Newly isolated Limosilactobacillus reuteri B1/1 modulates cell response in porcine ex vivo model mirroring the gut

doi:10.21203/rs.3.rs-3738075/v1

The epithelia of the intestine perform various functions, playing a crucial role in providing a physical barrier and an innate immune defence against infections. Creating a 3D model of cell co-cultures established with IPEC-J2 cell line and porcine blood monocyte-derived macrophages (MDMs), we are getting closer to mirroring the porcine intestine ex vivo. The effect of Limosilactobacillus reuteri B1/1 and Limosilactobacillus fermentum CCM 7158 on relative gene expression of interleukins (IL-1β, IL-6, IL-8, IL-18 and IL-10), genes encoding receptors for TLR4 and TLR2, tight junction proteins as claudin-1 (CLDN1), occludin (OCLN) and important antimicrobial proteins as lumican (LUM) and olfactomedin-4 (OLMF-4) was monitored in this model. The immunomodulatory potential of newly isolated L. reuteri B1/1 was confirmed as was able to suppress the enhanced pro-inflammatory response to LPS induction in both cell types. L. reuteriB1/1 was even able to up-regulate the mRNA levels of genes encoding antimicrobial proteins LUM and OLFM-4 and to increase TJ-related genes CLDN1 and OCLN, which were significantly down-regulated by LPS-infection in IPEC-J2 cells. Conversely, L. fermentum CCM 7158 which was chosen as an indicator lactic acid bacteria (LAB) strain, increased the mRNA levels of the investigated pro-inflammatory cytokines (IL-18, IL-6, and IL-1β) in MDM, when LPS was simultaneously applied to basally deposited macrophages. Although L. fermentum CCM 7158 induced the production of pro-inflammatory cytokines, synchronous up-regulation of the anti-inflammatory cytokine IL-10 was detected in both lactic acid bacteria LAB strains used in both cell cultures.

Co-culture

IPEC-J2

MDMs

lactobacilli

tight-junctions

cytokines

The increased productivity in livestock husbandry is associated with expanded demands on the quality of the meat produced. At the same time, the livestock industry represents an important economic activity in many countries. In large-scale farms, intensive conditions expose animals to stress, causing diseases and environmental decline, leading to significant economic losses. Treating these diseases has led to a surge in the use of veterinary drugs, fostering antimicrobial resistance and posing risks to consumers (Manyi-Loh et al., 2018). Health is closely tied to mucosal immunity and the intestinal microbiome. The intricate interactions between the host and gut microbiome impact nutrient exchange, influencing gut physiology, immunity, and morphology. On the other hand, the presence of intestinal pathogens can lead to undesirable changes in the morphology of the intestine (Pan and Yu, 2013). Thus, promoting sufficient cooperation and activation of the mucosal immune system, particularly through the production of antimicrobial proteins, is essential. Protein molecules such as lumican and olfactomedin-4 may promote intestinal homeostasis by initiating innate immune inflammatory responses that are beneficial in the early stages of enteritis and colitis (Karamanou et al., 2018; Cárdenas-León et al., 2022). The mucosal surface of the intestine is formed by an epithelium, while there are tight junctions (TJs) between the epithelial cells forming a continuous intercellular barrier, which is necessary for the separation of tissue spaces and the regulation of the selective movement of dissolved substances (González-Mariscal et al., 2003). Both the occludin and claudin family represent TJ transmembrane proteins capable of adhesively interacting with other molecules between adhered cells, including in terms of ion selectivity control (Hartsock and Nelson, 2008).

Consequently, there is a high demand for natural substances that have a beneficial effect on animal health, including protection against infectious diseases. Probiotic bacteria are undoubtedly among the most used substances of natural origin (Alagawany et al., 2021). The action of probiotics can vary depending on the properties of the specific probiotic bacteria used as well as their combination. Limosilactobacillus reuteri (L. reuteri) is among the most studied probiotic strains, which dominantly colonizes the intestine of mammals as well as humans. It is considered an "intestinal probiotic with prebiotic efficacy" because most of them show remarkable intestinal colonization including the secretion of bacteriocins, which also increases the expression of mucin genes, thus supporting the development and maturation of intestinal organoids and increasing the secretion of mucin itself (Jiang et al., 2023). Studying the mechanism of action for each probiotic strain is crucial. Typically, potential strains undergo microbiological testing in vitro and on 2D cell lines. However, these lines lack realism in mimicking natural organism reactions. Utilizing 3D animal gut models proves more suitable, offering a closer simulation of the in vivo intestinal environment and facilitating detailed study of bacteria-gut interactions. It's important to note that live animal experiments face legislative restrictions in the European Union due to ethical concerns (Díez-Solinska et al., 2022).

In a previous study we demonstrated that L. reuteri B1/1 exhibited substantial adherence to CLAB cells, especially at a concentration of 1 x 10⁹ CFU. This LAB strain not only influenced the gene expression of pro-inflammatory cytokines and the gene expression for lumican and olfactomedin-4, but also heightened the metabolic activity of the cells after a 4-hour incubation period. Due to the planned placement of the newly isolated L. reuteri B1/1 in the microorganism collection, we decided to further test it on a 3D model that more closely reflects the gut. Therefore, the present study aimed to monitor the effect of L. reuteri B1/1 and L. fermentum CCM 7158 which was chosen as an indicator LAB strain, on relative gene expression of interleukins (IL-1β, IL-6, IL-8, IL-18 and IL-10), genes encoding receptors for TLR4 and TLR2, tight junction proteins as claudin-1 (CLDN1), occludin (OCLN) and important antimicrobial proteins as lumican (LUM) and olfactomedin-4 (OLMF-4) produced by IPEC-J2 cell line and MDM cells in a 3D co-culture model.

Porcine intestinal epithelial cells

IPEC-J2 cell line was a kind gift from J.J. Garrido from the Department of Genetics and Animal Breeding at the University of Córdoba, Spain. Epithelial cells were maintained exactly as described previously in the study by Kiššová et al., (2022). After reaching a 75% monolayer confluency on culture flasks, the cells were released and transferred to a new culture falsk, as follows: cells were incubated with EDTA (1 mmol.L^− 1; Sigma-Aldrich, USA) for 5 minutes at 37°C with 5% CO₂, then EDTA solution was replaced with 1 x concentrated trypsin (Sigma-Aldrich, USA) for 10 min at 37°C with 5% CO₂ to release adhered cells from the flasks. The effect of trypsin was neutralized by adding 20% FBS from the total cell volume and the suspension was centrifuged at 300 x g for 5 minutes. IPEC-J2 cells were used from 25th to 35th passages, regularly controlled for mycoplasma contamination using PCR analysis (Young et al., 2010). For co-culture experiments the IPEC-J2 cells were handled according to the protocol described previously by Kiššová et al., (2023). Briefly, the IPEC-J2 cells were seeded on the top of collagenased cell culture inserts (Transwell® system, 12 mm diameter, 1.12 cm², 0.4 µm pore size; Costar, Corning BV, The Netherlands) at a density of 2.5 × 10⁵ cells per cell culture insert and were cultivated under a humidified atmosphere (5% CO₂ at 37°C) for 15 days.

Monocyte derived macrophages (MDMs)

Blood was taken under sterile conditions from the sinus supraorbitalis of clinically healthy pigs (10 to 12 week of age) Landras cross breeded with The Large White kept at the Clinic of Swine of the University of Veterinary Medicine and Pharmacy in Košice. The procedure of blood sample collection was managed in the same manner with the guidelines for animal welfare and was approved by the ethics committee for animal welfare, namely, “Ethics committee for the approval of research involving animals in accordance with the legislative requirements applicable at the UVMP in Košice” (Ethics committee at the UVMP in Košice, permit No. EKVP/2023-04). Blood samples were collected in 50 mL tubes filled with 1.5% heparin prepared in phosphate buffered saline (PBS). Mononuclear leukocytes (MNL) were obtained from the heparinized blood diluted 1:1 in PBS, underlayed with 15 mL separation solution (LSM1077 "Lymphocyte Separation Medium"; PAA, Austria) in Leucosep™ tubes (Greiner-Bio-One, Austria) and centrifuged (300 x g 20 min). MNLs were collected from the interface, then transferred into new 50 mL tubes and centrifuged (300 × g for 20 min) than the obtained cell pellet was washed twice more in 20 mL of PBS 300 × g for 20 min. After the last centrifugation, the supernatant was discarded and the MNL pellet was resuspended in 20 mL of RPMI 1640 (Roswell Park Memorial Institute-1640; Sigma-Aldrich, USA) medium. Two mililitre of cell suspension were placed into each of 12- well plate and monocytes were allowed to adhere during 2 h incubation at 37°C in 5% CO₂, after what the non-adherent cells were removed by washing with PBS. The generation of MDMs was handled according to modified culture protocol by (Raymond and Wilkie, 2005; Liu et al., 2016; Nedumpun et al., 2016). Adherent monocytes were incubated in RPMI 1640 culture media supplemented with glutamine (2 mmol.L^− 1; Lonza, Switzerland), heat-inactivated FBS (10%; Lonza, Switzerland), gentamicin (1%; PAA, Austria) and cytokine M-CSF (50 ng.mL^− 1; R&D Systems, USA) at a temperature of 37°C in an atmosphere enriched with 5% CO₂ for 5 days. The culture medium was changed every other day.

Bacterial strains

Limosilactobacillus reuteri B1/1 and Limosilactobacillus fermentum CCM 7158 strains were grown in de Man Rogosa Sharpe (MRS) broth (Merck) at 37°C overnight. The strains were then centrifuged at 500 x g for 10 min, the pellets were washed three times in PBS and resuspended in antibiotic-free DMEM/F12 medium. The concentration of bacteria was adjusted to 10⁷ CFU/mL according to optical density measurement at 600 nm (EON Biotek, USA). Enterocytes IPEC-J2 were treated with 100 µL of bacterial suspension per insert membrane.

Experimental design of the co-culture model of epithelial IPEC-J2 cell line and MDMs

Cell were grown on semipermeable membrane inserts as mentioned above, for 15 days to allow differentiation and establish tight epithelial monolayers. Fresh culture medium was changed every other day. On the day of the experiment, inserts with monolayers of differentiated IPEC-J2 cells were transferred to 12-well plates with differentiated MDMs at the bottom of the well. Complete antibiotic-free DMEM/F-12 medium was added to the upper and lower chamber of the inserts. Only confluent monolayers of differentiated IPEC-J2 growing on a semipermeable membrane for 13–15 days with TEER ≤ 1 kΩ / cm² were used in the experiments. L. reuteri or L. fermentum were added to differentiated IPEC-J2, and simultaneously LPS was added to MDMs cells representing the basolateral compartment of the co-culture model (Fig. 1). The effect of limosilactobacilli (1 x 10⁶ CFU/ insert) and LPS (1 µg/mL E. coli serotype O55:B5;Sigma-Aldrich, USA) on intestinal barrier markers (TEER, permeability) and changes in gene expression was evaluated after 24 hours of treatment.

Table 1

Table of cell treatment during experiments
Cell treatment	Design of experiments in co-cultures	Abbreviation
Control	IPEC-J2 or MDMs cells without treatment	-
LPS infection	MDMs cells were infected whit LPS (1 µg/mL) and incubated for 6 h	LPS
LF + LPS treatment	IPEC-J2 were cells treated with probiotic LF (1 x 10⁶ CFU/insert) and the MDMs cell were simultaneously infected with LPS (1 µg/mL) and incubated for 24 hours.	LF + LPS
LR + LPS treatment	IPEC-J2 were cells treated with probiotic LR (1 x 10⁶/insert) and the MDMs cell were simultaneously infected with LPS (1 µg/mL) and incubated for 24 hours.	LR + LPS

Determination of TEER and permeability

TEER was measured using an epithelial voltohmmeter EVOM2 (World Precision Instruments, USA) connected to the STX4 electrode. TEER change was monitored after 3, 6 and 24 hours and individual TEER values were calculated by subtracting the value of the empty insert and multiplying by the surface area of the membrane. TEER values at 3, 6 and 24 hours were normalized to the own TEER value of insert at 0 hour. To assess the integrity of the formed IPEC-J2 cell monolayer on insert membranes, the monolayer permeability test was carried out using fluorescent dye Lucifer Yellow (LY, Thermo Fisher Scientific, USA). Cell monolayers of differentiated epithelial cells were first washed with Hanks' balanced salt solution (HBSS; Sigma, Germany), and then 500 µL of LY solution in HBSS (40 µg/mL) was added to the apical side and 1300 µL of HBSS to the basolateral side of well, followed by incubation on a shaker in the dark. After 1 hour, the solution was collected from the basolateral side of the well and the fluorescence intensity was measured on a Synergy H4 hybrid plate reader (Bio-Tek instruments, USA) using a 485 nm excitation and 530 nm emission filters. All measurements were performed in triplicates.

Analysis of gene expression

Isolation of RNA and synthesis of complementary cDNA

A high-quality total RNA was isolated using the TRI reagent (Sigma-Aldrich, USA) and then purified by RNeasy mini kit (Qiagen, Manchester, UK) exactly according to the manufacturer's instructions. RNA purity and concentration were determined by spectrophotometer NanoPhotometer P-Class P 300 (Implen, Munich, Germany) at rations 260/280 nm 260/230, then was reversely transcribed using the iScript cDNA Synthesis Kit (Bio-Rad, Hercules, CA, USA) exactly according to the manufacturer's instructions. The resulting cDNA from the cells were stored at -18°C until further use.

Quantitative Polymerase Chain Reaction

The gene expression analysis was performed on Lightcycler 480 II Instrument (Roche Holding AG, Switzerland) using LightCycler^® Software (LightCycler® Software 4.1, Switzerland) in a 10 µL reaction volume consisting of 1 x SsoAdvanced^™ Universal SYBR Green Supermix (Bio-Rad Laboratories, Hercules, CA, USA), 0.5 µmol/L forward and reverse primers and 40 µg/µL cDNA (from IPEC-J2 or MDMs). All the used forward and reverse primers are listed in Table 2. For internal control hypoxanthine-guanine phosphoribosyltransferase (HPRT) was used as a reference gene in the case of IPEC-J2 cells and β-actin was used as an internal control for MDMs. The experimental protocol of qPCR consisted of an initial denaturation at 95°C for 30 s, followed by amplification in 37 cycles consisting of 3 main steps - denaturation at 95°C for 15 s, hybridization at 60°C for 30 s, and extension at 72°C for 2 min - followed by melting curve analysis to confirm amplification of the specific product. The relative normalized expression was evaluated using the 2^−∆∆CT method. The gene expression analysis was done in triplicates and is expressed as mean ± standard deviation (SD).

Table 2

Table of used primers
Gene	Primer	Sequence 5´→ 3´	Reference
β-actin	Forward	CATCACCATCGGCAACGA	(Moue et al., 2008)
β-actin	Reverse	GCGTAGAGGTCCTTCCTGATGT	(Moue et al., 2008)
HPRT	Forward	AACCTTGCTTTCCTTGGTCA	(Cinar et al., 2012)
HPRT	Reverse	TCAAGGGCATAGCCTACCAC	(Cinar et al., 2012)
IL-18	Forward	CTGCTGAACCGGAAGACAAT	(Moue et al., 2008)
IL-18	Reverse	TCCGATTCCAGGTCTTCATC	(Moue et al., 2008)
IL-1β	Forward	GCCCTGTACCCCAACTGGTA	(Kšonžeková et al., 2016)
IL-1β	Reverse	CCAGGAAGACGGGCTTTTG	(Kšonžeková et al., 2016)
IL-6	Forward	CCACCAGGAACGAAAGAGAG	(Shabir et al., 2018)
IL-6	Reverse	AGGCAGTAGCCATCACCAGA	(Shabir et al., 2018)
IL-8	Forward	TTATCGGAGGCCACAATAAG	(Dang et al., 2014)
IL-8	Reverse	TGGAATAGTAGATGGAGCCA	(Dang et al., 2014)
IL-10	Forward	TGTCATCAATTTCTGCCCTGT	(Zhao et al., 2020)
IL-10	Reverse	TCTTCATCGTCATGTAGGCTT	(Zhao et al., 2020)
TLR2	Forward	CCAGGCAAGTGGATTATTGA	(Yoon et al., 2023)
TLR2	Reverse	AAGAGACGGAAGTGGGAGAA	(Yoon et al., 2023)
TLR4	Forward	TGGTGTCCCAGCACTTCATA	(Byrne et al., 2021)
TLR4	Reverse	CGGCATGACTCCTCAGAAAC	(Byrne et al., 2021)
CLDN1	Forward	TGGTCAGGCTCTCTTCACTG	(Liu et al., 2022)
CLDN1	Reverse	TTGGATAGGGCCTTGGTGTT	(Liu et al., 2022)
OCLN	Forward	ATGCTTTCTCAGCCAGCGTA	(Xun et al., 2018)
OCLN	Reverse	AAGGTTCCATAGCCTCGGTC	(Xun et al., 2018)
LUM	Forward	ACCTGCGTTTGTCTCATAAT	(Karaffová et al., 2023)
LUM	Reverse	ATTGTAGGAGAGATCCAGCT	(Karaffová et al., 2023)
OLFM-4	Forward	GGTGATTTACGCAACTGAAG	(Karaffová et al., 2023)
OLFM-4	Reverse	GTTTGTACTGCTTGGTATGC	(Karaffová et al., 2023)

Statistical analysis

The results from the gene expression analysis are expressed as mean and the standard deviation (SD) of two independent experiments which were conducted in triplicates. Using GraphPad Prism 9.0.0 software the significant differences were determined by one-way analysis of variance (ANOVA) followed by Dunnett's multiple comparisons. The level of significance was set as P ≤ 0.05*, P ≤ 0.01** and P ≤ 0.001***.

TEER values

During the course of experiments the TEER values of the formed IPEC-J2 monolayers were measured after 3, 6 and 24 hours in order to monitor the integrity of the cell barrier (Fig. 2). As shown in Fig. 2, initial TEER values of the co-cultures did not differ from the control group of cells after 3 h of incubation. Bacterial infection of the IPEC-J2 cells in form of LPS infection decreased the measured TEER values after 6 h (P ≤ 0.05) and 24 h (P ≤ 0.001) of incubation, compared to the control group of cells. Twenty-four hour treatment of IPEC-J2 cells with either L. reuteri or L. fermentum also statistically significantly reduced TEER values relative to control, but TEER values were still above 1 kΩ.cm².

Assessment of monolayer permeability test

Lucifer yellow represent a small molecule able to cross through the epithelial barrier by passive paracellular diffusion. Given its hydrophilic nature and small molecular size, LY can be employed to chemically assess the functionality of tight junctions (Sharma et al., 2018). LPS induced a significant increase in LY flux measured after 24 hours. None of the lactobacilli were able to significantly attenuate the LPS-induced increase in permeability in accordance with the TEER results (Fig. 3).

Transcriptional answer of pro-inflammatory related genes in IPEC-J2 and MDM cells within the co-culture model

The pathological effect of LPS from E.coli was evaluated in an in vivo-like co-culture model by infection of MDM cells in the basolateral compartment. The effect of LPS was assessed by analyzing gene expression of important pro-inflammatory cytokines (IL-1β, IL-6, IL-8, IL-18) not only in directly treated MDM cells, but also in directly untreated IPEC-J2 cells in apical compartment. The results obtained from both cell cultures confirm the pathological action of LPS at the concentration used (1 ug/mL), as the monitored pro-inflammatory cytokines were significantly up-regulated in both cell cultures (Figs. 4 and 5). Direct stimulation of MDMs cells resulted in up-regulation of gene expression of IL-8 (P ≤ 0.001) (Fig. 5), meanwhile in undirectly treated IPEC-J2 cells an increased gene expression of IL-8 (P ≤ 0.05), IL-1β and IL-6 (P ≤ 0.001) was observed (Fig. 4).

The direct effect of live probiotic strains of L. reuteri B1/1 and L. fermentum CCM 7158 was investigated on IPEC-J2 cells representing the apical compartment of the co-culture model. The results obtained from gene expression of the pro-inflammatory cytokines IL-1β and IL-6 confirmed the anti-inflammatory effect of used probiotic strain L. reuteri B1/1, as reflected by the down-regulation of these genes compared to the LPS group of IPEC-J2 cells (P ≤ 0.001) (Fig. 4). However MDM cells were not directly treated with probiotics, we also confirmed a down-regulation for gene encoding IL-8 in cell treated with LF and LR (P ≤ 0.001) compared to LPS group experimental group (Fig. 5).

As a regulatory cytokine, we also investigated IL-10 expression, which was affected by probiotic bacterial culture of both LR and LF in both IPEC-J2 and MDMs, with statistical significance P ≤ 0.001 compared to the control group of cells in each culture (Figs. 4 and 5).

Transcriptional answer of TJ-related genes and toll like receptors in IPEC-J2 and MDM cells within the co-culture model

The influence of LPS from E.coli was investigated at an in vitro co-culture model by gene expression analysis of gene related to tight junction such as claudin-1 (CLDN1), lumican (LUM), olfactomedin-4 (OLFM-4) and occludin (OCLN). In directly treated MDMs cells with LPS, the down-regulation of LUM and CLDN (P ≤ 0.01) was noticed. However IPEC-J2 cell were directly not treated with LPS, in this undirectly infected group of cells were detected a down-regulation of investigated gene encoding OCLN (P ≤ 0.001), compared to control group of cells (Fig. 4).

In LR probitic treated group of IPEC-J2 cells were detected an up-regulation of mRNA levels for genes encoding OLFM, LUM and CLDN1 (P ≤ 0.001) compare to control, meanwhile an opposite trend was detected in LF treated probiotic group. L. fermentum CCM 7158 affected cells in the direction of decreasing the level of gene expression for molecule s CLDN1, LUM and OCLN (P ≤ 0.001) compare to control (Fig. 4).

TLR4 mRNA levels were up-regulated in LPS incubated group in case of IPEC-J2 cells (P ≤ 0.001), but not in MDMs (Figs. 4 and 5), nonetheless TLR2 mRNA levels were up-regulated in MDM cells (P ≤ 0.001), but in IPEC-J2 cell line due to low expression the transcriptional answer could not be evaluated for TLR2. Although in the case of TLR4 monitoring in IPEC-J2 and MDMs cells, and opposite trend was noted in probiotic treatment, while LR increased TLR4 expression in IPEC-J2 (P ≤ 0.001), there was no increased expression in MDMs cells. In contrary for LF treatment the mRNA level of TLR4 and TLR2 was increased in indirectly treated MDM cells (Fig. 5).

Within the body, the intestinal epithelium plays a number of important features such as digest and absorb nutrients, provides a physical barrier and shields the body from the challenging conditions of the gut lumen. The epithelial barrier secure selectivity, preventing potentially harmful luminal contents by rejection, meanwhile facilitating a controlled absorption and secretion of significant amounts of solutes and water in a specific direction. Individual epithelial cells are linked through a network of intercellular junctions - tight junction (TJ) which holds particular significance in defining the attributes of the paracellular barrier and its selectivity (Ma et al., 2018). To determine barrier strength, transepithelial electrical resistance (TEER) is commonly measured in in vitro cell models and permeability to paracellular markers such as the enzyme horseradish peroxidase, inulin or mannitol is assessed (Bernardini et al., 2021). Our results revealed that basolateral infection in the form of LPS had an effect on the reduction of TEER values already after 6 h of application. The fact that basolateral infection of cells with entero-invasive bacteria leads to a significant decrease in TEER was also demonstrated by Wine et al. (2009), who found that the basolateral aspect of the T84 cell line by infection with invasive E. coli (O157:H7) led to a significant decrease in TEER values. This reduction was more significant after basolateral application compared to apical of entero-invasive E. coli (Wine et al., 2009). There is evidence that other pathogens, such as C. jejuni, enter intestinal epithelial cells from the basolateral membrane, highlighting the importance of this finding (Monteville and Konkel, 2002).

In addition, it is well know, that the intestinal barrier function is, to some extent, supported by TJ proteins (Capaldo et al., 2017). Epithelial cell TJs are comprised of numerous junctional molecules including claudins, occludin and zonula occludens, which govern the paracellular permeability of various macromolecules, ions, and water between neighboring cells. Occludin is a key transmembrane protein in TJs, and both occludin and claudin-1 play essential roles in maintaining intestinal permeability and barrier function of TJs. There is evidence demonstrating that inflammation induced by LPS disrupts the integrity of intestinal epithelial cells and TJs (Wu et al., 2020). Disruption of the integrity of TJs leads to immune cell activation and inflammation processes in affected tissues (Suzuki, 2020). With agreement of the previous statement, in our study, a basolateral application of LPS to MDM cells affected the expression of gene encoding OCLN which resulted in significant down-regulation in IPEC-J2 cells representing the apical compartment. Similar results were reported by Zhao et al. (2019) in their study after treating IPEC-J2 cells with bacterial LPS, where they observed a decrease in mRNA levels for gene encoding OCLN (Zhao et al., 2020). Comparably, in the work of Wu et al. (2020), by applying LPS at a concentration of 1 µg/mL, observed down-regulation of expression for genes encoding the proteins occludin and claudin-1 (Wu et al., 2020).

On the other hand, strong adhesion provides the initial interaction of probiotics with intestinal epithelial cells, which is key for LAB strains to exert their beneficial effects on host health. Adhesion to intestinal cells limits the presence of potential pathogens, thereby providing protection to intestinal epithelial cells (IECs) (Guan et al., 2020). The genus Limosilactobacillus (līmōsus, Lat. - slimy), which also includes the strains L. reuteri and L. fermentum, is characterized by the property of most strains of this genus to produce exopolysaccharides (EPS) from sucrose to promote biofilm formation on epithelia in the gut (Zheng et al., 2020). In this study L. fermentum CCM 7158 was used as an indicator LAB strain since it is included in the Czech Collection of Microorganisms (CCM) and its characteristics have been widely studied both in in vitro and in vivo conditions in previous studies (Capcarova et al., 2010; Hrnčár et al., 2021, 2014; Mudroňová et al., 2006). An interesting finding in our work is that simultaneous treatment of MDM cells with LPS and treatment of IPEC-J2 with probiotic strain L. fermentum CCM 7158 led to down-regulation of mRNA for CLDN-1 and OCLN in intestinal cells. However, when L. reuteri B1/1 was used, the mRNA levels for the above-mentioned genes were significantly increased compared to the control group of cells. Similarly, genes encoding the antimicrobial proteins LUM and OLFM-4, which are also involved in maintaining the integrity of the intestinal epithelial layer (Karamanou et al., 2018), were significantly up-regulated in the L. reuteri B1/1 treatment of IPEC-J2 cells. In light of these results, we suggest that L. reuteri B1/1 may acts in a stimulatory manner on intestinal epithelia. Comparably, in our recent study, we observed stimulatory effect of L. reuteri B1/1 on non-carcinogenic porcine derived enterocytes (CLAB) at both used concentrations (10⁷ and 10⁹ CFU/mL) for mRNA transcription levels of LUM and OLFM-4 (Karaffová et al., 2023).

At the same time, enterocytes are an important component of the highly regulated communication network that provides protection to the intestinal mucosa, their ability to recognize microorganisms by pattern recognition receptors (PRR) is essential (Kagnoff, 2014). The best known of these PRR are the Toll-like receptors (TLRs). Interaction of microorganisms with TLRs either leads to activation and triggering of the signaling pathway or, conversely, through the mechanism of negative regulators, blocks their activation (Gao and Li, 2017). Structural components of the LAB cell wall, as well as the EPS they are able to produce and release to the surrounding environment, are capable to interact with TLRs in the gut (Oerlemans et al., 2021). In our previous study with the IPEC-J2/moDCs co-culture model, we demonstrated the ability of L. reuteri Biocenol™ derived EPS applied to increase mRNA levels in dendritic cell monocultures (Kiššová et al., 2023). In the present work we used live lactobacilli, where by treating apically deposited IPEC-J2 cells with L. fermentum CCM 7158, we observed an increase in gene expression for the gene encoding the TLR4 receptor not only in directly treated enterocytes but also in basolaterally deposited MDM cells. Although the gene encoding TLR2 could not be captured in IPEC-J2 due to the reduced gene expression level, but the expression of this gene was increased in MDMs. This up-regulation in basolaterally deposited macrophages correlates with the detected increased expression for the studied pro-inflammatory cytokines (IL-1β, IL-6, IL-18), exactly in this experimental group. We hypothesize that this increase of genes encoding TLR receptors implies actively maintaining the host's vigilance against pathogens. Our results are not surprising at all, because it is well known that TLR signaling triggers an initial cytokine reaction which intensifies the inflammatory response in the host, while engaging other cells in the fight against infectious agents. Macrophages participate in cytokine production following their TLR9, TLR2 and TLR4 activation by releasing cytokines such as IL-12, IL-1β, IL-6 and IL-10 (Strieter et al., 2003; Hoogerwerf et al., 2010; Juarez et al., 2010).

Numerous investigations have demonstrated that LPS disrupts structural integrity of the intestinal epithelia, triggers inflammation, and leads to the release of inflammatory cytokines such as IL-1β, IL-8, IL-6 and TNF-α (Cao et al., 2018; Wu et al., 2018; Gao et al., 2019). The results obtained from our study by monitoring mRNA transcriptional levels of pro-inflammatory cytokines (IL-8, IL-1β, IL-6, IL-18) in LPS-treated experimental group indicate an increased release of cytokines by each cell type. Similarly, previous studies have shown that LPS is able to induce inflammation in intestinal epithelial cells which was manifested by an increased levels of the monitored pro-inflammatory cytokines (Sargeant et al., 2011; Dong et al., 2019; Qiu et al., 2019). When comparing transcriptional levels of the studied pro-inflammatory cytokines in cells exposed to LPS and cells treated with L. reuteri B1/1 is obvious that simultaneous treatment of IPEC-J2 cells with LAB and LPS infection of MDMs significantly suppressed the inflammation induced by LPS infection alone without probiotic treatment. An interesting finding of our work, however, was the different cellular responses of both IPEC-J2 and MDMs to the two LAB strains used. While L. reuteri B1/1 had the potential to increase the expression of genes encoding the antimicrobial peptides LUM and OLFM-4, as well as genes encoding TJ-related genes (CLDN-1 and OCLN), we did not observe these effects in the case of L. fermentum CCM 7158. On the contrary, L. fermentum CCM 7158 was able to increase the mRNA levels of pro-inflammatory cytokines (IL-18, IL-6 and IL-1β) in indirectly treated MDM cells. Along with evaluating gene expression of pro-inflammatory cytokines, IL-10 and essential anti-inflammatory cytokine was assessed. IL-10 plays a pivotal role in preserving gut homeostasis, fine balance between inflammation processes triggered by pathogens and play a role in facilitating immunoregulatory mechanisms triggered by probiotics (Kaji et al., 2018; Sheil et al., 2006). In our experiment, cells from both the apical and basolateral compartments showed increased gene expression for this anti-inflammatory cytokine for both probiotic strains used and applied to IPEC-J2 cells. Although production of the anti-inflammatory cytokine IL-10 was observed in both LAB strains used in both cell cultures, we hypothesize that L. fermentum CCM 7158 has both an anti-inflammatory and immunostimulatory potential as it was able to increase pro-inflammatory cytokines upon simultaneous treatment with LPS in DMD cells. Similarly, in the study by Huang et al. (2012), they found that the strain E. faecium EF1 exhibits both anti-inflammatory and immunostimulatory activities after oral administration in suckling piglets (Huang et al., 2012). The simultaneous anti- and pro-inflammatory properties of probiotics have also been demonstrated in several other in vitro studies (De Moreno De Leblanc et al., 2007; Haller et al., 2000). However, it must be taken into account that different strains of probiotics have different effects on cellular activity, cytokine release and immunological interactions. Therefore, it is important to test bacterial strains under in vitro conditions, which allows the selection of toxic bacteria in order to reduce the number of preclinical tests performed on animals (Huang et al., 2020).

We investigated the immunomodulatory potential of a recently isolated LAB strain L. reuteri B1/1 and the indicator LAB strain L. fermentum CCM 7158 on the inflammatory response of the created 3D in vivo-like model to LPS infection. An in vitro immunoprotective potential of L. reuteri B1/1 was demonstrated as it was able to suppress the enhanced inflammatory response of both used cells to LPS infection. On the contrary, L. fermentum CCM 7158 increased the mRNA levels of all tested pro-inflammatory cytokines in indirectly treated MDM cells when LPS was simultaneously applied to basolaterally deposited macrophages. Although production of the anti-inflammatory cytokine IL-10 was observed in both LAB strains used in both cell cultures, we hypothesize both effects of L. fermentum – an anti-inflammatory and immunostimulatory. In addition, we demonstrated the ability of L. reuteri B1/1 to up-regulate the mRNA levels of genes encoding antimicrobial proteins LUM and OLFM-4 in directly treated IPEC-J2 cells. Moreover, L. reuteri B1/1 was able to increase TJ related genes CLDN1 and OCLN, which were significantly down-regulated by LPS infection. The obtained results suggest that the recently isolated LAB strain L. reuteri B1/1 have a potential in alleviating epithelial disruption caused by LPS and in influencing the production of antimicrobial molecules by enterocytes. On the other hand, additional research is required to enhance our comprehension of how L. reuteri B1/1 influences host mucosal immunity, the mechanism of action for possible commercial use of this new probiotic lactobacillus isolate.

Ethical Approval

The procedure of blood sampling was performed in accordance with the guidelines for animal welfare and was approved by the Ethics Committee for the approval of research involving animals by the legislative requirements applicable at the UVMP in Košice with permit No. EKVP/2023-04.

Competing interests

The authors declare no competing interests.

Authors' contributions

Conceptualization, Z.K., V.K. and J. S. Methodology, Data curation, Z.K. and J.S.; Formal analysis, Writing - Original draft preparation, Z.K. and V.K.; Supervision, D.M.; The cell cultures were established by Z.K., and J.S. Writing - Review and Editing Z.K. and V.K.; The management for research activity planning and the financial support for the project leading to this publication was performed by V.K. and D.M. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Slovak Research and Development Agency (APVV-21-0129) and the Grant agency for Science of Slovakia VEGA 1/0098/22 from the Ministry of Education, Science, Research and Sport of the Slovak Republic.

Availability of data and materials

Not applicable.

Conflict of interest

The authors have no pertinent financial or non-financial conflicts of interest to declare.

Alagawany M, Elnesr SS, Farag MR, Abd El-Hack ME, Barkat RA, Gabr AA, Foda MA, Noreldin AE, Khafaga AF, El-Sabrout K, Elwan HAM, Tiwari R, Yatoo MI, Michalak I, Di Cerbo A, Dhama K (2021) Potential role of important nutraceuticals in poultry performance and health - A comprehensive review. Res Vet Sci 137:9–29. https://doi.org/10.1016/j.rvsc.2021.04.009
Bernardini C, Algieri C, Mantia LD, Zannoni A, Salaroli R, Trombetti F, Forni M, Pagliarani A, Nesci S (2021) Relationship between serum concentration, functional parameters and cell bioenergetics in IPEC-J2 cell line. Histochem Cell Biol 156:59–67. https://doi.org/10.1007/s00418-021-01981-2
Byrne KA, Tuggle CK, Loving CL (2021) Differential induction of innate memory in porcine monocytes by β-glucan or bacillus Calmette-Guerin. Innate Immun 27:448–460. https://doi.org/10.1177/1753425920951607
Cao S, Zhang Q, Wang CC, Wu H, Jiao L, Hong Q, Hu C (2018) LPS challenge increased intestinal permeability, disrupted mitochondrial function and triggered mitophagy of piglets. Innate Immun 24:221–230. https://doi.org/10.1177/1753425918769372
Capaldo CT, Powell DN, Kalman D (2017) Layered defense: how mucus and tight junctions seal the intestinal barrier. J Mol Med 95:927–934. https://doi.org/10.1007/s00109-017-1557-x
Capcarova M, Weiss J, Hrncar C, Kolesarova A, Pal G (2010) Effect of Lactobacillus fermentum and Enterococcus faecium strains on internal milieu, antioxidant status and body weight of broiler chickens. J Anim Physiol Anim Nutr (Berl) 94:215–224. https://doi.org/10.1111/j.1439-0396.2010.01010.x
Cárdenas-León CG, Klaas M, Mäemets-Allas K, Arak T, Eller M, Jaks V (2022) Olfactomedin 4 regulates migration and proliferation of immortalized non-transformed keratinocytes through modulation of the cell cycle machinery and actin cytoskeleton remodelling. Exp Cell Res 415. https://doi.org/10.1016/j.yexcr.2022.113111
Cinar MU, Islam MA, Uddin MJ, Tholen E, Tesfaye D, Looft C, Schellander K (2012) Evaluation of suitable reference genes for gene expression studies in porcine alveolar macrophages in response to LPS and LTA. BMC Res Notes 5:107. https://doi.org/10.1186/1756-0500-5-107
Dang Y, Lachance C, Wang Y, Gagnon CA, Savard C, Segura M, Grenier D, Gottschalk M (2014) Transcriptional approach to study porcine tracheal epithelial cells individually or dually infected with swine influenza virus and Streptococcus suis. BMC Vet Res 10:1–11. https://doi.org/10.1186/1746-6148-10-86
De Leblanc M, Chaves A, Carmuega S, Weill E, Antóine R, Perdigón J G (2007) Effect of long-term continuous consumption of fermented milk containing probiotic bacteria on mucosal immunity and the activity of peritoneal macrophages. Immunobiology 213:97–108. https://doi:10.1016/j.imbio.2007.07.002
Díez-Solinska A, Vegas O, Azkona G (2022) Refinement in the European Union: A Systematic Review. Animals 12:1–13. https://doi.org/10.3390/ani12233263
Dong N, Xu X, Xue C, Wang C, Li X, Bi C, Shan A (2019) Ethyl pyruvate inhibits LPS induced IPEC-J2 inflammation and apoptosis through p38 and ERK1/2 pathways. Cell Cycle 18:2614–2628. https://doi.org/10.1080/15384101.2019.1653106
Gao D, Li W (2017) Perspective on TLR Recognition Mode Structures and Recognition Modes of Toll-Like Receptors. Proteins 85:3–9. https://doi.org/10.1002/prot.25179
Gao Z, Liu X, Wang W, Yang Q, Dong Y, Xu N, Zhang C, Song X, Ren Z, Zhao F, Zhang J, Jia L (2019) Characteristic anti-inflammatory and antioxidative effects of enzymatic- and acidic- hydrolysed mycelium polysaccharides by Oudemansiella radicata on LPS-induced lung injury. Carbohydr Polym 204:142–151. https://doi.org/10.1016/j.carbpol.2018.09.073
González-Mariscal L, Betanzos A, Nava P, Jaramillo BE (2003) Tight junction proteins. Prog Biophys Mol Biol 81(1):1–44. https://doi.org/10.1016/S0079-6107(02)00037-8
Guan C, Chen X, Jiang X, Zhao R, Yuan Y, Chen D, Zhang C, Lu M, Lu Z, Gu R (2020) In vitro studies of adhesion properties of six lactic acid bacteria isolated from the longevous population of China. RSC Adv 10:24234–24240. https://doi.org/10.1039/d0ra03517c
Haller D, Bode C, Hammes WP, Pfeifer AMA, Schiffrin EJ, Blum S (2000) Non-pathogenic bacteria elicit a differential cytokine response by intestinal epithelial cell/leucocyte co-cultures. Gut 47:79–87. https://doi.org/10.1136/gut.47.1.79
Hartsock A, Nelson WJ (2008) Adherens and tight junctions: Structure, function and connections to the actin cytoskeleton. Biochim Biophys Acta 3:660–669. https://doi:10.1016/j.bbamem.2007.07.012
Hoogerwerf JJ, De Vos AF, Van’t Veer C, Bresser P, De Boer A, Tanck MWT, Draing C, Van Der Zee JS, Van Der Poll T (2010) Priming of alveolar macrophages upon instillation of lipopolysaccharide in the human lung. Am J Respir Cell Mol Biol 42:349–356. https://doi.org/10.1165/rcmb.2008-0362OC
Hrnčár C, Weis J, Baraňska B, Malíková L, Petričová Ľ (2021) The Effect of different probiotic strains on fattening and carcass parameters of broiler ducks. J Microbiol Biotechnol Food Sci 2:1155–1163
Hrnčár C, Weis J, Mindek S, Bujko J (2014) Effect of probiotic addition in drinking water on body weight and body measurements of broiler chickens. Sci Pap Anim Sci Biotechnol 47:2
Huang W, Percie du Sert N, Vollert J, Rice ASC (2020) General Principles of Preclinical Study Design. Handb Exp Pharmacol 257:55–69. https://doi.org/10.1007/164_2019_277
Huang Y, Li YL, Huang Q, Cui ZW, Yu DY, Rajput IR, Hu CH, Li WF (2012) Effect of orally administered Enterococcus faecium EF1 on intestinal cytokines and chemokines production of Suckling Piglets. Pak Vet J 32:2074–7764
Jiang J, Li K, Xiao Y, Zhong A, Tang J, Duan Y, Li Z (2023) Limosilactobacillus reuteri regulating intestinal function: a review. Fermentation 9 https://doi.org/10.3390/fermentation9010019
Juarez E, Nuñez C, Sada E, Ellner JJ, Schwander SK, Torres M (2010) Differential expression of Toll-like receptors on human alveolar macrophages and autologous peripheral monocytes. Respir Res 11:1–13. https://doi.org/10.1186/1465-9921-11-2
Kagnoff MF (2014) The intestinal epithelium is an integral component of a communications network. J Clin Invest 124:2841–2843. https://doi.org/10.1172/JCI75225
Kaji R, Kiyoshima-Shibata J, Tsujibe S, Nanno M, Shida K (2018) Short communication: probiotic induction of interleukin-10 and interleukin-12 production by macrophages is modulated by co-stimulation with microbial components. J Dairy Sci 101:2838–2841. https://doi.org/10.3168/jds.2017-13868
Karaffová V, Teleky J, Pintarič M, Langerholc T, Mudroňová D, Hudec E, Ševčíková Z (2023) Application of Lactobacillus reuteri B1/1 (Limosilactobacillus reuteri) improves immunological profile of the non-carcinogenic porcine-derived enterocytes. Life 13:1–14. https://doi.org/10.3390/life13051090
Karamanou K, Perrot G, Maquart FX, Brézillon S (2018) Lumican as a multivalent effector in wound healing. Adv Drug Deliv Rev 129:344–351. https://doi.org/10.1016/j.addr.2018.02.011
Kiššová Z, Mudroňová D, Link R, Tkáčiková Ľ (2023) Immunomodulatory effect of probiotic exopolysaccharides in a porcine in vitro co – culture model mimicking the intestinal environment on ETEC infection. Vet Res Commun (2023) https://doi.org/10.1007/s11259-023-10237-4
Kiššová Z, Tkáčiková Ľ, Mudroňová D, Bhide M (2022) Immunomodulatory effect of Lactobacillus reuteri (Limosilactobacillus reuteri) and its exopolysaccharides investigated on epithelial cell line IPEC-J2 challenged with Salmonella Typhimurium. Life 12:1955. https://doi.org/10.3390/life12121955
Kšonžeková P, Bystrický P, Vlčková S, Pätoprstý V, Pulzová L, Mudroňová D, Kubašková T, Csank T, Tkáčiková L (2016) Exopolysaccharides of Lactobacillus reuteri: Their influence on adherence of E. coli to epithelial cells and inflammatory response. Carbohydr Polym 141:10–19. https://doi.org/10.1016/j.carbpol.2015.12.037
Liu J, Tian ZY, Xiao YC, Wang XL, Jin ML, Shi DS (2016) The role of porcine monocyte derived dendritic cells (MoDC) in the inflammation storm caused by streptococcus suis serotype 2 infection. PLoS ONE 11:1–13. https://doi.org/10.1371/journal.pone.0151256
Liu M, Wang Q, Wu W, Chen M, Zhang P, Guo M, Lin H, Ma Z, Zhou H, Fan H (2022) Glaesserella parasuis serotype 5 breaches the porcine respiratory epithelial barrier by inducing autophagy and blocking the cell membrane Claudin-1 replenishment. PLoS Pathog 18:1–19. https://doi.org/10.1371/journal.ppat.1010912
Ma TY, Nighot P, Al-Sadi R (2018) Tight junctions and the intestinal barrier, sixth edit. ed, physiology of the gastrointestinal tract, Sixth Edition. Elsevier Inc. https://doi.org/10.1016/B978-0-12-809954-4.00025-6
Manyi-Loh C, Mamphweli S, Meyer E, Okoh A (2018) Antibiotic use in agriculture and its consequential resistance in environmental sources: Potential public health implications. Molecules 23(4):795. https://doi.org/10.3390/molecules23040795
Monteville MR, Konkel ME (2002) Fibronectin-facilitated invasion of T84 eukaryotic cells by Campylobacter jejuni occurs preferentially at the basolateral cell surface. Infect Immun 70:6665–6671. https://doi.org/10.1128/IAI.70.12.6665-6671.2002
Moue M, Tohno M, Shimazu T, Kido T, Aso H, Saito T, Kitazaw H (2008) Toll-like receptor 4 and cytokine expression involved in functional immune response in an originally established porcine intestinal epitheliocyte cell line. Biochim Biophys Acta - Gen Subj 1780:134–144. https://doi.org/10.1016/j.bbagen.2007.11.006
Mudroňová D, Nemcová R, Laukova A, Koščová J, Strompfová V, Katarína G, Erika S, Gabriel L (2006) Effect of Lactobacillus fermentum alone, and in combination with zinc (II) propionate on Salmonella enterica serovar Dusseldorf in Japanese quails. Biol (Bratisl) 61:797–801
Nedumpun T, Ritprajak P, Suradhat S (2016) Generation of potent porcine monocyte-derived dendritic cells (MoDCs) by modified culture protocol. Vet Immunol Immunopathol 182:63–68. https://doi.org/10.1016/j.vetimm.2016.10.002
Oerlemans MMP, Akkerman R, Ferrari M, Walvoort MTC, de Vos P (2021) Benefits of bacteria-derived exopolysaccharides on gastrointestinal microbiota, immunity and health. J Funct Foods 76:104289. https://doi.org/10.1016/j.jff.2020.104289
Pan D, Yu Z (2013) Intestinal microbiome of poultry and its interaction with host and diet. Gut Microbes 5:108–119. https://doi.org/10.4161/gmic.26945
Qiu Y, Yang X, Wang L, Gao K, Jiang Z (2019) L-arginine inhibited inflammatory response and oxidative stress induced by lipopolysaccharide via arginase-1 signaling in IPEC-J2 cells. Int J Mol Sci 20:1–14. https://doi.org/10.3390/ijms20071800
Raymond CR, Wilkie BN (2005) Toll-like receptor, MHC II, B7 and cytokine expression by porcine monocytes and monocyte-derived dendritic cells in response to microbial pathogen-associated molecular patterns. Vet Immunol Immunopathol 107:235–247. https://doi.org/10.1016/j.vetimm.2005.05.008
Sargeant HR, Miller HM, Shaw MA (2011) Inflammatory response of porcine epithelial IPEC J2 cells to enterotoxigenic E. coli infection is modulated by zinc supplementation. Mol Immunol 48:2113–2121. https://doi.org/10.1016/j.molimm.2011.07.002
Shabir N, Khatun A, Nazki S, Gu S, Lee SM, Hur TY, Yang MS, Kim B, Kim W, Il (2018) In vitro immune responses of porcine alveolar macrophages reflect host immune responses against porcine reproductive and respiratory syndrome viruses. BMC Vet Res 14:1–13. https://doi.org/10.1186/s12917-018-1675-x
Sharma B, Luhach K, Kulkarni GT (2018) In vitro and in vivo models of BBB to evaluate brain targeting drug delivery, brain targeted drug delivery systems: a focus on nanotechnology and nanoparticulates. Acad Press Elsevier Ltd 53:101. https://doi.org/10.1016/B978-0-12-814001-7.00004-4
Sheil B, MacSharry J, O’Callaghan L, O’Riordan A, Waters A, Morgan J, Collins JK, O’Mahony L, Shanahan F (2006) Role of interleukin (IL-10) in probiotic-mediated immune modulation: An assessment in wild-type and IL-10 knock-out mice. Clin Exp Immunol 144:273–280. https://doi.org/10.1111/j.1365-2249.2006.03051.x
Strieter RM, Belperio JA, Keane MP (2003) Host innate defenses in the lung: The role of cytokines. Curr Opin Infect Dis 16:193–198. https://doi.org/10.1097/00001432-200306000-00002
Suzuki T (2020) Regulation of the intestinal barrier by nutrients: The role of tight junctions. Anim Sci J 91:1–12. https://doi.org/10.1111/asj.13357
Wine E, Ossa JC, Gray-Owen SD, Sherman PM (2009) Adherent-invasive Escherichia coli, strain LF82 disrupts apical junctional complexes in polarized epithelia. BMC Microbiol 9:1–11. https://doi.org/10.1186/1471-2180-9-180
Wu J, He C, Bu J, Luo Y, Yang S, Ye C, Yu S, He B, Yin Y, Yang X (2020) Betaine attenuates LPS-induced downregulation of Occludin and Claudin-1 and restores intestinal barrier function. BMC Vet Res 16:1–8. https://doi.org/10.1186/s12917-020-02298-3
Wu W, Wang S, Liu Q, Wang X, Shan T, Wang Y (2018) Cathelicidin-WA attenuates LPS-induced inflammation and redox imbalance through activation of AMPK signaling. Free Radic Biol Med 129:338–353. https://doi.org/10.1016/j.freeradbiomed.2018.09.045
Xun W, Shi L, Zhou H, Hou G, Cao T (2018) Effect of weaning age on intestinal mucosal morphology, permeability, gene expression of tight junction proteins, cytokines and secretory IgA in Wuzhishan mini piglets. Ital J Anim Sci 17:976–983. https://doi.org/10.1080/1828051X.2018.1426397
Yoon JW, Shin S, Park JW, Lee BR, Lee SI (2023) TLR/MyD88-mediated inflammation induced in porcine intestinal epithelial cells by ochratoxin A affects intestinal barrier function. Toxics 11. https://doi.org/10.3390/toxics11050437
Young L, Sung J, Masters JR (2010) Detection of mycoplasma in cell cultures. Nat Protoc 5:929–934. https://doi.org/10.1038/nprot.2010.43
Zhao L, Li M, Sun K, Su S, Geng T, Sun H (2020) Hippophae rhamnoides polysaccharides protect IPEC-J2 cells from LPS-induced inflammation, apoptosis and barrier dysfunction in vitro via inhibiting TLR4/NF-κB signaling pathway. Int J Biol Macromol 155:1202–1215. https://doi.org/10.1016/j.ijbiomac.2019.11.088
Zheng J, Wittouck S, Salvetti E, Franz C M A P, Harris HMB, Mattarelli P, O’toole P W, Pot B, Vandamme P, Walter J, Watanabe K, Wuyts S, Felis GE, Gänzle MG, Lebeer S (2020) A taxonomic note on the genus Lactobacillus: Description of 23 novel genera, emended description of the genus Lactobacillus beijerinck 1901, and union of Lactobacillaceae and Leuconostocaceae. Int J Syst Evol Microbiol 70:2782–2858. https://doi.org/10.1099/ijsem.0.004107

No competing interests reported.

Newly isolated Limosilactobacillus reuteri B1/1 modulates cell response in porcine ex vivo model mirroring the gut

Status:

Version 1

Abstract

Figures

Introduction

Material and Methods

Results

TEER values

Discussion

Conclusion

Declarations

References

Additional Declarations

Status:

Version 1