Construction of CRISPR/CAS9 system for industrial Saccharomyces cerevisiae strain and genetic manipulation effect on 2-phenylethanol pathway

doi:10.21203/rs.3.rs-364472/v1

PDF

Research

Construction of CRISPR/CAS9 system for industrial Saccharomyces cerevisiae strain and genetic manipulation effect on 2-phenylethanol pathway

https://doi.org/10.21203/rs.3.rs-364472/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted 01 Apr, 2021

You are reading this latest preprint version

Background

The market demand for natural 2-phenylethanol (2-PE) continues to increase. Saccharomyces cerevisiae can synthesize 2-PE through the Ehrlich pathway. There are few studies on the improvement of the diploid industrial strains of S. cerevisiae by gene editing technology. There is no report on the comparison of genetic manipulation effect among S.cerevisiae strains with different 2-PE yield background, and the study on knockout of 2-PE downstream product synthesis gene and its effect on the yield of 2-PE have not been found.

Results

The CRISPR/CAS9 system with high efficiency for diploid S.cerevisiae CWY132 strain for industrial production of 2-PE was constructed. When the length of the homology arm of donor DNA is increased from 60bp to 500bp, the efficiency of gene editing increased from 0–100%. Using CRISPR/CAS9 technology, the branched acetaldehyde dehydrogenase genes ALD2 and ALD3 and the terminal acetyltransferase gene ATF1 in the Ehrlich pathway of S.cerevisiae strains with different 2-PE yields were knocked out. The results showed that in the high-yielding CWY-132 strain, the 2-PE yield decreased from 3.50 g/L to 1.65 g/L when double ALD2 and ALD3 were knocked out, a decrease of 52.8%. When ATF1 was knocked out, the yield of 2-PE decreased to 0.83 g/L, a decrease of 76.2%; In the low-yielding strain PK-2C, the yield of 2-PE increased from 0.21 g/L to 1.20 g/L when ALD2 was knocked out, an increase of 471%. When ATF1 was knocked out, the yield of 2-PE increased to 0.45g/L, an increase of 114%. The results show that the same genetic manipulation strategy for strains with different 2-PE yeilds backgrounds produces significantly different or even opposite effects. In addition, we found that the insufficient supply of NADH in cells can significantly affect the production of 2-PE, and the tolerance of cells to 2-PE is also a key factor that limits the further increase of 2-PE production in high-yielding strain.

Conclusions

This study shows that the length of the Donor DNA homology arm is a key factor affecting the efficiency of CRISPR/CAS9 gene editing in industrial diploid S. cerevisiae strains. Our result also shows that it is not feasible to increase the 2-PE production in high-yielding strains by blocking the branch pathway in the Ehrlich pathway. Breakthrough in the 2-PE yield of the high-yielding strains requires improved strains’ tolerance to 2-PE and increase the cellular NADH level.

Applied & Industrial Microbiology

Biotechnology and Bioengineering

Ehrlich pathway

2-phenylethanol

ATF1

ALD3

CRISPR/CAS9

Saccharomyces cerevisiae

2-Phenylethanol (2-PE) is an aromatic alcohol with the fragrance of roses, which is naturally present in roses and fermented foods[1]. 2-PE contains a unique fragrance and is highly sought after by people. It is widely added in food, tobacco, cosmetics and daily chemical products[2–4]. 2-PE can also be used as a substrate for the production of its derivatives, such as another valuable flavor compound, ethyl phenylacetate[5]. At present, the methods for producing 2-PE in industry are mainly chemical synthesis and natural methods[6]. The chemical method not only has toxic substrates, but also contains by-products that are difficult to remove, so it is difficult to be widely used. The food industry is particularly prominent, which makes people more inclined to use natural 2-PE[7]. The natural production of 2-PE can be directly extracted from plants or transformed with microorganisms[8]. The price of chemically synthesized 2-PE in the market is about 5$/kg, while the natural one is up to 1000$/kg[9, 10]. Due to the insufficient supply of raw materials and low production efficiency, the direct extraction method cannot meet industrial production [11]. The production of natural 2-PE is mainly focused on microbial transformation.

Among the microorganisms currently known to produce 2-PE, they mainly include S. cerevisiae, Escherichia coli, Meyerozyma guilliermondii, Pichia pastoris, Candida glycerinogenes and Yarrowia lipolytica etc.[12]. Among them, S. cerevisiae is an internationally recognized safety model microorganism for both industrial processes and scientific research[13], it is the most widely studied strain for 2-PE production [4, 14, 15].

The metabolic pathway of 2-PE production in S.cerevisiae has been studied very clearly. One is the shikimic acid pathway of de novo synthesis of 2-PE from glucose[16],the second is the Ehrlich pathway through biotransformation of L-phenylalanine to 2-PE[12, 17]. The synthetic 2-PE of the former is much lower than that by the Ehrlich pathway[18, 19]. In the Ehrlich pathway, first L-Phe enters the cell under the action of amino acid permease (such as Gap1, Agp1 and Tat1)[20–22], and then it is transformed into 2-PE (Fig. 1): L-Phe is converted into phenylpyruvate under the action of transaminase, which are aromatic transaminase I (Aro8) and aromatic transaminase II (Aro9), which are encoded by the genes ARO8 and ARO9; Phenylpyruvate is catalyzed by phenylpyruvate decarboxylase to remove a carboxyl group to form phenylacetaldehyde[5]. There may be 5 genes encoding phenylpyruvate decarboxylase in S.cerevisiae, including PDC1, PDC5, PDC6, ARO10 and THI3[23, 24], when L-Phe is used as the sole nitrogen source, it is mainly expressed by ARO10[25]; Finally, phenylacetaldehyde produces 2-PE under the action of alcohol dehydrogenase (Adh1, Adh2, Adh3, Adh4 and Adh5) [5, 19, 26]. Overexpression of ARO8 and ARO10 in S. cerevisiae S288C obtained 2-PE yield of 2.61 g/L after 60 h fed-batch fermentation, which was 36.8% higher than that of the wild type[13].

There are precursors and energy shunts caused by two branch pathways during the synthesis of 2-PE. One is phenylacetaldehyde, the precursor of 2-PE, can be oxidized to phenylacetic acid under the action of acetaldehyde dehydrogenase[1]; The second is that the product 2-PE can be further converted into 2-phenylacetoethyl ester under the action of acetyltransferase[12, 27] (Fig. 1). In the oxidation process of phenylacetaldehyde, ALD3 and ALD2 genes play a key role[1, 28], and acetyltransferase is encoded by ATF1. Bosu Kim et al. Knocked out ALD3 and ALD2 of S.cerevisiae W303, and when 83 mg/L L-Phe was used as substrate, the final 2-PE yield increased by about 35% compared with that of wild type[1]. Overexpression of AAP9, ARO9 and ARO10 and knockout ALD2 and ALD3 in C.glycerinogenes resulted in an increase of 2-PE production by 38.9% to 5g/L[29]. However, the blocking of the consumption pathway of 2-PE catalyzed by ATF1 has not been reported yet.

CRISPR/CAS9 gene editing technology has been widely used in genetic engineering of microorganisms including S.cerevisiae for advantages of high efficiency and the ability to edit multiple genes at the same time[30, 31]. Compared with haploid laboratory yeast strains, diploid industrial S.cerevisiae strains are more robust and characterised by high levels of genomic diversity, which makes genetic engineering difficult[30]. Although CRISPR/CAS9 gene editing technology has been applied to laboratory yeast[32, 33] and industrial yeast[30], the editing efficiency in industrial yeast is still at a low level. Recent studies on 2-PE production by S. cerevisiae, YS58 strain[22], S288c strain[13]and W303 strain[1] are mostly haploid experimental strains, and there are few studies on diploid strains for industrial production. Therefore, it is necessary to explore to improve the gene editing efficiency of industrial yeast in order to carry out genetic engineering of strains.

2-PE can increase the fluidity of cell membranes, reduce the uptake of glucose and amino acids, and inhibit the growth of S. cerevisiae through induction of insufficient respiration[34], and its toxicity to cells becomes the main bottleneck to further increase its production. Generally, diploid strains of S.cerevisiae used for industrial production are more stress-resistant than laboratory strains and have excellent fermentation performance[35, 36]. Therefore, on the basis of industrial production strains with a certain 2-PE tolerance, the use of gene editing technology for precise modification of metabolic pathways is an effective strategy to further increase yield. In addition, the level of NADH in the cell reflects the redox level in the cell, which plays an important role in the growth and metabolism of the cell[37, 38], so the regeneration of the reducing power in the cell has also become an important method for regulating cell metabolism.

In the previous research of our group, we obtained 2-PE-producing diploid S. cerevisiae CWY-132 and realized industrial production. Through the optimization of medium composition, culture conditions and fermentation conversion process, the 2-PE level reached 3.98 g/L in shake flask[39] and 4.1 g/L in the small-scale fermentation tank[40]. This study established and optimized the CRISPR/CAS9 gene editing system of CWY-132 with 100% efficiency when manipulate Ehrlich pathway genes. This system was used for comparative study of the performances of genes manipulations related in 2-PE pathway in different production strains, and the effect of ATF1 gene knockout was reported for the first time. In addition, the effects of cell tolerance to 2-PE and the supply of NADH on 2-PE production were also discussed.

Construction of CRISPR/CAS9 system in industrial diploid S.cerevisiae

The CRISPR/CAS9 gene editing system of S.cerevisiae has been successfully established and applied, but the editing efficiency in industrial diploid strains is still not high. Stovicek et al. constructed the CRISPR/CAS9 system in industrial yeast, but the editing efficiency was only 65%~78%[30]. Therefore, it is necessary to greatly improve the gene editing efficiency of industrial S.cerevisiae strains.

The CRISPR/CAS9 system mainly includes three parts: sgRNA, Cas9 protein, and Donor DNA. The PAM site on the target gene is used as a guide mark. The sgRNA sequence can bind to the first 20bp of the PAM site, and then guide the Cas9 protein to cut this site. Then homologous recombination repair is performed through Donor DNA to achieve targeted editing of the target gene. In this paper, a high-efficiency CRISPR/CAS9 system was constructed in the industrial strain CWY132 of 2-PE, and it was found that the construction method of gRNA plasmid and the length of the Donor DNA homology arm affect the editing efficiency. Two strategies were used to construct gRNA plasmids(Fig. 2a). One was to amplify the gRNA plasmid backbone into three fragments containing homologous arms to make it homologous recombined into a new plasmid(program 1). Second, the complete gRNA plasmid was constructed in vitro by DPN I-mediated reverse PCR(program 2). The results show that the gRNA plasmid construction method shown in program 2 can greatly increase the transformation efficiency. The number of transformants is increased from zero to about hundreds in each plate. When constructing Donor DNA, ATF1 and ALD3 were used as the target genes to be knocked out, and homology arms of 60 bp, 100 bp, 500bp, and 1000 bp were set respectively. The results show that when the length of the homology arm was 60 bp, the target gene editing efficiency is 0, and when the length reached 500bp, the editing efficiency can reach 100% (Fig. 2b). In addition, the effect of different PAM sites on the system efficiency was also studied. When the homology arm length of Donor DNA is 500 bp, its knockout rate of ATF1 reached 100% at all the selected PAM sites.

In this research, we successfully constructed the CRISPR/CAS9 system in industrial diploid S.cerevisiae. The transformation efficiency was improved by optimized plasmid construction method, and the gene editing efficiency was significantly improved to and reached to 100% by increasing the length of the Donor DNA homology arm, and we also found that the PAM site does not affect the editing efficiency. This system with high gene editing efficiency could provide technical support for genetic manipulation in the industrial S.cerevisiae strain.

The effect of knocking out ALD2, ALD3, ATF1 on the 2-PE and ethanol production of different strains

2-PE synthesis was shunted to branch pathways in S.cerevisiae (Fig. 1). The 2-PE-producing industrial diploid S.cerevisiae strain CWY-132 and the laboratory haploid strain PK2-C were used to analyze the function of the branch pathway acetaldehyde dehydrogenase gene ALD2、ALD3 and acetyltransferase gene ATF1 of the 2-PE metabolic pathway. By using CRISPR/CAS9 technology, the above genes were single knocked out, double knocked out and overexpressed to see their changes in 2-PE and ethanol production. The knockout efficiency of these genes has reached 100%, further verifying the high efficiency of this gene editing system we established.

The 2-PE and ethanol yields of wild-type and gene-edited mutant strains were tested to study the functions and interaction effects of different genes. 5g/L L-Phe was used as a substrate for fermentation culture, and the supernatant was taken after 36 h of continuous fermentation to detect its 2-PE and ethanol content. The results showed that when inhibiting the branching pathway of acetaldehyde dehydrogenase, in the CWY-132 strain, the 2-PE yields of ALD2∆ and ALD3∆ strains were 3.02 g/L and 2.93 g/L, respectively, which were compared with 3.5 g/L of the wild type, it dropped by 14%. The 2-PE yield of the ALD2∆ALD3∆ strain was 1.65 g/L, which was about 52.8% lower than that of the wild type (Fig. 3a); In the haploid laboratory strain PK2-C, the 2-PE yields of ALD2∆ and ALD3∆ strains were 1.20g/L and 0.34g/L, respectively, which increased by about 471% and 62% respectively compared with the wild type (Fig. 3b). When inhibiting the downstream acetyltransferase gene ATF1 of 2-PE synthesis, the 2-PE yields of ATF1∆ and ATF1∆ALD3∆ of CWY-132 strain were 0.83g/L and 0.85g/L, respectively, compared with the wild type, it is reduced by about 76% (Fig. 3a). The 2-PE yield of the ATF1∆ strain of PK2-C was 0.45 g/L, which was 114% higher than the wild-type yield of 0.21 g/L (Fig. 3b).

2-PE is toxic to S.cerevisiae cells, and the combined action of ethanol can enhance the inhibition effect on the growth[34].The ethanol production of each strain was also tested and found that in CWY-132, the ALD2∆ and ALD3∆ strains were close to the wild type, and the ALD2∆ALD3∆ strain increased by about 45% compared with the wild type. In ATF1∆ and ATF1∆ALD3∆ strains, the ethanol production increased by 128% and 146% ,respectively, compared with the wild-type strain (Fig. 3a); Among the PK2-C strains, the ethanol production in ALD2∆ and ALD3∆ strains are close to the wild type, and the ATF1∆ strain is about 30% higher than the wild type (Fig. 3b). In the CWY-132 strains with overexpression of ALD3 or ATF1, the production of 2-PE and ethanol decreased slightly (Fig. 3c).

These results demonstrate that the blocking of branch pathways in the 2-PE high-yielding industrial strain CWY-132 failed to increase the 2-PE production, on the contrary, the yield decreased. ATF1∆ and the double mutant strains ALD2∆ALD3∆ and ATF1∆ALD3∆ decreased more significantly. To investigate these unexpected results, the low-yielding strain PK2-C was used for further study. The results showed that the yield of 2-PE increased when these genes was knocked out, which was consistent with the results of reported studies. For example, Bosu Kim et al. found that the 2-PE yield of haploid laboratory S.cerevisiae strain W303 that knocked out ALD3 and ALD2 was 35% higher than that of wild type[1]. These results prove that in the regulation of 2-PE biosynthesis, by blocking the branch pathway and downstream product synthase, the effect is different in strains with different yield backgrounds.

The knock-out effect on the synthase acetyltransferase of the downstream substance of 2-PE is more obvious. In the CWY-132 strain of ATF1 gene deletion, its colony on the plate is smaller and grow more slowly in liquid media when compared with the wild-type strain (Fig. 4a 4b), and the 2-PE production is greatly reduced, indicating that ATF1 involved in yeast growth and plays a crucial role in regulation of 2-PE catalytic conversion. Studies by other groups have shown that the acetyltransferase encoded by S.cerevisiae ATF1 is a key enzyme in acetate synthesis[41],and deletion or overexpression of ATF1 will significantly affect the production of alcohols and acetates[42, 43].

The synthesis level of alcohols in S.cerevisiae is related, and the yeast performs coordinated regulation. The results of this study show that in different strains of relatively high-yield of 2-PE, the increase or decrease of 2-PE production is often accompanied by corresponding changes in ethanol, and the trend is generally opposite. For example, in the CWY-132 strain, the 2-PE dropped significantly after the ATF1 gene was knocked out, while the ethanol increased significantly. The ALD2∆ALD3∆ strain also has a similar situation. However, this phenomenon did not occur in the low-yield haploid strain PK-2C, indicating that yeast cells have global regulation of the total alcohols stress substances in the cell to reduce cytotoxicity.

The effect of initial L-Phe concentration, correlation between 2-PE and ethanol, and NADH on 2-PE production

With CWY-132 as the starting strain, the initial addition amount of L-Phe was set at 0.1g/L, 1g/L, 3g/L and 5g/L. The 2-PE production of different engineered yeast strains under L-Phe concentrations was studied. The result showed that the 2-PE production of ALD2∆, ALD3∆ and ALD2∆ALD3∆ strains increased by 20%, 23% and 29% respectively under the substrate of 1g/L L-Phe (Fig. 5a). When L-Phe concentration was increased to 3g/L, the 2-PE decreased compared with the wild type (Fig. 5a). In particular, the ALD2∆ALD3∆ strain reduced the 2-PE production by nearly 50% under the 5g/L L-Phe substrate (Fig. 5a). However, the 2-PE production of ATF1∆ and ATF1∆ALD3∆ strains at the addition of 1g/L, 3g/L and 5g/L L-Phe substrate has been at a very low level (Fig. 5a).

It can be seen from the metabolic pathway (Fig. 1) that there is a certain connection between the ethanol and the 2-PE metabolic pathway. Ethanol can be converted into ethyl acetate catalyzed by acetyltransferase, and acetaldehyde can be converted into acetic acid by acetaldehyde dehydrogenase. Therefore, when these two enzymes are knocked out, the ethanol content is greatly increased. The results of L-Phe addition study further verified that the production of 2-PE and ethanol are always in a negative correlation (Fig. 5b 5c). On the basis of the ALD2∆ALD3∆ strain, the pyruvate decarboxylase PDC1 in the ethanol metabolism pathway was further knocked out, and the result found that ethanol production decreased significantly, while 2-PE production increased by 50% (Fig. 3a). These results further indicate that 2-PE is in competition with ethanol synthesis, and the increase in ethanol production will lead to a decrease in 2-PE production. The initial 2-PE yield of strain CWY-132 reached 3.4 g/L, and the tolerance of this strain to 2-PE on the plate was also 3.4 g/L (Fig. 6a). The dual toxicity of ethanol and 2-PE to the strain further damages the viability of the strain, which in turn affects the yield of 2-PE.

Study has shown that glutathione (GSH) can enhance the tolerance of Candida glycerinogenes to 2-PE[44]. In order to verify that increasing the 2-PE tolerance of S. cerevisiae can increase the yield, the addition of 0.1 mM GSH to the culture media increased the tolerance of CWY-132 to 2-PE from 3.4 g/L to 3.6 g/L (Fig. 6a). Adding 0.1 mM GSH during the fermentation process can increase the production of 2-PE by about 10% in the WT, ALD2∆, and ALD3∆ of CWY-132 (Fig. 6b). The result suggests that the toxic effect of 2-PE is a key limiting factor affecting the further increase of 2-PE production.

The growth of CWY-132 mutants and wild type was compared. The growth curve measurement and YPD plate streaking culture results showed that the growth of the ATF1∆ strain and the ALD3∆ATF1∆ strain was more weakened compared with the wild type, and the biomass was significantly reduced. The growth of ALD2∆ or ALD3∆ strain showed no significant changes, but the biomass of ALD2∆ALD3∆ strain decreased (Fig. 4a 4b). The growth and biomass of PK2-C mutant strains did not change (Fig. 4c 4d). These results indicate that blocking the branch pathways in the 2-PE synthesis pathway, especially the terminal shunt pathway, has an inhibitory effect on the growth of industrial diploid S. cerevisiae with high production of 2-PE.

The redox level reflects some metabolic activities related to cell growth and biosynthesis, and controls cell metabolism. The levels of NAD⁺ and NADH are key indicators of redox status[38]. When the production of ethanol increases, it can oxidize NADH in the cell and break the balance of NADH/NAD⁺ in the cell [37, 45], resulting in slow cell growth and further affecting the production of 2-PE. Measurement of the NADH content in different strains constructed, we found that the NADH content of the ALD2∆ALD3∆, ATF1∆ and ATF1∆ALD3∆ strains all decreased by 10%-15% compared with the wild type (Fig. 6c). After 2g/L NAD⁺ was added to the fermentation process, the 2-PE yield increased by 10% (Fig. 6b). Therefore we speculated that the metabolism of ethanol and 2-PE in S.cerevisiae strains have something in common. The blocking of the 2-PE synthesis branch pathway leads to an increase in ethanol production, which in turn leads to an imbalance between NADH/NAD⁺ in the cell. Dysregulation causes weakened cell growth, which in turn reduces 2-PE production.

These results indicate that strains with different yield backgrounds should be optimized for the amount of substrate L-Phe. For strains that require a higher concentration of L-Phe, the 2-PE yield cannot be increased or even decreased after knocking out the shunted genes. The results also indicate that ethanol and 2-PE exert dual toxicity to S. cerevisiae, which suggests that the overcome of the low tolerance of strain to 2-PE is a key problem. Construction of tolerance improved strains could be an effective strategy in further increasing the production of 2-PE. In addition, redox state should also be considered to improve the supply of NAD⁺.

In this study, a CRISPR/CAS9 gene editing system was constructed in the diploid S.cerevisiae that produces 2-PE, and the editing efficiency reached 100% after optimization. When using this system to knock out the branch pathway of the Ehrlich pathway related genes of the 2-PE synthesis of different strains, it is found that the effect is quite different in different strains. The production of 2-PE decreased in the industrial strains, while increased in the low-yielding haploid laboratory strains due to the blocking of the branching pathway. These results suggest that the future application of gene editing strategies to improve the production of S.cerevisiae 2-PE should fully consider the strain background. In addition, the dual toxicity of 2-PE and ethanol to S.cerevisiae is an important obstacle to the continued synthesis of 2-PE. Enhancing the strain's tolerance to 2-PE is effective strategy in future for 2-PE strain improvement and production. Moreover, it is also necessary to comprehensively consider the supply of the cell NADH/NAD⁺ in catalytic conversion for the 2-PE synthesis. This study deepened the understanding of the regulation of 2-PE synthesis by S.cerevisiae, and provided strategies and references for further development of new strategies for high-yield strain breeding.

Yeast strains and culture conditions

The S. cerevisiae strains used in this study are shown in Table 1. S. cerevisiae CWY-132 was a industrial strain. Yeast strains were cultured at a constant temperature of 30°C in a complete medium YPD (1% yeast extract, 2% peptone, 2% glucose, if making a solid medium, add 2% agar powder). The overnight cultured seed culture solution was inoculated into the fermentation medium (5g/L L-phenylalanine ,30g/L glucose, 0.5g/L magnesium sulfate, 5g/L potassium dihydrogen phosphate, 1.5g/L yeast extract) at cell densities of 10⁷ cells/mL, and the filling amount was 50mL/250mL, and the fermentation was continued for 36 h at 30°C and 200 rpm.

E. coli cells were grown in Luria–Bertani medium (0.5% yeast extract, 1% tryptone and 1% NaCl) supplemented with 100 μg/mL ampicillin at 37°C to select positive transformants.

2-PE tolerance determination

The tolerance of 2-PE was analyzed by dilution gradient plate method. Dilute the exponentially growing S.cerevisiae cells to 10⁷ cells/ml, and then spot 5 μL of 10-fold serial cell dilution on solid YPD plates containing 3.2 g/L, 3.4 g/L, and 3.6 g/L 2-PE. Cultivate at a constant temperature of 30°C.

Construction of CRISPR/CAS9 system

All plasmids used in this study are shown in Table 1, and primers are shown in Table 2. The Cas9 plasmid was transformed into S. cerevisiae CWY-132 and PK2-C respectively, and then the transformants containing the Cas9 plasmid were re-used as the starting strain for the next step of gene manipulation. The PAM site is obtained through the website http://yeastriction.tnw.tudelft.nl . The gRNA plasmids used in this study were obtained by inverse PCR (Fig. 2a). Take the construction of gRNA plasmids when ALD3 is knocked out as an example. Using the original gRNA plasmids as templates, PCR was performed with primers ALD3 g-F and ALD3 g-R. The resulting PCR reaction solution was subjected to template elimination treatment with Dpn I enzyme, and then transformed into E. coli Dh5α after DNA purification, and cultured in selective medium overnight. The obtained plasmid was confirmed by sequencing and used for transformation. The other gRNA plasmids are obtained in the same way. When constructing DONOR DNA, homology arm lengths of 60 bp, 100 bp, 500 bp, and 1000 bp were set respectively. The fragments of 60 bp and 100 bp homology arm length were chemically synthesized, and the homology arm lengths of 500 bp and 1000 bp were obtained by overlap extension PCR. Take the 500bp Donor DNA homology arm of ALD3 gene as an example. First, the wild-type S.cerevisiae genome was used as a template, and the two homologous arm fragments on the left and right were amplified with primer pairs ALD3 L500-F, ALD3 L-R and ALD3 R-F, ALD3 R500-R, respectively. The fragment obtained is recovered and purified by gel and used as a template again. The primers ALD3 L500-F and ALD3 R500-R are used for another round of overlap extension PCR to connect to complete Donor DNA (Fig. 7a). Subsequently, the constructed donor DNA and gRNA plasmid were co-transformed into S.cerevisiae strains containing Cas9, positive transformants on dual antibiotic plates containing hygromycin and G418 were selected. The gene deletion or integration in transformants was determined by PCR. The general operation flow of the CRISPR/CAS9 system is shown in Fig 7b.

Yeast transformation

The plasmids and DNA fragments were transformed into yeast cells by the PEG/lithium acetate method[46]. Transformed yeasts were cultured in YPD medium supplemented with 40 μg/mL G418 sulfate and 80 μg/mL hygromycin for selection.

Analytical method for 2-PE

Take out 1mL of fermentation broth, 10000 r/min, centrifuge for 10 minutes, take the supernatant liquid and analyze by gas chromatography(GC). Sample pretreatment: add 200 uL internal standard solution (methyl isobutyl methanol 1 g/L aqueous solution) to the supernatant, add 500uL ethyl acetate, shake and mix, centrifuge at 5000 rpm/min for 1 min, take the upper organic phase perform testing. Standard curve preparation: prepare 0.5, 1.0, 5.0, 10.0 g/L of 2-phenylethanol aqueous solution of standard concentration, and treat as above. The determination conditions for analyzing the concentration of 2-PE in the fermentation broth by GC are: Shimadzu GC2014 gas chromatograph; FID detector; column Rtx-1 (30m*0.25mm*0.25um, Restek); carrier gas is nitrogen; split flow; The split ratio is 49.0; the column flow rate is 1.45 mL/min; the purge flow rate is 3 mL/min; the temperature of detector is 250°C; the oven is maintained at 80°C for 1 min, and then increased to 200°C by 20°C/min; the sample volume is 1 uL.

NADH detection

The double antibody sandwich method was used to determine the level of microbial nicotinamide adenine dinucleotide (NADH) in S.cerevisiae. Collect the cells through centrifuge and discard the supernatant. The ratio of extract solution (volume) to cell number (10⁴ cells) was 500:1. The cells are broken by ultrasound (ice bath, 200W, ultrasound 3s, repeat 30 times at an interval of 10s), centrifuge at 8000g for 10 min at 4°C, take the supernatant, and put it on ice for testing. Coat the microwell plate with purified microbial NADH antibody to make solid phase antibody, and add NADH to the micro-wells of the coated monoclonal antibody in sequence, and then combined with HRP-labeled NADH antibody to form an antibody-antigen-enzyme-labeled antibody complex. After thorough washing, the substrate TMB is added for color development. TMB is converted into blue under the catalysis of HRP enzyme and into the final yellow under the action of acid. The color intensity is positively correlated with the microbial nicotinamide adenine dinucleotide (NADH) in the sample. The absorbance (OD value) was measured with a microplate reader at a wavelength of 450 nm, and the concentration of microbial nicotinamide adenine dinucleotide (NADH) in the sample was calculated from the standard curve.

Plasmid elimination

In this study, the elimination of gRNA plasmid and Cas9 plasmid was achieved by passage. The initial yeast was cultured overnight in 5 mL YPD liquid without any antibiotics, and then passaged every 12h. After fifth Generation, the plasmid elimination rate can reach more than 90%.

Ethics approval and consent to participate

Not applicable

Consent for publication

Informed consent for publication was obtained from all participants.

Availability of data and materials

All data generated or analyzed during this study are included in this article.

Competing interests

No competing interests.

Funding

This work was supported by the National Natural Science Foundation of China (NSFC 81873128)

Authors' contributions

Zhiwei Xu, Constructed the CRISPR/Cas9 system, carried out the gene editing. Zhe Chen, provided the CRISPR/Cas9 system gene editing guide and design. Lucheng Lin, carried out the 2-PE fermentation.Kun Wang, conducted 2-PE analysis. Jie Sun and Tingheng Zhu, conducted the whole study project and results analysis. All authors commented on the manu-script. All authors read and approved the final manuscript.

Acknowledgements

This work was supported by the National Natural Science Foundation of China (NSFC 81873128)

Kim B, Cho BR, Hahn JS. Metabolic engineering of Saccharomyces cerevisiae for the production of 2-phenylethanol via Ehrlich pathway. Biotechnol Bioeng. 2014;111(1):115–24.
Machas MS, McKenna R, Nielsen DR. Expanding Upon Styrene Biosynthesis to Engineer a Novel Route to 2-Phenylethanol. Biotechnol J, 2017. 12(10).
Scognamiglio J, et al. Fragrance material review on phenylethyl alcohol. Food Chem Toxicol. 2012;50(Suppl 2):S224-39.
Chreptowicz K, et al. Production of natural 2-phenylethanol: From biotransformation to purified product. Food Bioprod Process. 2016;100:275–81.
Etschmann MM, et al. Biotechnological production of 2-phenylethanol. Appl Microbiol Biotechnol. 2002;59(1):1–8.
Chen X, Wang Z, He X. [Advances in biosynthesis of 2-phenylethanol by yeasts]. Sheng Wu Gong Cheng Xue Bao. 2016;32(9):1151–63.
Xu P, Hua D, Ma C. Microbial transformation of propenylbenzenes for natural flavour production. Trends Biotechnol. 2007;25(12):571–6.
Kovacheva N, Rusanov K, Atanassov I, Industrial Cultivation of Oil Bearing Rose and Rose Oil Production in Bulgaria During 21ST Century, Directions and Challenges. Biotechnology & Biotechnological Equipment, 2010. 24(2): p. 1793–1798.
Hua D, Xu P. Recent advances in biotechnological production of 2-phenylethanol. Biotechnol Adv. 2011;29(6):654–60.
Li M, et al. CRISPR-mediated multigene integration enables Shikimate pathway refactoring for enhanced 2-phenylethanol biosynthesis in Kluyveromyces marxianus. Biotechnol Biofuels. 2021;14(1):3.
Mei J, Min H, Lü Z. Enhanced biotransformation of l-phenylalanine to 2-phenylethanol using an in situ product adsorption technique. Process Biochem. 2009;44(8):886–90.
Wang Y, et al. Advances in 2-phenylethanol production from engineered microorganisms. Biotechnol Adv. 2019;37(3):403–9.
Yin S, et al. Improving 2-phenylethanol production via Ehrlich pathway using genetic engineered Saccharomyces cerevisiae strains. Curr Microbiol. 2015;70(5):762–7.
Martínez-Avila O, et al. 2-phenylethanol (rose aroma) production potential of an isolated pichia kudriavzevii through solid-state fermentation. Process Biochem. 2020;93:94–103.
Bialecka-Florjanczyk E, et al. Synthesis of 2-phenylethyl acetate in the presence of Yarrowia lipolytica KKP 379 biomass. Journal of Molecular Catalysis B-Enzymatic. 2012;74(3–4):241–5.
Hassing EJ, et al. Connecting central carbon and aromatic amino acid metabolisms to improve de novo 2-phenylethanol production in Saccharomyces cerevisiae. Metab Eng. 2019;56:165–80.
Eshkol N, et al. Production of 2-phenylethanol from L-phenylalanine by a stress tolerant Saccharomyces cerevisiae strain. J Appl Microbiol. 2009;106(2):534–42.
Carmona M, et al. Anaerobic catabolism of aromatic compounds: a genetic and genomic view. Microbiol Mol Biol Rev. 2009;73(1):71–133.
Hazelwood LA, et al. The Ehrlich pathway for fusel alcohol production: a century of research on Saccharomyces cerevisiae metabolism. Appl Environ Microbiol. 2008;74(8):2259–66.
Gu Y, et al. Refactoring Ehrlich Pathway for High-Yield 2-Phenylethanol Production in Yarrowia lipolytica. ACS Synth Biol. 2020;9(3):623–33.
Saenz DA, Chianelli MS, Stella CA. L-Phenylalanine Transport in Saccharomyces cerevisiae: Participation of GAP1, BAP2, and AGP1. J Amino Acids. 2014;2014:283962.
Wang Z, et al. Reconstruction of metabolic module with improved promoter strength increases the productivity of 2-phenylethanol in Saccharomyces cerevisiae. Microb Cell Fact. 2018;17(1):60.
Styger G, Jacobson D, Bauer FF. Identifying genes that impact on aroma profiles produced by Saccharomyces cerevisiae and the production of higher alcohols. Appl Microbiol Biotechnol. 2011;91(3):713–30.
Hohmann S, Meacock PA. Thiamin metabolism and thiamin diphosphate-dependent enzymes in the yeast Saccharomyces cerevisiae: genetic regulation. Biochimica Et Biophysica Acta-Protein Structure and Molecular Enzymology, 1998. 1385(2): p. 201–219.
Vuralhan Z, et al. Physiological characterization of the ARO10-dependent, broad-substrate-specificity 2-oxo acid decarboxylase activity of Saccharomyces cerevisiae. Appl Environ Microbiol. 2005;71(6):3276–84.
Wittmann C, Hans M, Bluemke W. Metabolic physiology of aroma-producing Kluyveromyces marxianus. Yeast. 2002;19(15):1351–63.
Martinez-Avila O, et al. Bioprocesses for 2-phenylethanol and 2-phenylethyl acetate production: current state and perspectives. Appl Microbiol Biotechnol. 2018;102(23):9991–10004.
Pigeau GM, Inglis DL. Response of wine yeast (Saccharomyces cerevisiae) aldehyde dehydrogenases to acetaldehyde stress during Icewine fermentation. J Appl Microbiol. 2007;103(5):1576–86.
Wang Y, et al. Genetic engineering of an industrial yeast Candida glycerinogenes for efficient production of 2-phenylethanol. Appl Microbiol Biotechnol. 2020;104(24):10481–91.
Stovicek B, Forster. CRISPR-Cas system enables fast and simple genome editing of industrial Saccharomyces cerevisiae strains. Metabolic Engineering Communication. 2015;10:13–22.
Mans R, et al., CRISPR/Cas9: a molecular Swiss army knife for simultaneous introduction of multiple genetic modifications in Saccharomyces cerevisiae. FEMS Yeast Res, 2015. 15(2).
Bao Z, et al. Homology-integrated CRISPR-Cas (HI-CRISPR) system for one-step multigene disruption in Saccharomyces cerevisiae. ACS Synth Biol. 2015;4(5):585–94.
DiCarlo JE, et al. Genome engineering in Saccharomyces cerevisiae using CRISPR-Cas systems. Nucleic Acids Res. 2013;41(7):4336–43.
Stark D, et al. Inhibition aspects of the bioconversion of L-phenylalanine to 2-phenylethanol by Saccharomyces cerevisiae. Enzyme Microbial Technology. 2003;32(2):212–23.
Matsushika A, Goshima T, Hoshino T. Transcription analysis of recombinant industrial and laboratory Saccharomyces cerevisiae strains reveals the molecular basis for fermentation of glucose and xylose. Microbial Cell Factories, 2014. 13.
Matsushika A, et al. Bioethanol production performance of five recombinant strains of laboratory and industrial xylose-fermenting Saccharomyces cerevisiae. Bioresour Technol. 2009;100(8):2392–8.
Rigoulet M, et al. Organization and regulation of the cytosolic NADH metabolism in the yeast Saccharomyces cerevisiae. Mol Cell Biochem. 2004;256(1–2):73–81.
Bakker BM, et al. Stoichiometry and compartmentation of NADH metabolism in Saccharomyces cerevisiae. Fems Microbiology Reviews. 2001;25(1):15–37.
Cui Zhifeng SQ, Yang Xiao C, Zhibo W, Kun, Optimization of the Medium and Conditions for the Production of 2-phenylethanol by Yeast. FOOD AND FERMENTATION INDUSTRIES, 2008. 08: p. 52–55.
Zhifeng, WKS.Q.W.X.Z.T.C., Studies on the Biotransformation Processes for 2-phenylethanol Production by Saccharomyces cerevisiae CWY132 in Small Fermentor Test. FOOD AND FERMENTATION INDUSTRIES, 2009. 106: p. 534 -542.
Zhu J, et al. Microbial host selection affects intracellular localization and activity of alcohol-O-acetyltransferase. Microb Cell Fact. 2015;14:35.
Hirosawa I, et al. Construction of a self-cloning sake yeast that overexpresses alcohol acetyltransferase gene by a two-step gene replacement protocol. Appl Microbiol Biotechnol. 2004;65(1):68–73.
Lilly M, et al. The effect of increased yeast alcohol acetyltransferase and esterase activity on the flavour profiles of wine and distillates. Yeast. 2006;23(9):641–59.
Wang Y, et al. Transcription factor Hap5 induces gsh2 expression to enhance 2-phenylethanol tolerance and production in an industrial yeast Candida glycerinogenes. Appl Microbiol Biotechnol. 2020;104(9):4093–107.
Franzen CJ. Metabolic flux analysis of RQ-controlled microaerobic ethanol production by Saccharomyces cerevisiae. Yeast. 2003;20(2):117–32.
Gietz RD, Woods RA. Transformation of yeast by lithium acetate/single-stranded carrier DNA/polyethylene glycol method, Guide to Yeast Genetics and Molecular and Cell Biology, Pt B, C. Guthrie and G.R. Fink, Editors. 2002, Elsevier Academic Press Inc: San Diego. pp. 87–96.

Table 1. Strains and plasmids used in this study

Strains and plasmids	Relevant genotype	Origin
Saccharomyces cerevisiae
CWY-132	Diploid yeast strain	This lab
CWY-133	Diploid yeast strain, ALD2∆	This study
CWY-134	Diploid yeast strain, ALD3∆	This study
CWY-135 CWY-136 CWY-137 CWY-138 CWY-139 CWY-140 CWY-141 PK2-C PK2-C2 PK2-C3 PK2-C4 Escherichia coli DH5α Plasmids Cas9 gRNA ALD2- gRNA ALD3- gRNA ATF1- gRNA PDC1- gRNA	Diploid yeast strain, ALD2∆, ALD3∆ Diploid yeast strain, ATF1∆ Diploid yeast strain, ATF1∆,ALD3∆ Diploid yeast strain, PDC1∆ Diploid yeast strain, ALD2∆, ALD3∆， PDC1∆ Diploid yeast strain，Overexpression ALD3 Diploid yeast strain，Overexpression ATF1 Haploid yeast strain，MATα MATα, ALD2∆ MATα, ALD3∆ MATα, ATF1∆ Φ80 lacZΔM15 ΔlacU169 recA1 endA1 hsdR17 supE44 thi-1 gyrA relA1 KanR;f1 ori with P_TEF1,P_T3,P_AmpR; AmpR ;P_T3-CAS9-T_CYC1; HygR；2μori with P_TEF1,P_T3,P_AmpR_；AmpR; P_SNR52-sgRNA-T_SUP4 gRNA plasmid carrying ALD2 sgRNA gRNA plasmid carrying ALD3 sgRNA gRNA plasmid carrying ATF1 sgRNA gRNA plasmid carrying PDC1 sgRNA	This study This study This study This study This study This study This study This lab This study This study This study This lab This lab This lab This study This study This study This study

Table 2. Primers used in this study

Primer name	Sequence（5’-3’）
Primers for plasmid construction ALD3 g-F		AGAACTTACAAGATACTATGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAG
ALD3 g-R		CATAGTATCTTGTAAGTTCTGATCATTTATCTTTCACTGCGGAGA
ALD2 g-F		TTCAAATGCCAAAGGTGATTGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAG
ALD2 g-R		AATCACCTTTGGCATTTGAAGATCATTTATCTTTCACTGCGGAGA
ATF1 g1-F		CAAATATTCTATATGCGATTGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAG
ATF1 g1-R		AATCGCATATAGAATATTTGGATCATTTATCTTTCACTGCGGAGA
ATF1 g2-F		CTCCGTTTTTACATGTTTGTGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAG
ATF1 g2-R		ACAAACATGTAAAAACGGAGGATCATTTATCTTTCACTGCGGAGA
ATF1 g3-F		TCAAACCATTGAACTTCGAAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAG
ATF1 g3-R		TTCGAAGTTCAATGGTTTGAGATCATTTATCTTTCACTGCGGAGA
ATF1 g4-F		AAGTCTATCACCTTTTCGATGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAG
ATF1 g4-R		ATCGAAAAGGTGATAGACTTGATCATTTATCTTTCACTGCGGAGA
ATF1 g5-F		CATTCTGAATCATCTCTTTCGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAG
ATF1 g5-R		GAAAGAGATGATTCAGAATGGATCATTTATCTTTCACTGCGGAGA
PDC1 g-F		GGAAGTCATTGACACCATCTGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAG
PDC1 g-R		AGATGGTGTCAATGACTTCCGATCATTTATCTTTCACTGCGGAGA
Primers for Donor DNA construction
ALD3 L1000-F		AGGATGAGATATTTGGCCCGGTTGT
ALD3 L500-F		AGAGCTATAAACTCAGTGAGATTTA
ALD3 L-R		AACATTTATATAACTATGTAACGAATTTTCTTTTGGCTAATTTTCTAAAT
ALD3 R-F		ATTTAGAAAATTAGCCAAAAGAAAATTCGTTACATAGTTATATAAATGTT
ALD3 R500-R ALD3 R1000-R ALD2 L-F ALD2 L-R ALD2 R-F ALD2 R -R ATF1 L500-F ATF1 L1000-F ATF1 L-R ATF1 R-F ATF1 R500 -R ATF1 R1000-R PDC1 L-F PDC1 L-R PDC1 R-F		TCCAAAACATACATTCTTCAGTATC CACATGAAAATTTTTAAAGGTATGG GCTACCTCTTAATGTGTCACAAG CTTACATAATGATAACTATCACATTTTCTTTTGGCTTATTTTCACG CGTGAAAATAAGCCAAAAGAAAATGTGATAGTTATCATTATGTAAG TTACTAATTCCTTAACCCTTAGG CTGACACCCGGATAATTAAGAAGTG TGGTATAATCAAGCGTATTTAGAAG ATATCAGTCAAGCATCATGTGAGATGAGAGCTGATAAATTGATGGTATTT AAATACCATCAATTTATCAGCTCTCATCTCACATGATGCTTGACTGATAT GCATTTGTTTGTAGCTTTGCATTG ATAGCATGCTCCTATTATAGATGTG GTATGCTCTTCTGACTTTTCGTG AACTAATAATTAGAGATTAAATCGCTTTTGATTGATTTGACTGTGTTA TAACACAGTCAAATCAATCAAAAGCGATTTAATCTCTAATTATTAGTT
PDC1 R -R		GAAATCAGCTTGTGGGTATTGTTC

PDF

Version 1

posted 01 Apr, 2021

You are reading this latest preprint version

Construction of CRISPR/CAS9 system for industrial Saccharomyces cerevisiae strain and genetic manipulation effect on 2-phenylethanol pathway

Status:

Version 1

Abstract

Background

Results

Conclusions

Figures

Background

Results And Discussion

Conclusions

Materials And Methods

Declarations

References

Tables

Status:

Version 1