, consistent with sturgeon ecology.

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Availability of data and materials

Data is available in the article's supplementary material.

Competing interests

The authors have declared that no competing interests exist.

Funding

This work was funded by the Science Committee of the Ministry of Education and Science of the Republic of Kazakhstan (Grant No. AP14869076). Open access funding provided by University of Helsinki, including Helsinki University Central Hospital.

Authors' contributions

R.K. conceptualized the project; R.K. developed the methods and software;

R.K., A.T., O.K., G.A. performed the experiments and analyzed the data;

R.K., G.A., A.T., O.K., A.Z. wrote the paper;

R.K., A.T., O.K., G.A. prepared the figures;

R.K., G.A., A.Z. acquired funds for the project. All authors reviewed the manuscript.

Acknowledgements

The authors would like to acknowledge Dr. K. B. Isbekov, Director General of the Scientific and Production Center of Fisheries (SPCF), Dr E. L. Kadimov, Director of the Atyrau Branch of the SPCF, Dr A. N. Tumenov, Director of the West Kazakhstan Branch of the SPCF for permission for conducting field survey along the Ural River. We are also grateful to Dr. A. I. Kim, Head of the Fisheries Laboratory of the West Kazakhstan Branch of the SPCF; T. A. Uteuliev, A. M. Tuleuov and N. U. Bulekov, scientific fellows of Atyrau and West Kazakhstan Branches of the SPCF for providing support in the fieldwork, as well as GIS specialist N. Nurtazina for graphical design of the map. We warmly thank Jacquelin DeFaveri (University of Helsinki) for outstanding editing and proofreading of the manuscript.

Bemis WE, Findeis EK, Grande L. An overview of Acipenseriformes. In: Sturgeon Biodiversity and Conservation. Edited by Birstein VJ, Waldman JR, Bemis WE. Dordrecht: Springer Netherlands; 1997: 25–71.
Yarushina MI, Eremkina TV, Tockner K. Chap. 18 - Ural River Basin. In: Rivers of Europe. Edited by Tockner K, Uehlinger U, Robinson CT. London: Academic Press; 2009: 673–684.
Secretariat. World Wildlife Trade Report. Switzerland: Geneva; 2022.
Rosenthal H, Pourkazemi M, Bruch R. The 5thInternational Symposium on Sturgeons: a conference with major emphasis on conservation, environmental mitigation and sustainable use of the sturgeon resources. Journal of Applied Ichthyology 2006, 22(s1):1–4.
Jarić I, Lenhardt M, Cvijanović G, Ebenhard T. Acipenser sturioandAcipenser nudiventrisin the Danube - extant or extinct? J Appl Ichthyol. 2009;25(2):137–41.
Bloesch J, Jones T, Reinartz R, Striebel B. An action plan for the conservation of sturgeons (acipenseridae) in the Danube River Basin. Österreichische Wasser- und Abfallwirtschaft. 2006;58(5):81–8.
Kulikov EV, Isbekov KB, Asylbekova SZ, Kadimov EL, Kamelov AK. Present Status of Natural Reproduction of Sturgeon (Acipenseridae) in the Ural River. Vestnik of Astrakhan State Technical University Series: Fishing industry 2018:81–8.
Kadimov EL, Asylbekova SZ, Kim AI. Research of Natural Fish Reproduction in the Ural River in the West Kazakhstan Region of the Republic of Kazakhstan. Vestnik of Astrakhan State Technical University Series: Fishing industry 2018:39–45.
Sergaliev NK, Sariev BT, Tumenov AN, Bakiev SS. Efficiency of tagging methods for sturgeon fish producers. Experimental Biology 2020, 85(4).
Dejean T, Valentini A, Miquel C, Taberlet P, Bellemain E, Miaud C. Improved detection of an alien invasive species through environmental DNA barcoding: the example of the American bullfrogLithobates catesbeianus. J Appl Ecol. 2012;49(4):953–9.
Meulenbroek P, Hein T, Friedrich T, Valentini A, Erős T, Schabuss M, Zornig H, Lenhardt M, Pekarik L, Jean P, et al. Sturgeons in large rivers: detecting the near-extinct needles in a haystack via eDNA metabarcoding from water samples. Biodivers Conserv. 2022;31(11):2817–32.
Berger CS, Hernandez C, Laporte M, Côté G, Paradis Y, Kameni TDW, Normandeau E, Bernatchez L. Fine-scale environmental heterogeneity shapes fluvial fish communities as revealed by eDNA metabarcoding. Environ DNA. 2020;2(4):647–66.
Boivin-Delisle D, Laporte M, Burton F, Dion R, Normandeau E, Bernatchez L. Using environmental DNA for biomonitoring of freshwater fish communities: Comparison with established gillnet surveys in a boreal hydroelectric impoundment. Environ DNA. 2020;3(1):105–20.
Deeg CM, Li S, Esenkulova S, Hunt BPV, Schulze AD, Miller KM. Environmental DNA survey of the Winter Salmonosphere in the Gulf of Alaska. Environ DNA. 2023;5(3):519–39.
Piggott MP, Banks SC, Broadhurst BT, Fulton CJ, Lintermans M. Comparison of traditional and environmental DNA survey methods for detecting rare and abundant freshwater fish. Aquat Conservation: Mar Freshw Ecosyst. 2020;31(1):173–84.
Thomsen PF, Kielgast J, Iversen LL, Wiuf C, Rasmussen M, Gilbert MT, Orlando L, Willerslev E. Monitoring endangered freshwater biodiversity using environmental DNA. Mol Ecol. 2012;21(11):2565–73.
Jerde CL, Mahon AR, Chadderton WL, Lodge DM. Sight-unseen detection of rare aquatic species using environmental DNA. Conserv Lett. 2011;4(2):150–7.
Wilcox TM, McKelvey KS, Young MK, Jane SF, Lowe WH, Whiteley AR, Schwartz MK. Robust detection of rare species using environmental DNA: the importance of primer specificity. PLoS ONE. 2013;8(3):e59520.
Wilcox TM, McKelvey KS, Young MK, Sepulveda AJ, Shepard BB, Jane SF, Whiteley AR, Lowe WH, Schwartz MK. Understanding environmental DNA detection probabilities: A case study using a stream-dwelling char Salvelinus fontinalis. Biol Conserv. 2016;194:209–16.
Anderson JT, Schumer G, Anders PJ, Horvath K, Merz JE. Confirmed Observation: A North American Green Sturgeon Acipenser medirostris Recorded in the Stanislaus River, California. J Fish Wildl Manage. 2018;9(2):624–30.
Kelly RP, Shelton AO, Gallego R. Understanding PCR Processes to Draw Meaningful Conclusions from Environmental DNA Studies. Sci Rep. 2019;9(1):12133.
Thomsen PF, Kielgast J, Iversen LL, Moller PR, Rasmussen M, Willerslev E. Detection of a diverse marine fish fauna using environmental DNA from seawater samples. PLoS ONE. 2012;7(8):e41732.
Li F, Peng Y, Fang W, Altermatt F, Xie Y, Yang J, Zhang X. Application of Environmental DNA Metabarcoding for Predicting Anthropogenic Pollution in Rivers. Environ Sci Technol. 2018;52(20):11708–19.
Araujo ASF, de Araujo Pereira AP, Melo VMM, de Medeiros EV, Mendes LW. Environmental DNA Sequencing to Monitor Restoration Practices on Soil Bacterial and Archaeal Communities in Soils Under Desertification in the Brazilian Semiarid. Microb Ecol. 2023;85(3):1072–6.
Agersnap S, Larsen WB, Knudsen SW, Strand D, Thomsen PF, Hesselsoe M, Mortensen PB, Vralstad T, Moller PR. Monitoring of noble, signal and narrow-clawed crayfish using environmental DNA from freshwater samples. PLoS ONE. 2017;12(6):e0179261.
Yang J, Zhang L, Mu Y, Zhang X. Small changes make big progress: A more efficient eDNA monitoring method for freshwater fish. Environ DNA. 2023;5(2):363–74.
García-Machado E, Laporte M, Normandeau E, Hernández C, Côté G, Paradis Y, Mingelbier M, Bernatchez L. Fish community shifts along a strong fluvial environmental gradient revealed by eDNA metabarcoding. Environ DNA. 2021;4(1):117–34.
Dejean T, Valentini A, Duparc A, Pellier-Cuit S, Pompanon F, Taberlet P, Miaud C. Persistence of environmental DNA in freshwater ecosystems. PLoS ONE. 2011;6(8):e23398.
Bergman PS, Schumer G, Blankenship S, Campbell E. Detection of Adult Green Sturgeon Using Environmental DNA Analysis. PLoS ONE. 2016;11(4):e0153500.
Pfleger MO, Rider SJ, Johnston CE, Janosik AM. Saving the doomed: Using eDNA to aid in detection of rare sturgeon for conservation (Acipenseridae). Global Ecol Conserv. 2016;8:99–107.
Janosik AM, Whitaker JM, VanTassel NM, Rider SJ. Improved environmental DNA sampling scheme for Alabama sturgeon provides new insight into a species once presumed extinct. J Appl Ichthyol. 2021;37(2):178–85.
Bronnenhuber JE, Wilson CC. Combining species-specific COI primers with environmental DNA analysis for targeted detection of rare freshwater species. Conserv Genet Resour. 2013;5(4):971–5.
Yusishen ME, Eichorn F-C, Anderson WG, Docker MF. Development of quantitative PCR assays for the detection and quantification of lake sturgeon (Acipenser fulvescens) environmental DNA. Conserv Genet Resour. 2018;12(1):17–9.
Hernandez C, Bougas B, Perreault-Payette A, Simard A, Côté G, Bernatchez L. 60 specific eDNA qPCR assays to detect invasive, threatened, and exploited freshwater vertebrates and invertebrates in Eastern Canada. Environ DNA. 2020;2(3):373–86.
Plough LV, Bunch AJ, Lee BB, Fitzgerald CL, Stence CP, Richardson B. Development and testing of an environmental DNA (eDNA) assay for endangered Atlantic sturgeon to assess its potential as a monitoring and management tool. Environ DNA. 2021;3(4):800–14.
Waraniak JM, Blumstein DM, Scribner KT. Barcoding PCR primers detect larval lake sturgeon (Acipenser fulvescens) in diets of piscine predators. Conserv Genet Resour. 2017;10(2):259–68.
Xu N, Zhu B, Shi F, Shao K, Que Y, Li W, Li W, Jiao W, Tian H, Xu D, et al. Monitoring seasonal distribution of an endangered anadromous sturgeon in a large river using environmental DNA. Naturwissenschaften. 2018;105(11–12):62.
Yu D, Shen Z, Chang T, Li S, Liu H. Using environmental DNA methods to improve detectability in an endangered sturgeon (Acipenser sinensis) monitoring program. BMC Ecol Evol. 2021;21(1):216.
Stoeckle MY, Soboleva L, Charlop-Powers Z. Aquatic environmental DNA detects seasonal fish abundance and habitat preference in an urban estuary. PLoS ONE. 2017;12(4):e0175186.
Fremier AK, Strickler KM, Parzych J, Powers S, Goldberg CS. Stream Transport and Retention of Environmental DNA Pulse Releases in Relation to Hydrogeomorphic Scaling Factors. Environ Sci Technol. 2019;53(12):6640–9.
Ludwig A, Debus L, Jenneckens I. Int Rev Hydrobiol. 2002;87(5–6):661–74.
Torabi Jafroudi H, Jamshidi S, Talesh Sasani S, Bani A. Molecular Identification of Residual DNA Separated from the Persian Sturgeon (Acipenser persicus) for Modeling eDNA Evaluation in Aquatic Ecosystem. J Genetic Resour. 2023;9(1):103–10.
Knudsen SW, Hesselsoe M, Thaulow J, Agersnap S, Hansen BK, Jacobsen MW, Bekkevold D, Jensen SKS, Moller PR, Andersen JH. Monitoring of environmental DNA from nonindigenous species of algae, dinoflagellates and animals in the North East Atlantic. Sci Total Environ. 2022;821:153093.
Schenekar T, Schletterer M, Weiss SJ. Development of a TaqMan qPCR protocol for detecting Acipenser ruthenus in the Volga headwaters from eDNA samples. Conserv Genet Resour. 2020;12(3):395–7.
Farrington H, Lance R. Development of genetic markers for environmental DNA (eDNA) monitoring of sturgeon. Ecosyst Manag Restor Res Progr 2014, 12:ERDC TN-EMRRP-RQ-02.
Pont D, Meulenbroek P, Bammer V, Dejean T, Eros T, Jean P, Lenhardt M, Nagel C, Pekarik L, Schabuss M, et al. Quantitative monitoring of diverse fish communities on a large scale combining eDNA metabarcoding and qPCR. Mol Ecol Resour. 2023;23(2):396–409.
Kalendar R, Boronnikova S, Seppanen M. Isolation and Purification of DNA from Complicated Biological Samples. Methods Mol Biol. 2021;2222:57–67.
Lecaudey LA, Schletterer M, Kuzovlev VV, Hahn C, Weiss SJ. Fish diversity assessment in the headwaters of the Volga River using environmental DNA metabarcoding. Aquat Conservation: Mar Freshw Ecosyst. 2019;29(10):1785–800.
Bokova I. UNESCO 2015, UNESCO report 2015, Rapport UNESCO 2015. In.: UNESCO; 2016: 175.
Barnes MA, Turner CR, Jerde CL, Renshaw MA, Chadderton WL, Lodge DM. Environmental conditions influence eDNA persistence in aquatic systems. Environ Sci Technol. 2014;48(3):1819–27.
Naef T, Besnard AL, Lehnen L, Petit EJ, van Schaik J, Puechmaille SJ. How to quantify factors degrading DNA in the environment and predict degradation for effective sampling design. Environ DNA. 2023;5(3):403–16.
Kirtane A, Kleyer H, Deiner K. Sorting states of environmental DNA: Effects of isolation method and water matrix on the recovery of membrane-bound, dissolved, and adsorbed states of eDNA. Environ DNA. 2023;5(3):582–96.
Pont D, Rocle M, Valentini A, Civade R, Jean P, Maire A, Roset N, Schabuss M, Zornig H, Dejean T. Environmental DNA reveals quantitative patterns of fish biodiversity in large rivers despite its downstream transportation. Sci Rep. 2018;8(1):10361.
Laporte M, Berger CS, García-Machado E, Côté G, Morissette O, Bernatchez L. Cage transplant experiment shows weak transport effect on relative abundance of fish community composition as revealed by eDNA metabarcoding. Ecol Ind 2022, 137.
Kirtane A, Wieczorek D, Noji T, Baskin L, Ober C, Plosica R, Chenoweth A, Lynch K, Sassoubre L. Quantification of Environmental DNA (eDNA) shedding and decay rates for three commercially harvested fish species and comparison between eDNA detection and trawl catches. Environ DNA. 2021;3(6):1142–55.
Sassoubre LM, Yamahara KM, Gardner LD, Block BA, Boehm AB. Quantification of Environmental DNA (eDNA) Shedding and Decay Rates for Three Marine Fish. Environ Sci Technol. 2016;50(19):10456–64.
Yates MC, Fraser DJ, Derry AM. Meta-analysis supports further refinement of eDNA for monitoring aquatic species‐specific abundance in nature. Environ DNA. 2019;1(1):5–13.
Strickler KM, Fremier AK, Goldberg CS. Quantifying effects of UV-B, temperature, and pH on eDNA degradation in aquatic microcosms. Biol Conserv. 2015;183:85–92.
Collins RA, Wangensteen OS, O'Gorman EJ, Mariani S, Sims DW, Genner MJ. Persistence of environmental DNA in marine systems. Commun Biol. 2018;1:185.
Havelka M, Fujimoto T, Hagihara S, Adachi S, Arai K. Nuclear DNA markers for identification of Beluga and Sterlet sturgeons and their interspecific Bester hybrid. Sci Rep. 2017;7(1):1694.
Minamoto T, Uchii K, Takahara T, Kitayoshi T, Tsuji S, Yamanaka H, Doi H. Nuclear internal transcribed spacer-1 as a sensitive genetic marker for environmental DNA studies in common carp Cyprinus carpio. Mol Ecol Resour. 2017;17(2):324–33.
Sanches TM, Schreier AD. Optimizing an eDNA protocol for estuarine environments: Balancing sensitivity, cost and time. PLoS ONE. 2020;15(5):e0233522.
Turner CR, Barnes MA, Xu CCY, Jones SE, Jerde CL, Lodge DM, Gilbert M. Particle size distribution and optimal capture of aqueous macrobialeDNA. Methods Ecol Evol. 2014;5(7):676–84.
Renshaw MA, Olds BP, Jerde CL, McVeigh MM, Lodge DM. The room temperature preservation of filtered environmental DNA samples and assimilation into a phenol-chloroform-isoamyl alcohol DNA extraction. Mol Ecol Resour. 2015;15(1):168–76.
Tsuji S, Takahara T, Doi H, Shibata N, Yamanaka H. The detection of aquatic macroorganisms using environmental DNA analysis—A review of methods for collection, extraction, and detection. Environ DNA. 2019;1(2):99–108.
Shu L, Ludwig A, Peng Z. Standards for Methods Utilizing Environmental DNA for Detection of Fish Species. Genes (Basel) 2020, 11(3).
Eichmiller JJ, Miller LM, Sorensen PW. Optimizing techniques to capture and extract environmental DNA for detection and quantification of fish. Mol Ecol Resour. 2016;16(1):56–68.
Takahara T, Minamoto T, Doi H. Effects of sample processing on the detection rate of environmental DNA from the Common Carp (Cyprinus carpio). Biol Conserv. 2015;183:64–9.
Shaw JLA, Clarke LJ, Wedderburn SD, Barnes TC, Weyrich LS, Cooper A. Comparison of environmental DNA metabarcoding and conventional fish survey methods in a river system. Biol Conserv. 2016;197:131–8.
Bessey C, Jarman SN, Berry O, Olsen YS, Bunce M, Simpson T, Power M, McLaughlin J, Edgar GJ, Keesing J. Maximizing fish detection with eDNA metabarcoding. Environ DNA. 2020;2(4):493–504.
Yang RH, Su JH, Shang JJ, Wu YY, Li Y, Bao DP, Yao YJ. Evaluation of the ribosomal DNA internal transcribed spacer (ITS), specifically ITS1 and ITS2, for the analysis of fungal diversity by deep sequencing. PLoS ONE. 2018;13(10):e0206428.

No competing interests reported.

SupplementaryMaterial.docx

Download PDF

Version 1

posted

You are reading this latest preprint version

eDNA reveals the ecology and seasonal migration of a rare sturgeon species in the Ural River

Status:

Version 1

Abstract

Figures

Introduction

Methods

Study Area and eDNA sampling

eDNA isolation and targeting amplification

Results and Discussion

Optimization of eDNA extraction methodology from river water samples

Amplification of eDNA samples isolated from river water with primers common to the genus Acipenser

Targeted detection of species-specific nuclear DNA markers in eDNA specimens isolated from river water

Conclusion

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1