Histopathological tissue alterations of targeted organs of ornamental goldfish, Carassius auratus in India caused by a new pathogenic bacterial strain, Bacillus licheniformis PKBMS 16 identified on the basis of morpho- biochemical and 16S rDNA characterization

doi:10.21203/rs.3.rs-3647134/v1

Download PDF

Research Article

Histopathological tissue alterations of targeted organs of ornamental goldfish, Carassius auratus in India caused by a new pathogenic bacterial strain, Bacillus licheniformis PKBMS 16 identified on the basis of morpho- biochemical and 16S rDNA characterization

https://doi.org/10.21203/rs.3.rs-3647134/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

A highly pathogenic ampicillin-resistant bacteria Bacillus licheniformis have been identified from liver and kidney of symptomatic Goldfish Carassius auratus L. of India which may lead to a huge loss in the production of goldfish. Molecular characterization of the bacteria confirms its morphological and biochemical evidence. Phylogenetic analysis of the 16S rRNA gene sequence indicates Bacillus licheniformis PKBMS₁₆ (KX235179) was most similar to those of Bacillus licheniformis, strain B3 (HM030741.1, 99%) and was placed highest bootstrap value. The pathogenic effect of the bacteria, Bacillus licheniformis PKBMS₁₆ with a dose of 1.0 x 10⁵ CFU/ml after 10 and 20 days of post-infection has been found to induce significant changes in histological, hematological, and serum biochemical parameters in the experimental group. Histologically, the internal organs, mainly the liver and kidney are severely damaged which may be the target organ for this isolated bacteria. The results on Bacillus licheniformis causing Bacilliosis in ornamental are worthy and significant because no reports on the in vivo pathogenicity of Bacillus species are available yet. However, this is the first reported episode from India, and it is reasonable to believe that in the experimental challenge, this bacterium produced a systemic pathology in terms of histological and hemato-biochemical alteration in Carassius auratus similar to many other known fish pathogens.

Carassius auratus

Bacillus licheniformis

PKBMS16

16S rRNA

Histopathology

Bacterial diseases are considered the main cause of high mortalities resulting in economic losses in the aquaculture industry. The major pathogens of ornamental fish are Gram-negative bacteria including Aeromonas sp. and Pseudomonas sp. which contributes to their pathogenicity to the fish (Austin and Austin 1993; Biradar et al. 2007).

Many species of Bacillus have been established as bacterial pathogens of fish. Bacillus cereus, found to be present on the necrotic gills of common carp, Cyprinus carpio (Pychynski et al. 1981) produces toxins that cause disseminated intravascular coagulation (Burdon et al. 1967). Bacillus mycoides, established as a bacterial pathogen of channel catfish in Alabama, can cause lesions in fish muscle without interaction with other pathogens (Goodwin et al. 1994). The cloudy eye is a common bacteria-borne disease that may lead to blindness in the case of ornamental fish mainly caused by Bacillus bacteria (Azmi et al. 2014; Gurinovich and Titok 2023). The Bacillus has the protease enzyme and it may produce some exoprotein which may take part in the pathogenicity of the goldfish. Bacillus licheniformis is considered to be an opportunistic pathogen mainly infecting immune-suppressed or severely debilitated individuals, or infections occur as sequelae to trauma or surgical procedures (Boer et al. 1994).

In the present study, the fish collected showed severe ulceration and fin erosion, from which a highly pathogenic bacteria, Bacillus licheniformis has been isolated from Goldfish, C. auratus L. which may lead to huge production loss in the ornamental fish industry. The sequencing of complete genomes of pathogens has become routine work in search of improved methods for the diagnosis of fish diseases. This rapid change in taxonomy and back-end identification libraries of the first-line identification method needs constant updates. Based on morphological, biochemical, 16SrRNA sequencing, and restriction mapping along with identification of the pathogenic genes database, the identification up to species level of isolated bacterial strain has been done in the present study.

Histopathological changes have been widely used as biomarkers in the evaluation of the health of fish exposed to contaminants (Goodwin et al. 1994). During the study, we identified a new strain of Bacillus licheniformis and observed that fish injected with this bacterium developed kidney and liver lesions. Therefore, this communication reports the severity of infection in the host body through histopathological alteration due to Bacillus infection. Furthermore, this may result in large-scale target tissue alteration and host susceptibility which has also been presented in this paper. This report of bacterial infection in India from goldfish collected from ornamental fish farms also aims to extend our knowledge of the diversity and distribution of Bacillus.

Sampling

Matured goldfish (C. auratus) with an average body weight of 19.25 ± 0.54 gm and length of 10–12 cm has been used for experimental purposes. During the period of March 2016 - October 2021, around thirty fish farms, belonging to different districts of West Bengal, India, namely Nadia (23.4710⁰N, 88.5565⁰E), Hooghly (22.8963⁰N, 88.2461⁰E), Howrah (22.5958⁰N, 88.2636⁰E), Kolkata (22.5726⁰N, 88.3639⁰E), South 24 Parganas (22.1352⁰N, 88.4016⁰E) and North 24 Parganas (22.6168⁰N, 88.4029⁰E) have been surveyed and 200 fish specimens were collected. At the site, the behavioural abnormalities, and gross and clinical signs of diseased Carassius auratus were recorded. Morbid C. auratus with typical disease symptoms (n = 185) and also apparently healthy (n = 15) were brought to the laboratory in oxygen-filled polythene bags separately for bacteriological analysis. Afterward, the infected fishes were kept in several aerated covered glass aquaria of 20 L. capacities at (23.5⁰C˗28.1⁰C) 26.6⁰C, pH (6.5 ˗ 7.1) 6.9 with dissolved oxygen 6.0–7.8 mg/L in the Parasitology laboratory, University of Kalyani.

Methods for isolation and culture of bacterial strains

The infected organs (Liver and Kidney) were homogenized and the homogenates were kept in overnight growth culture in Nutrient Broth (HiMedia). Primary isolation has been made by the pour culture method in nutrient agar and Hi chrome Bacillus Agar (HiMedia). Moderate and heavy growth were obtained at 10 ˗ 20⁰C. The pathogenic colonies were isolated from the pour plate method and identified both phenotypically and genotypically. The identified strain was maintained, preserved, and stored in pure culture form. The predominant bacterial colonies were subjected to scanning electron microscopic study. Molecular identification was based on 16S rRNA analysis.

Phenotypic characterization of isolated bacteria

Pure culture was maintained on agar slants for further characterization and identification. The shape, size, color, margin, and opacity of the isolated colonies have been recorded. Gram staining of the heat-fixed, an air-dried smear of isolated bacteria has been done and the result of the staining was observed under oil immersion using a bright field microscope (Gephardt et al. 1981).

Preparation of scanning electron micrograph of bacterial smear

Smear preparation of bacterial suspension has been made on a cover slip and heat-fixed over a flame for 1-2s, followed by 2.5% glutaraldehyde (aqueous) for 45 min. The cover slips were then dehydrated passing through 50, 70, and 90%, and finally with absolute alcohol for 5 min each. The specimens were coated with metallic gold in an IB-2 ion coater and examined in a Hitachi S-530 Scanning Electron Microscope at accelerating voltages of 15 and 20KV.

Biochemical characterization

Biochemical characterization of the isolate was done following the standard microbiological methods (Pelczar et al. 1957; Collee and Miles 1989; Lacey 1997). To study the bio-chemical properties, catalase, citrate utilization, nitrate reduction, indole production, methyl-red, urease, oxidase, NaCl tolerance, and carbohydrate metabolism (acid gas production) tests have been prepared. For qualitative determination of enzymes, starch hydrolysis tests have been done. The sensitivity of the isolate to recommend doses of antibiotics was followed by standard methodology.

Genotypic characterization of isolated bacteria

The identification of the isolates was further confirmed by modern molecular techniques such as 16S rDNA. The assay involves isolation, amplification, and sequencing of the gene coding for the 16S rRNA i.e. the 1.5 kbps 16S rDNA, from bacteria.

DNA extraction

After morphometric confirmation, the bacteria were subjected to DNA isolation and the contents were collected carefully in 1.5 mL micro centrifuge tubes. Bacterial colonies were then centrifuged at 1000×g for 10 min. The DNA was extracted by suspending the bacteria in 500 µL lysis buffer (100 mM NaCl, 10 mM Tris, 10 mM EDTA, 0.2% SDS, 1 0.4 mg/mL Proteinase K) and incubating overnight at 55⁰C. Then, 500 µL of phenol: chloroform (1:1) was added to the digested bacteria, mixed gently, and centrifuged at 5200×g for 10 min. The upper phase was transferred to a new tube and mixed with 1/10th volume of sodium acetate (3 M, pH 5.2) and 2 volumes of 96% ethanol (Amresco, USA). If necessary, the extraction step and phenol-chloroform treatment have been repeated. The DNA was precipitated at 20⁰C overnight and pelleted by centrifugation at 10000×g for 30 min. The pellet was washed once with 70% ethanol, air-dried for several minutes, and resuspended in 30 µL of molecular biology-grade water. The quality of DNA has been evaluated on 0.8% Agarose Gel (Fig. 1).

Polymerase chain reaction amplification

Isolated DNA was amplified with PCR [Eppendorf] using 16S rDNA specific forward and reverse primers, 8F [5'AGAGTTTGATCCTGGCTCAG3'] and 1492R [5'ACGGCTACCTTGTTACGACTT3'] respectively with the help of Veriti® 99 well Thermal Cycler (Model No. 9902). A single discrete PCR amplicon band of 1500 bp was observed. PCR was carried out in a final volume of 50 µl, which contained 10 ˗ 50 ng of extracted DNA, 1× Taq DNA Polymerase buffer (Invitrogen), 0.2 mmol of dNTP (Invitrogen), 1.5 mmol of MgCl2, 10 pmol of each primer (Invitrogen), 2.5 U of Taq DNA polymerase (Invitrogen) and distilled water. A PTC-100 (MJ Research Inc.) thermal cycler was used. Amplification was done by initial denaturation at 95⁰C for 5 min, followed by 35 cycles of denaturation at 95⁰C for 30 sec, annealing of primers at 51⁰C for 30 sec, and extension at 72⁰C for 60 sec. The final extension was at 72⁰C for 5 min. The PCR products were analyzed agarose gel electrophoresis gel containing 0.5 µg/mL ethidium bromides in 1× Tris-acetate- EDTA (TAE) buffer, and size was estimated by comparison with the 1Kb Plus DNA ladder.

Sequencing

The PCR products are then further subjected to Sanger Sequencing and sequenced with Forward and Reverse DNA sequencing reaction of PCR amplicon was carried out with 704F and 907R primers using BDT v3.1 Cycle sequencing kit on ABI 3730xl Genetic Analyzer performed by the Genomics Division, Xcelris Labs Ltd, Ahmedabad, India. Forward and reverse sequence segments were aligned and a contiguous sequence was deposited in the GenBank database.

Phylogenetic analysis

The 16S rDNA sequence has been used to carry out the BLAST alignment search tool of NCBI GenBank database (www.ncbi.nlm.gov/BLAST). Based on the maximum identity score first sixteen Bacillus licheniformis sequences were selected and aligned using the multiple alignment software program Clustal W (Saitou and Nei 1987). The evolutionary history was inferred using the Neighbor-Joining method (Guindon et al. 2010). Nucleotide frequencies, and ML analysis were performed using PhyML 3.0 online (http://www.atgc-montpellier.fr/phyml/). The bootstrap consensus tree inferred from 1000 replicates (Felsenstein 1985) is taken to represent the evolutionary history of the taxa analyzed (Felsenstein 1985). Branches corresponding to partitions reproduced in less than 50% of bootstrap replicates are collapsed. The percentage of replicate trees in which the associated taxa clustered together in the bootstrap test (1000 replicates) is shown next to the branches (Felsenstein 1985). The evolutionary distances were computed using the Jukes-Cantor method (Kimura 1980) and are in the units of the number of base substitutions per site. A distance matrix was generated using the RDP database and the phylogenetic tree was constructed using MEGA 5 (Tamura et al. 2011). The rate variation among sites was modeled with a gamma distribution (shape parameter = 1). The analysis involved 30 nucleotide sequences. Codon positions included were 1st + 2nd + 3rd + Noncoding. All positions containing gaps and missing data were eliminated. There were a total of 772 positions in the final data set. Evolutionary analyses were conducted in MEGA 5 (Tamura et al. 2011).

Pathogenecity studies

Preparation of cell suspension of Bacillus licheniformis PKBMS₁₆

Bacillus licheniformis PKBMS₁₆ isolated from infected goldfish during the survey were sub-cultured once on nutrient agar before its use in pathogenicity studies and maintained in Hi chrome Bacillus agar incubated at 30⁰C for 24 hrs to get young discrete colonies. Two young colonies were aseptically picked up and transferred to 10 ml broth (Miles et al. 1938) and incubated at 30⁰C for 24 hrs. This 24 hrs old culture was then transferred to 300 ml fresh broth and re-incubated at 30⁰C for 48 hrs. The cells were harvested by centrifugation at 7500 rpm for 20 min at 4⁰C in a refrigerated centrifuge. The cell pellets were washed twice by centrifugation with sterile physiological saline and finally resuspended in 10 ml sterile saline and used immediately. A portion of the cell suspension was suitably diluted up to 10⁸ in sterile saline and the number of cells/ml of suspension was determined by the drop plate method on CA after incubation at 30⁰C for 48 hrs.

LD₅₀ challenge experiment

Inocula were prepared from cultures of a pure strain of Bacillus licheniformis PKBMS₁₆. Purified bacterial suspension of 10⁷ CFU was serially diluted with PBS and used for the challenge experiments. This study was designed for 24 to 96 hrs after the inoculation. The experiment was divided into two groups with subgroups of five different concentrations (10³ to 10⁷) with duplicate. One was for an experimental animal which was inoculated with normal saline for 4 days (Control group) and another was used for an experimental animals was inoculated with a bacterial suspension of different concentration for 4 days. Fish other than the control group were exposed to bacterial inoculums by intra-peritoneal injection with 0.1 ml of Bacillus licheniformis PKBMS₁₆, according to their concentrations as described above. Mortality was recorded daily for the remaining days (Saha and Bandyopadhyay 2020).

Experimental challenge

One-fourth of the LD₅₀ value was chosen for pathophysiological studies of the experimental group of fishes. 200 fish with an average body weight of 19.25 ± 0.54 gm and length of 10 ˗ 12 cm were collected from a commercial fish farm for the purpose. On arrival at the Parasitology laboratory, department of Zoology, fish were disinfected with 5-ppm potassium permanganate for 5 min, stocked in 500 L. capacity fiberglass reinforced plastic tanks containing 300 L. of clean bore-well water at the rate of 50 per tank, and acclimatized for 10 days with continuous aeration. They were fed with commercially available pellet feed at the rate of 2% body weight. Accumulated wastes and feces were removed once in three days and 50% water was exchanged. Prior to the challenge, the acclimatized fish were checked visually for gross and external signs of diseases including the parasites on the body muscle, liver, spleen, and gills as well as bacterial infection in the kidney. The absence of gross and external signs of diseases and bacterial growth on agar media confirmed that the stocks were healthy and devoid of obvious disease. Infectivity trials were performed by intraperitoneal injection at predetermined doses in duplicate. Fishes were divided into three groups, namely the control group, treated group I, and treated group II and the determined dose was administered. Each fish received 100 µl of the inoculums. One hundred microliters each of Bacillus licheniformis PKBMS₁₆ cell suspension containing 10⁵ CFUmL/l injected at 45⁰ angle between the pelvic fins and anal vent of fish. The respective control group received only 100 µl of sterile physiological saline. The challenged and control groups were maintained in the respective aquaria for 20 days. The behavioral abnormalities, external signs of infection, and mortality, if any were recorded daily.

Histopathological study

Different target organs, e.g. liver, kidney, spleen, gill, and muscles of normal and naturally infected goldfish and challenged host fishes were collected from normal and naturally infected host fish after 20 days post-treatment along with visible symptoms and fixed in Bouin’s fixative for 24 hours, dehydrated in ascending grades of alcohol and cleared in xylene. The fixed tissues were embedded in paraffin wax and sectioned into five micrometers thick, stained with Hematoxylin-eosin, and mounted in DPX (Bernet et al. 1999). Then the sections were examined on the light microscope and photographed by using an Olympus CX 41 model (40X and 100 X).

Scanning electron microscopic study of tissues infected with bacterial pathogen

The tissues of the host fish with experimental infection were examined and fixed in 2.5% glutaraldehyde solution for two hours at 4⁰C followed by dehydration with ethanol, and washing with absolute acetone and amyl acetate mixture in 3:1, 2:2, and 1:3 ratios respectively, and finally with 100% amyl acetate. The tissues were then dried in critical point using CO₂ in an HCP:2 Critical Point Dryer (Hitachi), coated with metallic gold in an IB-2 ion coater, and examined in a Hitachi S-530 Scanning Electron Microscope at accelerating voltages of 15 and 20KV.

Statistic analysis

The data were compared by One Way Analysis of Variance (ANOVA) and in completely random design comparisons, of means were performed with post-hoc Tukey HSD test using SPSS (Version 20.0). The significant level was set at P < 0.05(*) and P < 0.01(**). The LD₅₀ results were statistically analyzed following Reed and Muench (1938).

During the initial necropsies of that fish farm, huge pathological lesions on different organs of goldfish were found (Fig. 1). Muscle explants underlying unbroken but pale skin and a single bacterial species were isolated from all fishes (Fig. 1E). Externally affected fish had hemorrhages at the base of fins, mouth, and skin muscles with faded pigments (Figs. 1A, 1B, and 1C).

Morphometric characterization

The organism formed an irregular, off-white circular, and medium-sized colony on nutrient and Hichrome bacillus agar plates with an average diameter of 2 ˗ 4 mm (Figs. 2A and 1B). Colonies become opaque with dull to rough surfaces. Hair-like outgrowth is strongly attached to the agar which may be the indicator of the species licheniformis. The isolates are mesophilic and have the ability to grow at 37⁰C. The organism stains positively with Gram’s stain (Fig. 1C).

Scanning electron microscopy revealed that it is a large rod-shaped bacterium with flagella, measuring 1.5–3.0 × 0.6–0.8 µm in diameter (Fig. 3A˗C). Bacteria are motile by peritrichous flagella. SEM study also revealed that ellipsoidal, sub-terminal endospores have been produced by the isolate which does not deform the vegetative cell and are devoid of the capsule.

A series of biochemical characteristics in Table 1 identified the isolate as a member of the genus Bacillus (Sneath et al. 1986). The bacterial isolate showed positive results for catalase, methyl-red, nitrate reduction, citrate utilization, and starch hydrolysis, and negative for urease, voges proskauer, indole, oxidase, and lipase test. The bacteria were found to be sensitive to the recommended doses of tetracycline, but resistant to ampicillin. The bacterial isolate could not ferment lactose but utilize glucose and sucrose. The bacteria could tolerate up to 10% NaCl present in the nutrient broth medium. Based on the morphological, biochemical, and phylogenetic analysis, the isolate was identified as Bacillus licheniformis.

Table 1

Characterization of *Bacillus licheniformis* PKBMS₁₆
Biochemical tests	Result
Gram Stain	+
Rod shaped	+
Growth temp.	25⁰ − 37⁰C
Motility	+
Oxidase test	-
Catalase test	+
Indole production	-
VP test	-
MR test	+
Urease activity	-
Citrate utilization	+
Nitrate	+
Methyl Red test	+
Growth on different media
Nutrient agar	+
Mac’ Conkey agar	-
Hichrome Bacillus Agar	+
Enzymatic activity test
Starch hydrolysis	+
Carbon source utilization:	Gas/Acid
Lactose	- /-
Sucrose	- /+
glucose	+ /+
NaCl tolerance	Upto 10%
Antibiotics sensitivity test
Ampicillin	R
Tetracycline	S

Molecular characterization

In the molecular analysis, the specific 16S rDNA specific universal forward and reverse primers, 8F [5'AGAGTTTGATCCTGGCTCAG3'] and 1492R [5'ACGGCTACCTTGTTACGACTT3'] successfully amplified an approximately 1618 bp fragment of the 16S rDNA gene of bacterial infecting C. auratus (Fig. 4). A consensus sequence of 1526 bp of 16S rRNA was generated from forward and reverse sequence data which has been submitted to the NCBI GenBank database under the accession number KX235179. The 16s ribosomal RNA gene sequence (1526 bp long) analysis showed that nucleotide contains adenine bases 375, cytosine bases 364, guanine bases 485, and thymine bases 302. Thus GC content of the ribosomal RNA molecule is 55.60% and 44.40% AT content (Fig. 5).

Sequence analysis

The BLAST search using the partial 16S rDNA sequence data (highly conserved region) of the present bacterial strain isolated from C. auratus did not match any of the available in the GenBank. Nucleotide frequencies were estimated from the data (f(A) = 0.24813, f(C) = 0.23877, f(G) = 0.31549, f(T) = 0.19762), six rates of nucleotide substitution were A <-> C = 1645.85567, A <-> G = 7580.14762, A <-> T = 4000.22495, C <-> G = 2607.32736, C <-> T = 10448.18838, G <-> T = 1.00000; gamma distribution parameter estimated 0.029. The final decoration AIC = 4509.43922 was selected with six rate categories.

BLASTN search (www.ncbi.nlm.gov/BLAST) indicated that this sequence was most similar to those various Bacillus sp. The 16S rDNA sequence of the bacterial strain was aligned with all available 16S rDNA sequences in the GenBank database and finally, the phylogenetic tree was constructed (Fig. 6). The phylogenetic tree indicated that this bacterial isolate belongs to the genus Bacillus and the pattern of the tree determined that the strain is closely related to other B. licheniformis strains with 99% 16S rDNA similarity.

The alignment view is constructed on the basis of the percentage of similarity of the closely related species of Bacillus licheniformis PKBMS₁₆ (KX235179), which gives a clear picture of the above description based on the branching of the clusters of the neighbor joining tree of Bacillus licheniformis PKBMS₁₆ (KX235179).

Evolutionary pair-wise distances among Bacillus licheniformis and other species of myxosporeans, measured by the Kimura-2 parameter algorithm, ranged from 0.00 (T. toyamai HQ338729) to 0.56 (Kudoa iwatai AY514038).

All the hit of this sequence is matched with the Bacillus licheniformis clade, we consider the current species as Bacillus, on the basis of morphological conformation, and the phylogenetic tree have been constructed within the Bacillus clusters and was placed with the Bacillus licheniformis, strain B3 with highest bootstrap value and confirmed the clustering, pattern of maximum likelihood and maximum parsimony analysis and the observed wide range in the evolutionary pairwise distances among Bacillus sp., measured by Kimura-2 parameter algorithm from 0.003 (Bacillus licheniformis, strain B3) and 0.004 (Bacillus licheniformis, strain 2TgB) as a possible indicator of a some sort of genetic diversity, which is increasing among Bacillus. The bootstrap consensus tree inferred from 1000 replicates is taken to represent the evolutionary history of the taxa analyzed. The percentage of replicate trees in which the associated taxa clustered together in the bootstrap test (1000 replicates) have been shown next to the branches (Fig. 6).

Pathogenicity studies

Determination of acute doses

The acute toxicity of different concentrations of bacterial doses to healthy goldfish was determined by performing a 4-days bioassay of LD₅₀. The goldfish survived easily with bacterial doses of 10³ − 10⁶ CFU/L for four days with visible effects. In the pure concentration of 10⁷ CFU maximum fishes die, therefore, 10⁵ CFU has decided to be the acute dose of concentration with a possible lesion on host fish with maximum survivability which is much lower than the LD₅₀ values of the described dose. More diluted doses are unable to produce symptoms in their host fish. Taking into account, for illustration of exact changes of pathophysiological condition of Bacillus licheniformis PKBMS₁₆ infected goldfish in compared to their control group (uninfected), 10⁵ CFU was considered as an acute dose without severe mortality (Fig. 7).

Lethal doses of Bacillus licheniformis PKBMS₁₆ in fish are 10⁷ CFU intraperitoneal. Interestingly, it has been shown that as few as 10⁵ CFU are sufficient to establish Bacillus licheniformis in lesions of fish. After 20 days, ulcerative lesions had developed at the injection site.

In vivo assay

After 10 and 20 days of post-infection, it has been found that 1.0 x 10⁵ CFU/ml dose of Bacillus licheniformis PKBMS₁₆ induced significant changes in hematological and serum biochemical parameters in the experimental group of fish mainly after 20 days post-treatment group. Clinically, goldfish infected by Bacillus licheniformis PKBMS₁₆ shows conspicuous internal clinical signs including hemorrhages in the internal organs.

Tissue histology

Fish that received injections developed a light-colored area over the injection site within 48 hrs, and the underlying muscle became necrotic. Fish injected with normal saline did not develop external lesions on the 20th day post-injection. Bacillus licheniformis have been re-isolated from the liver and kidney of all fishes which develop external lesions. Histologically, the internal organ, mainly the liver and kidney are severely damaged which may be the target organs for this isolated bacteria. All the lesions from fish with Bacillus licheniformis suspensions resembles lesions of fish induced by Gram-positive bacilli.

Liver (Fig. 8 and Fig. 9)

The most common lesions in the liver of the goldfish are vacuolar degeneration in the hepatocytes along with focal areas of necrosis and aggregations of inflammatory cells between the hepatocytes (Fig. 8B). Minimal vaculation of hepatocyte and the central vein was also observed in many cases (Fig. 8B, 8C, and 8E). The main alterations observed in the infected liver, which is irregular-shaped nuclei and the presence of eosinophilic granules in the cytoplasm (Figs. 8B, 8D, 9B, and 9D). Severe infection in the liver is also indicated by hydropic swelling, characterized by the enlargement of hepatocytes along with the presence of large lipid vacuoles, which usually occupy the whole cell and displaced nuclei to the periphery and cystic degeneration that are more common like injuries induced by any environmental hindrances (Fig. 8F). Hepatocytes are completely damaged and the influx of blood cells surrounded by hepatocytes shows hydropic swelling. Sometimes aggregations of inflammatory cells between the hepatocytes attached with some secondary infection in the intravascular system which showed a dark appearance in the tissue system by haemolysis in blood vessels (Figs. 8G, 8H, and 9C). Also distended sinoside between liver cells, dialation and congestion of blood sinusoids, and intravascular haemolysis in hepatic blood vessels and hepetoportal blood vessels have been observed (Fig. 8I). These changes are also confirmed by an SEM study of Bacillus infected tissue. Moreover, focal areas of coagulative necrosis and fibrosis have been observed.

Kidney (Fig. 10 and Fig. 11)

The kidney from the control group didn’t show any histopathological alteration changes and contained well-organized glomerulus, renal tubules, and interstitial tissue. The histopathological alterations in the kidney of both naturally and experimentally infected fish included severe degenerative and necrotic changes in renal tubules with dilation in a renal blood vessels and capillary tubes of renal tubules which is characterized by the formation of vacuole due to the destruction of the cell membranes and severe haemorrhage in the interstitial tissue (Figs. 10B, 10H, and 11D). Aggregations of inflammatory cells have been observed between renal tubules (Figs. 10E). Vacuolar degeneration (cloudy swelling) in the epithelium has been observed along with degenerated tubules with loss of cytoplasm of the cell (Figs. 10B and 10H). SEM study also revealed edema in Bowman’s capsules due to adhesion to the partial layer and nuclear hypertrophy has been observed along with visceral layers of renal corpuscles (Fig. 11B). Epithelial disruption, inflammation, and necrosis of skeletal muscle tissue are responsible for fat deposition in the interstitial tissues (Figs. 10E and 10G). The kidney of experimentally challenged fish also showed shrunken glomerulus with increased peri-glomerulus space, accompanied by necrotic renal tubules (Fig. 10C). SEM study also confirmed the hyaline droplet degeneration and occlusion of the tubular lumen also found in some tissue of moribund fishes (Figs. 10D, 10F, and 11C).

Bacterial infection is a major risk factor in commercial aquaculture farms worldwide and has been considered a significant economic problem in India over the past decade.

Clinical symptoms of Bacillus infection like scale erosion, haemorrhagic skin and ulceration as well as tail and fin rot were observed in all the groups of infected fish. Exposure to bacterial doses resulted in clinical changes in the fish as well. SEM study of this isolate also reveals the exact identifying characteristics of Bacillus licheniformis which corroborated well with previous works (Goodwin et al. 1994; Agerholm et al. 1995, 1997; Azmi et al. 2014).

According to the nucleotide base composition report, the greater amount of GC than AT content has been found. The conserved region of the novel sequence indicated the presence of larger amounts of G bases, followed by A bases, which gives a clear idea about the invariability of the region that plays a great role in phylogeny analysis (Panda et al. 2012).

The rates of different nucleotide substitution from one base and to another base were assessed. The rates of transition were more than transversion for all base substitutions and stable AIC has been found from the data which indicated the strong ancestral phylogeny of the present species divergence from the earlier described species (Kaur et. al. 2016).

Partial 16S rRNA gene sequence data analysis of strain-isolated bacteria showed high arrangements between traditional and molecular identification and was finally identified as Bacillus licheniformis PKBMS₁₆ (KX235179). The potential utility of conserved regions to identify or amplify the rRNA gene followed by exploitation of more variable regions of the gene spacers to detect or identify bacteria that may be difficult or even impossible to culture has long been recognized (Barry et al. 1990; Rodicio and Mendoza 2004). Therefore, the phylogenetic tree based on the final edited alignment, indicates the high bootstrap value and confirms the clustering pattern of Bacillus licheniformis PKBMS₁₆ with a strong tendency toward Bacillus licheniformis cluster, showing maximum likelihood and maximum parsimony analysis over 99%.

The novel DNA sequence of Bacillus licheniformis PKBMS₁₆ clustered phylogenetically with other Bacillus spp. and was most similar to those of Bacillus licheniformis, strain B3 (HM030741.1, 99%), available to resemble our sequence showing the match percentage 99%. A BLAST search of the ssrRNA gene sequence of Bacillus licheniformis PKBMS₁₆ was also shown close genetic similarities with Bacillus sp. 18PAM3 and Bacillus licheniformis strain forms the closest neighboring branch with the novel sequence and these two species was placed as a sub clade in the phylogenetic tree from which the new bacteria was placed and both the branches are originating from the monophyletic clade that is strongly supported by bootstrap values. The isolated strain formed a dichotomy with Bacillus licheniformis, strain B3 (HM030741.1, 99%) with a high node support which shows 99% homogenicity. Although all the species of sequence alignments view showed high genetic affinities with the novel sequence as they are branching out from the same branches form the new one. However, the BLAST search using the partial 16S rDNA sequence of Bacillus licheniformis PKBMS₁₆ did not match fully with any of the Bacillus available in the GenBank. Therefore, in phylogenetic analyses, a clearly independent position of Bacillus licheniformis PKBMS₁₆ sp. can be established among the Bacillus species. Therefore, it could be considered as a new strain, for which the name Bacillus licheniformis PKBMS₁₆ is being proposed.

After determining the infective doses a series of histopathological changes have been observed in the liver and kidney, the primary target organs for infection in both naturally and experimentally infected fish by Bacillus licheniformis PKBMS₁₆.

Alterations in the liver may be useful as markers that show severe morphological changes with exposure to various bacterial diseases (Agerholm et al. 1995). Since it is the main organ for detoxification and biotransformation (Soufy et al., 2007). In the present study, the liver revealed various degenerative changes. The most demonstrated one was vacuolar degeneration (Ahmadmoradi et al. 2012). Gingerich (1982) revealed that the vacuolization of hepatocytes might indicate an imbalance in the rate of synthesis of substances in the parenchymal cells. During the study, the pathological changes in the liver include inflammatory cells and focal areas of necrosis between hepatocytes. These results agreed with Mohammed (2009) who studied histopathological alteration on Tilapia zilli and Solea vulgaris livers contaminated by drainage water of Lake Qarun. Mohammed (2003) found similar changes in the mentioned organs of fish. In previous studies, cell swelling, focal necrosis and haemorrhagia, pyknosis of nuclei, and vacuolization of cytoplasm have been reported, (Cengiz and Unlu 2006; Ibrahim 2013) which corroborates with the current study.

The kidney is the vital organ of the body, responsible for proper infiltration functioning by removal of waste from the blood and selective re-absorption of body fluid and erythropoiesis to maintain the homeostasis (Iqbal et al. 2004). Vacuolar degeneration as observed in the histologic section of muscle has probably occurred in response to tissue damage caused by the bacterium, which corroborated with the findings of Tripathi et al. (2005). Various histopathological alterations found in this study are similar to many other known fish pathogens including Flavobacterium, Aeromonas spp., Edwardsiella spp., and Pseudomonas spp. (Austin and Austin 2007; Heil 2009). Laurén et al. (1989) delineated the hyalinization of the renal tubular epithelium in rainbow trout Oncorhynchus mykiss, as a result of oral uptake of the antibiotic Fumagillin. These histological alterations in kidneys have been observed by several authors in fish (Velmurugan et al. 2007; Mohamed 2009; Belicheva and Sharova 2011). Vasoconstriction and reduced blood flow, causing ischemia resulted in tubular cell damage (Confer and Panciera 2001). Dilation of the lumen of the kidney tubules and degeneration of the glomerulus has been reported in Labeo rohita exposed to hexachlorocyclohexane (Dass and Mukherjee 2000) and Cyprinus carpio exposure to deltamethrin (Cengiz 2006) as shown in the present study. Some common alterations of fish kidney like tubular degeneration, dilation of capillaries in the glomerulus, and reduction of Bowman’s space along with glomerular vaculation has been found which corroborated with the observations of various authors (Takashima and Hibay 1995; Paecho and Santosh 2002; Mohammed 2009).

Though most of the studies conducted on Bacillus bacteria have focused on the isolation, identification, characterization (Goodwin 1994; Azmi et al. 2014) and more over on its advantage as a probiotic for promoting the health of fish but none have established its pathogenicity towards fish. In our study, a highly pathogenic new bacterial strain, Bacillus licheniformis PKBMS₁₆ is commonly isolated and identified from Goldfish Carassius auratus L, based on its both morphological and molecular characterization. The result of the present study on Bacillus licheniformis causing Bacilliosis in ornamental fishes is worthy and significant because no reports on in vivo pathogenicity of Bacillus species are available yet. However, it is reasonable to believe that in experimentally challenged fishes, the bacterium produced a systemic pathology in terms of histological alteration in C. auratus similar to many other known fish pathogens. This is the first reported episode from India on the description of the histological profile of Goldfish, C. auratus due to Bacilliosis which also provides a case definition for future work, like the host-pathogen interaction, mode of infection, rapid identification of bacterium in the environment, including epidemiological studies.

Compliance with Ethical Standards

The fish were collected in fresh form from the different fish farm of West Bengal. At the point of time when work began on the parasites of edible ornamental fishes, we approached Committee for the Purpose of Control and Supervision of Experiments on Animals (CPCEA), Ministry of Environment, Forest and Climate Change, and Government of India for ethical clearance. The host fish was reviewed and approved by Animal Ethics Committee on Animal Experiments of the University of Kalyani (892/GO/Re/S/01/CPCSEA).

Credit authorship contribution statement

Dr. Mandira Saha: Data curation, Writing, Original draft preparation, Visualization, Investigation, Conceptualization, Software programming, Validation, Methodology, Reviewing and Editing of manuscript. Beauty Kundu: Visualization, Investigation, Editing of manuscript. Saikat Saha: Data curation, Reviewing and Editing of manuscript. Dr. Sabir Hossen Molla: Conceptualization, Supervision, Project administration, Validation.

Conflict of Interest

The authors declared that they have no conflict of interest.

Acknowledgement

Sincere thanks are expressed to National testing house, Salt Lake City, Kolkata-91 for technical support. Authors are also thankful to Department of Zoology, University of Kalyani for providing Laboratory facilities. Thanks are also due to Department of Zoology, Chakdaha College for providing some instrumental facilities. No funding received during the study.

Agerholm JS, Jensen NE, Jensen HE, Dantzer V (1997) Placental localization after infection with Bacillus licheniformis in pregenent cows. Placenta 18: p. A9.
Agerholm JS, Krogh HV, Jensen HE (1995)) A retrospective study of bovine abortions associated with Bacillus licheniformis. J Vet Med series B 42: 225˗234.
Ahmadmoradi E, Rezaie A, Mousavi SM (2012) Histopathological study of the kidney, liver and intestine tissues in goldfish (Carassius auratus) and angelfish (Pterophyllum sp.). Aquac Aquar Conserv Legis 5 (4): 282˗288.
Austin B, Austin DA (1993) Bacterial fish pathogens. In: Schuster Chichester S, editor, Diseases of Farmed and Wildfish. 2nd ed. Springer Publication pp. 111˗117.
Austin B, Austin DA, and Munn CB (2007) Bacterial Fish Pathogens. Diseases of Farmed and Wild Fish, 4th edition. Praxis Publishing Ltd, Chichester, UK, p. 552.
Azmi SA, Chatterjee SN, Saha NC (2014) Phenotypic and molecular characterization of bubble eye gold fish pathogenic ampicillin resistant Bacillus sp. (GF1). Int J Pharm Bio Sci 5(4): 342–351.
Barry T, Powel R, Gannon F (1990) A general method to generate DNA probes for microorganisms. Biotechnol 8: 233˗236.
Bernet D, Schmidt H, Meier W, Burkhardt-Holm P, Wahli T (1999) Histopathology in fish: Proposal for a protocol to assess aquatic pollution. J Fish Dis 22(1): 25˗34.
Biradar SS, Goud NR, Neogi U, Saumya R (2007) In vitro and in vivo antibacterial studies of medicinal plant on motile aeromonad septicemia in fish caused by Aeromonas hydrophila. J Fish Aquat Sci 2(6): 417˗ 421.
Boer AS de, Priest F, Diderichsen B (1994) On the industrial use of Bacillus licheniformis: a review. Appl Microbiol Biotechnol 40: 595˗598.
Burdon KL, Davis JS, Wende RD (1967) Experimental infection of mice with Bacillus cereus: studies of pathogenesis and pathologic changes. J infect Dis 117: 307˗316.
Cengiz EI (2006) Gill and kidney histopathology in the freshwater fish Cyprinus carpio after acute exposure to deltamethrin. Environ Toxicol Pharmacol 22(2): 200˗204.
Collee JG, Miles PS (1989) Tests for identification of bacteria. In: Collee JG, 13th ed. New York: Churchil Livingstone.
Confer AW, Panciera RJ (2001) The urinary system, Thomson’s Special Veterinary Pathology. 2: 209˗246.
Das BK, Mukherjee SC (2000) A histopathological study of carp (Labeo rohita) exposed to hexachlorocyclohexane. Vet Arh 70(4): 169˗180.
Felsenstein J (1985) Confidence limits on phylogenies: An approach using the bootstrap. Evol 39(4): 783˗791.
Gephart P, Murray RGE, Costilow RN, Nester EW, Wood WA, Krieg NR, Phillips GB (1981) Manual of methods for general bacteriology, ASM Press, Washington 1: p. 1.
Gingerich WH (1982) Hepatic toxicology of fishes. Aquat Toxicol 1: 55˗105.
Goodwin AE, Roy JS, Grizzle JM, Goldsby MT (1994) Bacillus mycoides: a bacterial pathogen of channel catfish. Dis Aquat Org 18: 173˗179.
Guindon S, Dufayard JF, Lefort V, Anisimova M, Hordijk W, Gascuel O (2010) New algorithms and methods to estimate maximum-likelihood phylogenies: assessing the performance of PhyML 3.0. Syst Biol 59: 307˗321.
Gurinovich AS, Titok MA (2023) Molecular Genetic and Functional Analysis of the Rap-Phr Signal System of the Plasmid pBS72 of Bacillus subtilis Isolates. Microbiol 92(5): 630˗637.
Heil N (2009) National Wild Fish Health Survey. Laboratory Procedures Manual, Fifth ed. U.S. Fish and Wildlife Service, Warm Springs, GA.
Ibrahim NK (2013) Possible protective effect of kombucha tea ferment on cadmium chloride induced liver and kidney damage in irradiated rats. Int J Biol Life Sci 9: 7˗12.
Iqbal F, Qureshi IZ, Ali M (2004) Histopathological changes in the kidney of common carp, Cyprinus carpio following nitrate exposure. J Aquat J Res Sci 15(4): 411˗418.
Kaur H, Attri R, Joshi J (2016) Molecular identification of a new myxozoan, Myxobolus dermiscalis n. sp. (Myxosporea) infecting scales of Labeo rohita Hamilton in Harike Wetland, Punjab (India). Int J Parasitol Parasit Wildl 5(2): 139˗144.
Kimura MA (1980) A simple method for estimating evolutionary rate of base substitutions through comparative studies of nucleotide sequences. J Mol Evol 16: 111˗120.
Lacey LA (1997) Manual of techniques in insect pathology, New York: Academic Press.
Lauren DJ, Wishkovsky A, Groff JM, Hedrick RP, Hinton DE (1989) Toxicity and pharmacokinetics of the antibiotic fumagilin in yearling rainbow trout (Salmo gairdneri). Toxicol Appl Pharm 98: 444˗453.
Belicheva LA, Sharova JN (2011) Assessment of fish health status under long-term water pollution: Vygozero reservoir, north-west Russia. Environ Technol Resourc Proc Int Sci Pract Conf 2: 368˗373.
Miles AA, Misra SS, Irwin JO (1938) The estimation of the bactericidal power of the blood. Epidemiol Infect 38(6): 732˗749.
Mohamed F (2003) Histopathological studies on some organs of Oreochromis niloticus, Tilapia zillii and Synodontis schall from El-Salam canal, Egypt. Egypt J Aquat Bio Fish 7(3): 99˗138.
Mohamed FAS (2009) Histopathological studies on Tilapia zillii and Solea vulgaris from Lake Qarun, Egypt. World J Fish Marine Sci 1(1): 29˗39.
Pacheco M, Santosh MA (2002) Biotransformation, genotoxic and histopathological effects of environmental contaminants in European eel (Anguilla anguilla L.). Ecotoxic Environ Saf 53(3): 331˗347.
Panda S, Bandyopadhyay PK, Chatterjee SN (2012) Characterization of Pseudomonas aeruginosa PB112 (JN996498) isolated from infected Labeo bata (Hamilton) by 16S rRNA gene sequence analysis and fatty acid methyl ester (FAME) analysis. Afr J Biotechnol 12(4): 400˗405.
Pelczar MJ, Bard RC, Burnett GW, Conn HJ, Demoss RD, Euans EE, Weiss FA, Jennison MW, Meckee AP, Riker AJ, Warren J, Weeks OB (1957) Manual of microbiological methods. Society of American Bacteriology, McGraw Hill Book Company, Inc., New York. p. 315.
Pychynski T, Malanowska T, Kozlowski M (1981) Bacterial flora in branchloneclosis of carp (particularly Bacillus cereus and Bacillus subtilis). Med Weter 37(12): 742˗743.
Reed LJ, Muench H (1938) A simple method of estimating fifty percent endpoints. Am J Epidemiol 27(3): 493˗497.
Rodicio MR, Mendoza MC (2004) Enferm Infecc Microbiol Clin 22: 238˗245.
Saha M, Bandyopadhyay PK (2020) In vivo and in vitro antimicrobial activity of phytol, a diterpene molecule, isolated and characterized from Adhatoda vasica Nees. (Acanthaceae), to control severe bacterial disease of ornamental fish, Carassius auratus, caused by Bacillus licheniformis PKBMS₁₆. Microb Pathog 141: p. 103977.
Saitou N, Nei M (1987) The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol 4(4): 406˗425.
Sneath PHA, Mair NS, Sharpe ME, Holt JG (1986) Bergey’s Manual of Systematic Bacteriology. Williams Wilkins Co., Baltimore. p. 1123.
Soufy H, Soliman M, El-Manakhly E, Gaafa A (2007) Some biochemical and pathological investigations on monosex Tilapia following chronic exposure to carbofuran pesticides. Glob Vet 1: 45˗52.
Takashima F, Hibya T (1995) An atlas of fish histology: Normal and pathological features, 2nd ed. Tokyo, Kodansha.
Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S (2011) MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol 28(10): 2731˗2739.
Tripathi NK, Latimer KS, Gregory CR, Ritchie BW, Wooley RE, Walker RL (2005) Development and evaluation of an experimental model of cutaneous columnaris disease in koi Cyprinus carpio. J Vet Diagn Investig 17 (1): 45˗54.
Velmurugan B, Selvanayagam M, Cengiz E, Unlu E (2007) The effects of fenvalerate on different tissues of freshwater fish Cirrhinus mrigala. J Environ Sci Health Part B. 42: 157˗163.

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Histopathological tissue alterations of targeted organs of ornamental goldfish, Carassius auratus in India caused by a new pathogenic bacterial strain, Bacillus licheniformis PKBMS 16 identified on the basis of morpho- biochemical and 16S rDNA characterization

Status:

Version 1

Abstract

Figures

Introduction

Material and Methods

Sampling

Methods for isolation and culture of bacterial strains

Phenotypic characterization of isolated bacteria

Preparation of scanning electron micrograph of bacterial smear

Biochemical characterization

Genotypic characterization of isolated bacteria

DNA extraction

Polymerase chain reaction amplification

Sequencing

Phylogenetic analysis

Pathogenecity studies

LD₅₀ challenge experiment

Experimental challenge

Histopathological study

Scanning electron microscopic study of tissues infected with bacterial pathogen

Statistic analysis

Results

Morphometric characterization

Molecular characterization

Sequence analysis

Pathogenicity studies

Determination of acute doses

In vivo assay

Tissue histology

Liver (Fig. 8 and Fig. 9)

Kidney (Fig. 10 and Fig. 11)

Discussion

Conclusions

Declarations

References

Additional Declarations

Status:

Version 1

Histopathological tissue alterations of targeted organs of ornamental goldfish, Carassius auratus in India caused by a new pathogenic bacterial strain, Bacillus licheniformis PKBMS 16 identified on the basis of morpho- biochemical and 16S rDNA characterization

Status:

Version 1

Abstract

Figures

Introduction

Material and Methods

Sampling

Methods for isolation and culture of bacterial strains

Phenotypic characterization of isolated bacteria

Preparation of scanning electron micrograph of bacterial smear

Biochemical characterization

Genotypic characterization of isolated bacteria

DNA extraction

Polymerase chain reaction amplification

Sequencing

Phylogenetic analysis

Pathogenecity studies

LD50 challenge experiment

Experimental challenge

Histopathological study

Scanning electron microscopic study of tissues infected with bacterial pathogen

Statistic analysis

Results

Morphometric characterization

Molecular characterization

Sequence analysis

Pathogenicity studies

Determination of acute doses

In vivo assay

Tissue histology

Liver (Fig. 8 and Fig. 9)

Kidney (Fig. 10 and Fig. 11)

Discussion

Conclusions

Declarations

References

Additional Declarations

Status:

Version 1

LD₅₀ challenge experiment