A novel role of AIM2 inflammasome-mediated pyroptosis in radiofrequency ablation of hepatocellular carcinoma

doi:10.21203/rs.3.rs-3753471/v1

Download PDF

Research Article

A novel role of AIM2 inflammasome-mediated pyroptosis in radiofrequency ablation of hepatocellular carcinoma

https://doi.org/10.21203/rs.3.rs-3753471/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 30 Jun, 2024

Read the published version in Annals of Hepatology →

Version 1

posted

You are reading this latest preprint version

Background

Hepatic inflammation and inflammasome-mediated mechanisms are involved in the pathogenesis of hepatocellular carcinoma (HCC). The absent in melanoma 2 (AIM2) protein triggers activation of the inflammasome cascade. It currently remains unclear whether AIM2 plays a role in HCC and radiofrequency ablation (RFA), which uses radiofrequency waves to treat tumors. This study aimed to investigate whether RFA can induce pyroptosis, also known as cell inflammatory necrosis, in HCC through AIM2-inflammasome signaling in vivo and in vitro.

Methods

BALB/c nude mice were used to generate HepG2 or SMMC-7721 cell-derived tumor xenografts. HCC cells with knockdown or overexpression of AIM2 were created using short hairpin RNA (shRNA) and expression vector transfection, respectively, for functional and mechanistic studies. Downstream effects were examined using flow cytometry, qRT-PCR, ELISAs, and other molecular assays.

Results

RFA could significantly suppress tumor growth in mice bearing HCC cell xenografts. Flow cytometry analysis revealed that RFA could induce pyroptosis. Furthermore, AIM2, NLRP3, caspase-1, γ-H2AX, and DNA-PKc had significantly greater expression levels in the liver tissues from mice treated with RFA compared with those of the controls. Additionally, interleukin (IL)-1β and IL-18 expression levels were significantly higher in the HCC cell-derived xenograft mice treated with RFA compared with those without RFA. Notably, a significantly greater effect was achieved in the RFA complete ablation group versus the partial ablation group. Moreover, knockdown or overexpression of AIM2 in HCC cells demonstrated that AIM2 exerted a role in RFA-induced pyroptosis.

Conclusions

These data indicate that RFA can suppress HCC tumor growth by inducing pyroptosis via AIM2, which serves as an important cell death mechanism. Therefore, therapeutically intervening with AIM2-mediated inflammasome signaling may help improve RFA treatment outcomes for HCC patients.

Absent in melanoma 2

Hepatocellular carcinoma

Inflammasome

Pyroptosis

Radiofrequency ablation

Hepatocellular carcinoma (HCC) is one of the most common malignancies and a leading cause of cancer-related deaths globally [1]. According to the World Health Organization, about 750,000 new HCC cases occur worldwide each year [2]. Notably, the majority of HCC cases occur in Asian countries [3]. In China, the HCC incidence is considerably high, accounting for approximately 50% of all newly diagnosed HCC cases across the world, with about 326,000 patients dying each year. This can be attributed to the particularly high prevalence of chronic hepatitis B virus (HBV) infection [3, 4, 5]. In fact, HBV and hepatitis C virus (HCV) are common causes of chronic hepatitis and progressively cause inflammation of the liver. Although the exact pathogenic mechanisms underlying HCC remain to be elucidated, hepatic inflammation and inflammasome-mediated molecular mechanisms have been proposed to play roles in the pathogenesis of HBV- and HCV-related HCC. In addition, HCC is considered an inflammation-related malignancy [6, 7, 8, 9]. For example, nonalcoholic steatohepatitis (NASH) is a progressive form of nonalcoholic fatty liver disease that is associated with hepatocyte injury and liver inflammation. NASH is a major risk factor for developing HCC and involves complex immune responses that are not fully clear.

Of the various treatment methods for HCC, radiofrequency ablation (RFA) has emerged as an effective and safe approach for patients with small-sized tumors, usually 3 cm or less in diameter. Compared with traditional hepatic resection and liver transplantation, RFA has been associated with less invasiveness and a shorter hospital stay. Under the guidance of imaging, one or more thin needles are inserted through the skin into the tumor. A RF current is then established, which generates a high temperature and leads to tumor cell necrosis [10]. Despite the advantages and increasing application of RFA for treating HCC, the molecular details underlying its specific mechanism of action are not well understood.

Absent in melanoma 2 (AIM2) is a cytosolic receptor in the pyrin and HIN domain-containing protein family [11, 12]. AIM2 can sense and bind to both double-stranded DNA and apoptosis-associated speck-like protein, thus triggering activation of the inflammasome signaling cascade and assembly of the AIM2 inflammasome [13, 14, 15]. Activation of the AIM2 inflammasome, which consists of multiple proteins, represents a key aspect of inflammation pathways. The AIM2 inflammasome can activate caspase-1, leading to the induction, maturation, and release of key pro-inflammatory cytokines, such as interleukin (IL)-1β and IL-18 [16]. Therefore, the AIM2 inflammasome possesses both pro-inflammatory and pro-pyroptotic properties to mediate pyroptosis, a type of programmed cell death that is also known as cell inflammatory necrosis. During this process, the cells continue to expand until the cell membrane bursts, which results in cellular content release and activation of a strong inflammatory response.

Pyroptosis has been implicated in host defense mechanisms, thus combating microbial invasion, carcinogenesis, and cancer progression. Several previous studies have reported that AIM2 expression levels are decreased in HCC tissues compared with histologically normal tissues [17, 18]. Additionally, lower AIM2 expression levels are significantly correlated with more advanced HCC [19, 20]. Currently, how AIM2 is involved in HCC remains largely unknown. In addition, whether AIM2 exerts a role in the RFA mechanism of action in HCC has not yet been explored.

In the present study, we aimed to investigate the roles of AIM2 in HCC and explore the use of RFA for treating this disease. In vitro experiments with hepatoma cells and in vivo work with a xenograft tumor mouse model were conducted. Our results suggested that AIM2-mediated activation of inflammasome signaling is an important cell death mechanism in HCC. Lower AIM2 levels are significantly correlated with more advanced HCC cases. The findings obtained in this study may offer a better understanding of the biological function of AIM2, the AIM2 inflammasome, and pyroptosis in HCC, thereby potentially helping to improve RFA-based treatment methods for HCC.

Cell culture

Two human HCC cell lines, HepG2 and SMMC-7721, were obtained from Shanghai Binsui Biotechnology (Shanghai, China) and used for the in vitro studies. The HepG2 and SMMC-7721 cells were cultured in RPMI 1640 medium (Hyclone, Marlborough, MA, USA) supplemented with 10% fetal bovine serum (FBS), 100 µg/mL streptomycin, and 100 units/mL penicillin. Cells were incubated at 37ºC and 5% CO₂.

Experimental animals

BALB/c nude mice (4–6 weeks old) were purchased from Jiangsu Synthgene Biotechnology Co., Ltd. (Nanjing, Jiangsu, China). The mice were housed under controlled conditions and given access to tap water ad libitum throughout the experimental period. To establish the HepG2 and SMMC-7721 cell-derived tumor xenograft animal models, BALB/c nude mice were subcutaneously injected with HepG2 cells (1×10⁷ cells suspended in 100 µL of serum-free medium) or SMMC-7721 cells (1×10⁷ cells suspended in 100 µL of serum-free medium). HepG2 or SMMC-7721 cell-derived xenograft nude mice were randomly assigned to receive RFA complete ablation (no remaining tumor), RFA partial ablation (some tumor remaining), or no ablation as a control (non-ablation). Blood samples were taken from the mice via the jugular vein, then were centrifuged at 1,110 × g for five minutes to separate the serum. Four weeks following the treatment, the mice were anesthetized and sacrificed by cervical dislocation, then the tumors were collected. The weights and volumes of the excised tumors were analyzed.

The study involving experimental mice was reviewed and approved by the Ethics Committee of Changzhou First People’s Hospital (Approval No. 2018-025). All methods were carried out in accordance with the local institutional and national guidelines and regulations. In addition, the experiments were performed in compliance with the international regulations for the use of laboratory animals.

RFA

HepG2 or SMMC-7721 cell-derived xenograft nude mice were treated with RFA using a Cool-tip™ RFA Electrode kit (Covidien IIc, Mansfield, MA, USA) according to the manufacturer’s protocol. For the in vitro study, RFA was performed using a thermal needle to treat SMMC-7721 cells.

Histology

Tumor tissues from the HepG2 and SMMC-7721 cell-derived xenograft nude mice were formalin fixed, paraffin-embedded (FFPE), then cut into 2-µm sections. After staining with hematoxylin and eosin (H&E), the slides were examined by light microscopy.

Immunohistochemistry (IHC)

IHC analysis was performed to assess the protein expression levels of AIM2, NLRP3, and caspase-1 in the liver tissues from HepG2 and SMMC-7721 cell-derived xenograft nude mice treated with or without RFA. The liver tissues were processed into FFPE blocks. These FFPE liver tissue samples were sectioned and hydrated, then incubated with primary antibodies (1:1000 for all), including those targeting AIM2 (Abcam, ab204995), NLRP3 (Abcam, ab263899), and caspase-1 (Abcam, ab207802), at 4°C overnight. The sections were then incubated with horseradish peroxidase (HRP)-conjugated secondary antibodies at 37°C for 30 minutes. The slides were incubated with 3,3′-diaminobenzidine (DAB), a substrate for HRP, using a DAB Peroxidase Substrate kit according to the manufacturer’s instructions (Vector Laboratories, Burlingame, CA, USA). Images were taken using an Olympus digital electron microscope (Olympus, Tokyo, Japan). The immunoreactivities of the IHC images were evaluated for each slide.

Overexpression of AIM2

The pcDNA 3.1 vector was used to construct the expression vector (OS-AIM2) by inserting the AIM2-encoding cDNA sequence. The successful construction of OS-AIM2 was verified by sequencing. SMMC-7721 cells were transfected with OS-AIM2 for overexpression of AIM2 using Lipofectamine 2000 Reagent (Invitrogen, Carlsbad, CA, USA).

Knockdown of AIM2

AIM2 was knocked down using short hairpin RNAs (shRNAs). Two shRNAs were designed to target AIM2 (AIM2-shRNA1 and AIM2-shRNA2). A scramble shRNA was used as a negative control. The specific sequences were as follows: AIM2-shRNA1, forward: 5′-CCGGCAGCCATCAGAAATGATGTCGCAAACTCGAGGAATTTTGCGACATCATTTCTGATGGCTGTTTTTG-3′, reverse: 5′-AATTCAAAAACAGCCATCAGAAATGATGTCGCAAAATTCCTCGAGTTTGCGACATCATTTCTGATGGCTG-3′; AIM2-shRNA2, forward: 5′-CCGGGAGATAAGGTTCGACTTACATTCTTCTCGAGAAGAATGTAAGTCGAACCTTATCTCTTTTTG-3′, reverse: 5′-AATTCAAAAAGAGATAAGGTTCGACTTACATTCTTCTCGAGAAGAATGTAAGTCGAACCTTATCTC-3′; scramble, forward: 5′-CCGGAACAGTCGCGTTTGCGACTGGCTCGAGCCAGTCGCAAACGCGACTGTTTTTTTG-3′, reverse: 5′-AATTCAAAAAAACAGTCGCGTTTGCGACTGGCTCGAGCCAGTCGCAAACGCGACTGTT-3′. SMMC-7721 cells were transfected with shRNAs using Lipofectamine 2000 Reagent.

Lactate dehydrogenase (LDH) release assay

Cellular damage and proliferation were measured using an LDH release assay. SMMC-7721 cell culture supernatants were examined using an LDH release assay kit (Abcam) according to the manufacturer’s instructions. Cells (1×10⁵ cells/mL) were seeded in 96-well plates for these assays, with 100 µL cell suspension per well.

Flow cytometry analysis of pyroptotic cells

Pyroptosis was measured on a flow cytometer (Becton, Dickinson and Company, Franklin Lakes, NJ, USA). Fluorescent-labeled inhibitors of caspase (FLICA) probe assays (AAT Bioquest, Sunnyvale, CA, USA) were conducted to examine pyroptosis according to the manufacturer’s instructions. Pyroptotic cells were specifically stained by FAM-FLICA-caspase-1 and propidium iodide staining.

Enzyme-linked immunosorbent assays (ELISAs)

ELISAs were performed to determine the serum levels of IL-1β and IL-18 in HepG2 and SMMC-7721 cell-derived xenograft nude mice treated with or without RFA, as well as in the SMMC-7721 cell culture supernatants, following instructions included in the specific Abcam kits. For ELISAs, cells (1×10⁵ cells/mL) were seeded in 96-well plates, with 100 µL cell suspension per well.

Real-time quantitative reverse transcription–polymerase chain reaction (qRT-PCR)

Total RNA was extracted from SMMC-7721 cells using TRIzol (Invitrogen). The total RNA samples were reverse transcribed into cDNA using the Vazyme Biotech (Nanjing, China) reverse transcription kit according to the manufacturer's instructions. Then, qRT-PCR reactions (20 µL) were performed to measure the relative mRNA expression levels of target genes (pyroptosis-related genes) using the 2× ChamQ Universal SYBR qPCR Master Mix (Vazyme Biotech) and 10 µM of each primer. β-actin expression was used as an internal control. The relative mRNA levels of target genes were obtained by using the 2^-ΔΔCt method, with all assays performed in triplicate. Fold-change values were calculated by comparative Ct analysis after normalization to β-actin. The sequences of the primers used in the qRT-PCR analysis were as follows: AIM2, forward primer: 5ʹ-ATCAGGAGGCTGATCCCAAA-3ʹ, reverse primer: 5ʹ-TCTGTCAGGCTTAACATGAG-3ʹ; β-actin, forward primer: 5ʹ-GGCACCACACCTTCTACAATG-3ʹ, reverse primer: 5ʹ-TAGCACAGCCTGGATAGCAAC-3ʹ; NLRP3, forward primer: 5’-AAAGAGATGAGCCGAAGTGGG-3’, reverse primer: 5’-TCAATGCTGTCTTCCTGGCA-3’; caspase-1, forward primer: 5’-CGACAAGGTCCTGAAGGAGA-3’, reverse primer: 5’-CCCTTTCGGAATAACGGAGT-3’; γ-H2AX, forward primer: 5’-AGCACTTGGTAACAGGCACATCTTC-3’, reverse primer: 5’-GTCCACATAGCCAGCCGTGA-3’; DNA-PKc, forward primer: 5’-CCAGCTCTCACGCTCTGATATG-3’, reverse primer: 5’-CAAACGCATGCCCAAAGTC-3’; IL-1β, forward primer: ATGATGGCTTATTACAGTGGCAA, reverse primer: GTCGGAGATTCGTAGCTGGA; IL-18, forward primer: ATGCTCTGTTTGGGCTGGATA, reverse primer: GTGAGAGTCGATTTCTGTGGC.

Western blot analysis

Western blot analysis was performed to examine the hepatic protein levels of AIM2 and key inflammasome- and pyroptosis-related proteins, such as NLRP3 (Abcam, ab263899), caspase-1 (Abcam, ab207802), γ-H2AX (Abcam, ab81299), and DNA-PKc (Thermo Fisher Scientific, 18 − 2). The protein expression of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (Abcam, ab9485) was used as a loading control. Briefly, total protein was extracted from 20 mg of tumor tissue using RIPA buffer (Solarbio, Beijing, China) supplemented with 1% protease inhibitor and phosphatase inhibitor. Lysis was performed on ice for 30 minutes, followed by centrifugation at 12,000×g at 4°C for 10 minutes. The supernatant was collected and protein quantification was performed using a BCA protein concentration assay kit (Thermo Fisher Scientific, Waltham, MA, USA) following the manufacturer’s instructions.

Next, 30–50 µg of total protein was separated on 4–15% sodium dodecyl sulfate–polyacrylamide gels. After electrophoretic transfer onto Immun-Blot polyvinylidene difluoride membranes (Biotides company,Beijing China), the blots were blocked with phosphate-buffered saline (PBS) containing 5% nonfat dry milk and 0.1% Tween-20, followed by incubation with primary antibody (1:1000 for all) overnight at 4ºC. The membranes were then incubated with secondary antibodies (1:10,000) at room temperature for 1 hour. Chemiluminescence development using DAB and H₂O₂ was then performed. A chemiluminescence imaging system (Bio-Rad, California USA) was used to determine the relative optical density of each specific band.

Statistical analysis

Statistical analysis was conducted with SPSS software version 16.0 for Windows (SPSS Inc., Chicago, IL, USA). All experiments included at least triplicate samples for each treatment group, and the data are expressed as the mean ± standard deviation (SD). Representative images are presented for the IHC and western blot results. Analysis of variance (ANOVA) was applied to compare the means of multiple groups. P < 0.05 indicated a statistically significant difference between groups.

RFA suppressed tumor growth in subcutaneous xenograft nude mice

We initially assessed the effects of RFA on in vivo tumor growth in subcutaneous xenograft nude mice. As shown in Fig. 1A/B, HepG2 and SMMC-7721 cell-derived xenograft tumors in the no-RFA control group grew progressively. However, RFA treatment markedly suppressed tumor growth after four weeks of treatment, as demonstrated by the significantly smaller tumor size and lower tumor weight compared with those of the controls. It was also noted that the tumor sizes were significantly smaller and the tumor weights were significantly lower in the HepG2 and SMMC-7721 cell-derived xenograft nude mice treated with complete RFA ablation than in those treated with partial RFA ablation after four weeks of treatment (P < 0.05) (Fig. 1A/B). Consistent with these changes, H&E staining of tumor sections revealed a significant reduction in the number of tumor cells in the HepG2 and SMMC-7721 cell-derived xenograft nude mice treated with complete or partial RFA ablation compared with the control mice (Fig. 1C). In addition, flow cytometry analysis showed that the percentages of pyroptotic cells were 12.62%, 10.75%, and 5.49% (HepG2) and 26.42%, 9.84%, and 3.53% (SMMC-7721) in the complete, partial, and no-RFA ablation groups, respectively (Fig. 1D). Statistical analysis indicated that the proportion of pyroptotic tumor cells was significantly increased in the subcutaneous xenograft nude mice treated with RFA partial or complete ablation compared with the no-RFA ablation control group (P < 0.01) (Fig. 1D). Moreover, there was a significantly greater effect in the RFA compete ablation group compared with the partial ablation group (P < 0.01).

RFA induced pyroptosis in subcutaneous xenograft nude mice

Given the inhibitory effects of RFA on tumor growth, we next assessed pyroptosis levels in subcutaneous xenograft nude mice at different time points after RFA treatment. IHC and western blot analyses were performed to examine the expression levels of key proteins involved in the inflammasome and pyroptosis in liver tissues from the HepG2 and SMMC-7721 cell-derived xenograft nude mice. The IHC results showed that the AIM2, NLRP3, and caspase-1 protein expression levels were significantly greater in the liver tissue sections of the HepG2 and SMMC-7721 cell-derived xenograft nude mice treated with RFA partial or complete ablation compared with those of the control group (P < 0.05) (Fig. 2A/B). In addition, a greater effect of RFA on AIM2, NLRP3, and caspase-1 protein expression was observed in the HepG2 and SMMC-7721 cell-derived xenograft nude mice treated with complete ablation in comparison with partial ablation (Fig. 2A/B). Western blot analysis revealed similar findings to the IHC results. Additionally, the mRNA and protein levels of γ-H2AX and DNA-PKc were significantly greater in the HepG2 and SMMC-7721 cell-derived xenograft nude mice treated with RFA partial or complete ablation versus no-RFA ablation (P < 0.05) (Fig. 2C–F). A greater effect was observed in the complete ablation group compared with the partial ablation group (Fig. 2C–F).

The mean levels of serum IL-1β and IL-18 were significantly greater in the HepG2 and SMMC-7721 cell-derived xenograft nude mice treated with RFA partial or complete ablation after four weeks of treatment (P < 0.05) (Figs. 3A/B). Notably, there was a greater effect of RFA on IL-1β and IL-18 serum levels in the HepG2 and SMMC-7721 cell-derived xenograft nude mice treated with complete ablation compared with those treated with partial ablation (Fig. 3).

AIM2 was involved in RFA-induced pyroptosis in hepatoma cells

Intrigued by the animal study findings, we further investigated the biological role of AIM2 in RFA-induced pyroptosis in SMMC-7721 cells in vitro. Cell proliferation was evaluated using LDH release assays. The results revealed that shRNA-mediated knockdown of AIM2 enhanced the proliferation of SMMC-7721 cells in a time-dependent manner (P < 0.05) (Fig. 4A). In contrast, overexpression of AIM2 using the OS-AIM2 expression vector attenuated the proliferation of SMMC-7721 cells in a time-dependent manner (P < 0.05) (Fig. 4B). In addition, exposure to RFA resulted in a marked increase in LDH release compared with no-RFA treatment. Furthermore, overexpression of AIM2 with OS-AIM2 enhanced the LDH release compared with the control SMMC-7721 cells (P < 0.05) (Fig. 4C).

Pyroptosis is a form of programmed cell death that can affect tumor cell proliferation. Therefore, we examined the effects of RFA on pyroptosis in hepatoma SMMC-7721 cells with overexpression or knockdown of AIM2. Flow cytometry assays showed that RFA could induce pyroptosis compared with no RFA (P < 0.05) (Fig. 5A). Additionally, overexpression of AIM2 with OS-AIM2 enhanced pyroptosis, whereas knockdown of AIM2 with shAIM2 diminished pyroptosis, in SMMC-7721 cells (P < 0.05) (Fig. 5A).

Furthermore, qRT-PCR assays revealed that the hepatic γ-H2AX and DNA-PKc mRNA levels were significantly greater in the SMMC-7721 cells treated with RFA versus those not treated with RFA. Moreover, overexpression of AIM2 increased hepatic γ-H2AX and DNA-PKc mRNA expression levels, while AIM2 knockdown led to a decrease in the hepatic γ-H2AX and DNA-PKc mRNA expression levels, in SMMC-7721 cells (P < 0.05) (Fig. 5B). Similarly, the western blot results showed that the hepatic γ-H2AX, DNA-PKc, and caspase-1 protein expression levels were significantly greater in the SMMC-7721 cells treated with RFA versus those not treated with RFA. Similar to the mRNA expression patterns, overexpression of AIM2 increased hepatic γ-H2AX and DNA-PKc protein expression levels. In contrast, knockdown of AIM2 suppressed the hepatic γ-H2AX and DNA-PKc protein levels in SMMC-7721 cells (P < 0.05) (Fig. 5C).

We next found that RFA treatment caused increased hepatic IL-1β and IL-18 mRNA expression levels in SMMC-7721 cells, as well as secreted protein levels in the cell culture supernatant (P < 0.05) (Fig. 6). Notably, SMMC-7721 cells with AIM2 overexpression exhibited dramatic increases in both hepatic IL-1β and IL-18 mRNA expression levels and protein secretion. In contrast, AIM2 knockdown in SMMC-7721 cells inhibited both hepatic IL-1β and IL-18 mRNA expression levels and protein secretion (P < 0.05) (Fig. 6). These results supported our hypothesis that AIM2 can exert a biological role in RFA-induced pyroptosis in HCC.

The major novel findings of this study can be summarized as follows: (1) RFA treatment significantly inhibited tumor growth in BALB/c nude mice bearing HepG2 or SMMC-7721 cell-derived xenografts compared with the controls that did not receive RFA (Fig. 1); (2) RFA induced pyroptotic cell death of HepG2 or SMMC-7721 cells in the xenograft nude mice, as evidenced by significantly elevated expression levels of AIM2, NLRP3, caspase-1, γ-H2AX, and DNA-PKc in the liver tissues of the mice treated with RFA versus those of the controls (Fig. 2). Additionally, the serum levels IL-1β and IL-18 were significantly greater in the HepG2 or SMMC-7721 cell-derived xenograft mice treated with RFA compared with those not receiving RFA (Fig. 3). More pronounced effects were observed in the complete ablation group versus the partial ablation group of xenograft nude mice (Fig. 2–3); (3) Functional and mechanistic in vitro studies indicated that AIM2 exerts a direct role in RFA-induced pyroptosis. These findings were supported by experiments using knockdown or overexpression of AIM2 in SMMC-7721 cells (Fig. 4–6). Collectively, our results help elucidate the effects of RFA on the proliferation of hepatoma cells and induction of pyroptosis through AIM2-inflammasome signaling.

It has been well documented that hepatic inflammation is crucially involved in HCC development [7]. Over the last decade, there has been rapid progress in our understanding of inflammasome activation and its role in HCC pathogenesis. For example, AIM2-like receptors are reportedly capable of inducing inflammasome activation, thereby further triggering caspases. Once activated, caspases can mediate the generation, maturation, and secretion of pro-inflammatory cytokines, mainly IL-1β and IL-18. As a result, excessive secretion of IL-1β and IL-18 can ultimately induce a form of cell death, referred to as pyroptosis [21, 22, 23].

HBV and HCV infections are well-known causes of HCC. In fact, nearly 90% of HCC cases are associated with chronic hepatic inflammation [24, 25]. Therefore, inflammasome-associated molecular mechanisms have been a major focus of HCC research. In the present study, we found that RFA treatment could induce pyroptosis in nude mice bearing HepG2 or SMMC-7721 cell-derived xenografts, as well as in SMMC-7721 cells in vitro. Our findings further supported that the AIM2-activated inflammasome could activate caspase-1, through which it enhanced the production and secretion of IL-1β and IL-18, then ultimately pyroptosis.

Numerous previous studies have shown that the hepatic AIM2 levels are significantly reduced in HCC samples compared with matched histologically normal tissues from the same patients. Additionally, lower AIM2 expression levels are significantly correlated with more advanced HCC [19, 20, 26], as well as with poorer tumor differentiation and greater invasion and metastasis abilities. Overall, these observations suggest that the loss of AIM2 may contribute to HCC progression [19, 20]. Moreover, Ma et al. showed that overexpressing AIM2 could significantly suppress tumor growth in a xenograft mouse model of HCC [19]. Furthermore, the potential role of AIM2 in HCC development has been recently investigated, with the results demonstrating that genetic silencing of AIM2 or caspase-1/11 could protect mice from the occurrence of HCC [27, 28]. Our findings are consistent with these previous studies. To date, the exact roles of AIM2 and AIM2-activated inflammasomes in the action of RFA treatment for HCC have not been explored. Our results indicate that the inhibitory effects of RFA on the proliferation of hepatoma cells may involve the induction of pyroptosis through AIM2-inflammasome signaling. We postulated that exposure to RFA can cause cellular damage, triggering the release of self-DNA. This can be sensed by AIM2 and thereby lead to the assembly and activation of the inflammasome complex in response to RFA, but in the absence of infection.

This study has some potential limitations. First, we found that AIM2 expression levels were markedly elevated in response to RFA in the mice bearing HepG2 or SMMC-7721 cell-derived xenografts, as well as in cell culture. However, the molecular pathways through which AIM2 is upregulated remain unknown. We propose that, in the absence of infection caused by pathogens, AIM2 may sense RFA-associated DNA, assemble and activate the inflammasome complex, then promote the secretion of pro-inflammatory cytokines that thus induce pyroptosis. Given that compelling evidence of the actions of AIM2 beyond the inflammasome complex has been reported [29, 30, 31, 32, 33, 34], it would be interesting to explore whether AIM2 can play an inflammasome-independent role in HCC and RFA treatment. Further in-depth investigations on the underlying molecular mechanisms are currently underway in our laboratory.

Taken together, we found that RFA treatment could suppress tumor growth and induce pyroptosis in in vitro and in vivo models of HCC. In addition, we identified AIM2-mediated activation of inflammasome signaling as an important cell death mechanism. Therefore, these findings advance our understanding of the biological function of AIM2. Therapeutic intervention with AIM2-mediated inflammasome signaling may help improve RFA treatment outcomes for HCC patients.

AIM2, absent in melanoma 2; ELISA, enzyme-linked immunosorbent assay; FLICA, fluorescent-labeled inhibitors of caspase; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; HBV, hepatitis B virus; HCC, hepatocellular carcinoma; HCV, hepatitis C virus; H&E, hematoxylin and eosin; IL-1β, interleukin-1β; IL-18, interleukin-18; LDH, lactate dehydrogenase; NC, negative control; qRT-PCR, quantitative reverse transcription–polymerase chain reaction; RFA, radiofrequency ablation; SD, standard deviation.

Ethics approval

The Ethics Committee of Changzhou First People’s Hospital approved all animal experiments (Approval No. 2018-025).

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author upon reasonable request.

Competing interests

The authors declare that they have no competing interests.

Funding

This study was supported by the Natural Science Foundation of Jiangsu Province (Grant No. BK20180185), China Postdoctoral Science Foundation (Grant No. 2020M681447), and Postdoctoral Science Foundation of Jiangsu Province (Grant No. 20202175).

Authors’ contributions

FH and CW conceived and designed the study. ZH contributed significantly to data analysis and manuscript preparation. CW and FH performed the data analyses and wrote the manuscript.

Acknowledgements

We thank J. Iacona, Ph.D., from Liwen Bianji (Edanz) (www.liwenbianji.cn) for editing the English text of a draft of this manuscript.

Yang JD, Hainaut P, Gores GJ, Amadou A, Plymoth A, Roberts LR. A global view of hepatocellular carcinoma: trends, risk, prevention and management. Nat Rev Gastroenterol Hepatol. 2019;16:589-604.
Bertino G, Ardiri A, Demma S, Calvagno SG, Toro A, Basile E, et al. Rare benign tumors of the liver: still rare? J Gastrointest Cancer. 2014;45:202-17.
Llovet JM, Kelley RK, Villanueva A, Singal AG, Pikarsky E, Roayaie S, et al. Hepatocellular carcinoma. Nat Rev Dis Primers. 2021;7:6.
Chen W, Zheng R, Baade PD, Zhang S, Zeng H, Bray F, et al. Cancer statistics in China. CA Cancer J Clin. 2016;66:115-32.
Akinyemiju T, Abera S, Ahmed M, Alam N, Alemayohu MA, Allen C, et al. The burden of primary liver cancer and underlying etiologies from 1990 to 2015 at the global, regional, and national level: Results from the global burden of disease study. JAMA Oncol. 2017;3:1683-91.
Szabo G, Petrasek J. Inflammasome activation and function in liver disease. Nat Rev Gastroenterol Hepatol. 2015;12:387-400.
Galun E. Liver inflammation and cancer: The role of tissue microenvironment in generating the tumor-promoting niche (TPN) in the development of hepatocellular carcinoma. Hepatology. 2016;63:354-6.
Man SM. Inflammasomes in the gastrointestinal tract: infection, cancer and gut microbiota homeostasis. Nat Rev Gastroenterol Hepatol. 2018;15:721-37.
Luan J, Ju D. Inflammasome: A double-edged sword in liver diseases. Front Immunol. 2018;9:2201.
Izzo F, Granata V, Grassi R, Fusco R, Palaia R, Delrio P, et al. Radiofrequency Ablation and Microwave Ablation in Liver Tumors: An Update. Oncologist. 2019;24:e990-e1005.
Lugrin J, Martinon F. The AIM2 inflammasome: Sensor of pathogens and cellular perturbations. Immunol Rev. 2018;281:99-114.
Wang B, Yin Q. AIM2 inflammasome activation and regulation: A structural perspective. J Struct Biol. 2017;200:279-82.
Jin T, Perry A, Jiang J, Smith P, Curry JA, Unterholzner L, et al. Structures of the HIN domain:DNA complexes reveal ligand binding and activation mechanisms of the AIM2 inflammasome and IFI16 receptor. Immunity. 2012;36:561-71.
Morrone SR, Matyszewski M, Yu X, Delannoy M, Egelman E, Sohn J. Assembly-driven activation of the AIM2 foreign-dsDNA sensor provides a polymerization template for downstream ASC. Nat Commun. 2015;6:7827.
Fernandes-Alnemri T, Yu JW, Datta P, Wu J, Alnemri ES. AIM2 activates the inflammasome and cell death in response to cytoplasmic DNA. Nature. 2009;458:509-13.
Hornung V, Ablasser A, Charrel-Dennis M, Bauernfeind F, Horvath G, Caffrey DR, et al. AIM2 recognizes cytosolic dsDNA and forms a caspase-1-activating inflammasome with ASC. Nature. 2009;458:514-8.
Zheng P, Xiao W, Zhang J, Zheng X, Jiang J. The role of AIM2 in human hepatocellular carcinoma and its clinical significance. Pathol Res Pract. 2023;245:154454.
Lozano-Ruiz B, González-Navajas JM. The Emerging Relevance of AIM2 in Liver Disease. Int J Mol Sci. 2020;21:6535.
Ma X, Guo P, Qiu Y, Mu K, Zhu L, Zhao W, et al. Loss of AIM2 expression promotes hepatocarcinoma progression through activation of mTOR-S6K1 pathway. Oncotarget. 2016;7:36185-97.
Chen SL, Liu LL, Lu SX, Luo RZ, Wang CH, Wang H, et al. HBx-mediated decrease of AIM2 contributes to hepatocellular carcinoma metastasis. Mol Oncol. 2017;11:1225-40.
Martinon F, Burns K, Tschopp J. The inflammasome: a molecular platform triggering activation of inflammatory caspases and processing of proIL-beta. Mol Cell. 2002;10:417-26.
Kayagaki N, Wong MT, Stowe IB, Ramani SR, Gonzalez LC, Akashi-Takamura S, et al. Noncanonical inflammasome activation by intracellular LPS independent of TLR4. Science. 2013;341:1246-9.
Liu X, Zhang Z, Ruan J, Pan Y, Magupalli VG, Wu H, et al. Inflammasome-activated gasdermin D causes pyroptosis by forming membrane pores. Nature. 2016;535:153-8.
Llovet JM, Zucman-Rossi J, Pikarsky E, Sangro B, Schwartz M, Sherman M, et al. Hepatocellular carcinoma. Nat Rev Dis Primers. 2016;2:16018.
Ringelhan M, Pfister D, O'Connor T, Pikarsky E, Heikenwalder M. The immunology of hepatocellular carcinoma. Nat Immunol. 2018;19:222-32.
Sonohara F, Inokawa Y, Kanda M, Nishikawa Y, Yamada S, Fujii T, et al. Association of Inflammasome Components in Background Liver with Poor Prognosis After Curatively-resected Hepatocellular Carcinoma. Anticancer Res. 2017;37:293-300.
Martínez-Cardona C, Lozano-Ruiz B, Bachiller V, Peiró G, Algaba-Chueca F, Gómez-Hurtado I, et al. AIM2 deficiency reduces the development of hepatocellular carcinoma in mice. Int J Cancer. 2018;143:2997-3007.
Macek Jilkova Z, Kurma K, Decaens T. Animal models of hepatocellular carcinoma: The role of immune system and tumor microenvironment. Cancers (Basel). 2019;11:1478.
El-Zaatari M, Bishu S, Zhang M, Grasberger H, Hou G, Haley H, et al. Aim2-mediated/IFN-β-independent regulation of gastric metaplastic lesions via CD8+ T cells. JCI Insight. 2020;5:e94035.
Furrer A, Hottiger MO, Valaperti A. Absent in Melanoma 2 (AIM2) limits pro-inflammatory cytokine transcription in cardiomyocytes by inhibiting STAT1 phosphorylation. Mol Immunol. 2016;74:47-58.
Farshchian M, Nissinen L, Siljamäki E, Riihilä P, Piipponen M, Kivisaari A, et al. Tumor cell-specific AIM2 regulates growth and invasion of cutaneous squamous cell carcinoma. Oncotarget. 2017;8:45825-36.
Man SM, Zhu Q, Zhu L, Liu Z, Karki R, Malik A, et al. Critical Role for the DNA Sensor AIM2 in Stem Cell Proliferation and Cancer. Cell. 2015;162:45-58.
Wilson JE, Petrucelli AS, Chen L, Koblansky AA, Truax AD, Oyama Y, et al. Inflammasome-independent role of AIM2 in suppressing colon tumorigenesis via DNA-PK and Akt. Nat Med. 2015;21:906-13.
Qi M, Dai D, Liu J, Li Z, Liang P, Wang Y, et al. AIM2 promotes the development of non-small cell lung cancer by modulating mitochondrial dynamics. Oncogene. 2020;39:2707-23.

No competing interests reported.

Download PDF

Journal Publication

published 30 Jun, 2024

Read the published version in Annals of Hepatology →

Version 1

posted

You are reading this latest preprint version

A novel role of AIM2 inflammasome-mediated pyroptosis in radiofrequency ablation of hepatocellular carcinoma

Status:

Journal Publication

Version 1

Abstract

Background

Methods

Results

Conclusions

Figures

Background

Materials and Methods

Cell culture

Experimental animals

RFA

Histology

Immunohistochemistry (IHC)

Overexpression of AIM2

Knockdown of AIM2

Lactate dehydrogenase (LDH) release assay

Flow cytometry analysis of pyroptotic cells

Enzyme-linked immunosorbent assays (ELISAs)

Real-time quantitative reverse transcription–polymerase chain reaction (qRT-PCR)

Western blot analysis

Statistical analysis

Results

RFA suppressed tumor growth in subcutaneous xenograft nude mice

RFA induced pyroptosis in subcutaneous xenograft nude mice

AIM2 was involved in RFA-induced pyroptosis in hepatoma cells

Discussion

Conclusions

Abbreviations

Declarations

References

Additional Declarations

Status:

Journal Publication

Version 1