Experimental animal and treatments
Four-week-old male C57BL/6 mice were procured from Royan Institute for Biotechnology (Isfahan, Iran) and were housed in a temperature-controlled facility (24 ± 3 °C and humidity of 65% ±5), under a 12 h light-dark cycle. All experiments were conducted following the guidelines of the committee of the Royan Institute (IR.ACECR.ROYAN.REC1398.44). Mice were acclimatized to the Royan animal housing condition for two weeks. They were held ad libitum to access water and foods throughout the study. After adaptation, mice with an approximate weight of 14 ± 2 g, were randomly divided into two groups of control (Ctrl) and diabetic mice (DM) that respectively fed with normal diet and AGEs-reach diet (Abedpour et al., Unpublished data) which were obtained from Royan Institute for Biotechnology, for 16 weeks. After ensuring the emergence of DM, the diabetic group was divided into seven groups randomly (n = 5), as follows: 1. Diabetic mice (DM group), 2. Diabetic mice treated with SPTC (130 mg/kg, DM/SPTC group), 3. Diabetic mice treated with Salvia Officinalis (60 mg/kg, DM/Sal), 4. Diabetic mice treated with metformin (300 mg/kg, DM/Met), 5. Diabetic mice with endurance exercise training (DM/EX), 6.Diabetic mice treated with SPTC + metformin (as the same dose which mentioned, DM/SPTC + Met) 7. Diabetic mice treated with SPTC + exercise training (DM/SPTC + EX).
SPTC (Salvia officinalis 145 mg, Panax ginseng 145 mg, Trigonella foenum-graeceum 60 mg, and 25 mg Cinnamomum zeylanicum) and Salvia were provided as a dried powder by the Goldaru pharmaceutical company (Isfahan, Iran). All chemical and herbal drugs were administered as a gavage supplement, five times per week (day 1 up to 5 /each week) for 8 weeks.
Once a week during the experiment period, body weights, and 24 h, Calorie, and water intake were measured. At the end of experiments, mice were sacrificed under xylazine and ketamine anesthesia, and blood and tissue samples were separated for subsequent tests.
Biochemical Analyses Of Serum Glucose And Plasma Insulin Levels
The serum level of insulin was determined by Ultra-Sensitive Mouse Insulin ELISA Kit (Crystal Chem, US) according to the protocol. Glucose tolerance test (GTT) and fasting blood sugar (FBS) were measured using an Alpha TRAK glucometer and its standard strips (Zoetis, US) as described elsewhere.
Exercise Training Protocol
Endurance exercise was applied as a type of moderate-high intensity exercise on a motorized treadmill with a 0 ° incline during 8 weeks (5 days/week). At first, mice were acclimated to treadmill exercise for two weeks, and after that speed and duration of treadmill training were gradually increased at a rate of 3 m/min from 10 to 25 m/min in the final session for 45 min (~ 70% VO2 max).
Quantitative Real-time Pcr (qrt-pcr)
Total RNA was isolated from the liver using TRIzol reagent (Thermo Scientific, USA). To remove contaminating genomic DNA, samples were treated with DNaseI (TaKaRa, Japan). mRNA was reverse transcribed with 1 µg of total RNA using the cDNA synthesis kit according to the manufacturer’s instruction (TaKaRa). qRT-PCR was performed with CYBR green (TaKaRa, Japan) on an Applied Biosystems real-time PCR thermal cycler (Thermo Fisher Scientific, Waltham, MA, USA). Evaluation of gene expression was carried out according to the 2−ΔΔct method. Accordingly, relative quantification was calculated according to 18 s rRNA as an internal control. Primers were ordered from micro-gene (Korea), and their sequences are shown in Table 1.
Table 1
Gene | Forward primer (5'-3') | Reverse primer (5'-3') | Annealing temperature (°C) |
Gpx1 | TGAGAAGTGCGAAGTGAATGGTG | TCTCAAAGTTCCAGGCAATGTCG | 62 |
Txn | CTCCCCGCAACAGCCAAA | GCAGTCATCCACATCCACTTCAA | 62 |
Nqo1 | GCCAATCAGCGTTCGGTA | AGTTCATAGCATAGAGGTCAGA | 62 |
HO1 | GGCTGTGAACTCTGTCTC | ATACCCACCATCACACCCTG | 56 |
18 s rRNA | CGGACACGGACAGGATTG | TCGCTCCACCAACTAAGAAC | 59 |
Western Blot Analysis
Tissue proteins were extracted using TRI reagent, according to the manufacturer protocol. Proteins were resolved by SDS-PAGE (10%) and transferred to PVDF membranes (Bio-Rad, USA). Membranes were blocked with different blocking buffer containing 10% skim milk (Millipore, USA), and 5% TBST. Then, they were respectively incubated with primary antibodies for 1.5 h (Anti-Nrf2 antibody [1:1000, EP1808Y, Abcam, UK], anti- β actin antibody (1:500, Sigma, USA), anti-Keap1 antibody [ 1:1000, ab119403, Abcam, UK] and secondary antibodies (Goat Anti-Rabbit IgG H&L (HRP) (1:20000, Santa Cruz SC-2301, HRP-conjugated goat antimouse IgG (1:5000, Dako, Japan P0447), for 1 h at room temperature. Blots were detected by an Amersham ECL Advance Western Blotting Detection Kit (GE Healthcare, USA). Image J software (National Institutes of Health, Bethesda, MD, USA) was utilized for quantification of the intensity band.
Histological Studies
Immediately after mice sacrificing, tissues were fixed in 10% buffered formalin and embedded in paraffin. Accordingly, fixed tissues were then cut into slices with 5 µm thickness. After deparaffinization and hydration, tissue sections were stained with hematoxylin and eosin (H&E) and finally were observed under light microscopy.
Ros Detection
ROS production in mice liver was measured using 2',7'-Dichlorofluorescin Diacetate (DCFDA) fluorescence method as previously described. Briefly, liver samples (100 mg) were homogenized in 1 mL ice-cooled (4 °C) 40 mM Tris–HCl buffer (pH:7.4). After diluting to 0.25% with the same buffer, the total homogenate of each sample was divided into two equal portions of 2 mL. Approximately 40 µL of 1.25 mM DCFDA was added to one portion, and the same volume of methanol was added to the other portion (Control). After 20 min incubation of all samples in 37 °C, the conversion of DCFH to the fluorescent product DCF was determined at 488 nm excitation and 525 nm emission using BD FACSCalibur Flow Cytometer (Becton Dickinson, USA). The results were evaluated according to DCF fluorescence intensity.
Total Antioxidant Capacity
Total antioxidant capacity of tissue and drug samples were determined using Ferric Reducing Antioxidant Power (FRAP) Assay Kit (Naxifer™- TAC Capacity Assay Kit, NS-15012, Iran) as described in manufacturer protocol.
Statistical analysis
The statistical analyses were carried out using GraphPad Prism 8.5 software (GraphPad
Software, San Diego, CA, USA). The paired samples t-test was performed to evaluate the diabetic group compared to the control group. Also, One-way analysis of variance (ANOVA) was used to make comparisons between all treatment groups. All experimental results are presented as mean ± SD. p-value < 0.05 represents significant difference between the samples.