Unveiling the Impact of 17β-Estradiol on Thymic Epithelial Cell Proliferation: A miRNA Perspective

doi:10.21203/rs.3.rs-3761522/v1

Download PDF

Research Article

Unveiling the Impact of 17β-Estradiol on Thymic Epithelial Cell Proliferation: A miRNA Perspective

https://doi.org/10.21203/rs.3.rs-3761522/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background Estrogen signaling and microRNA (miRNA) expression play a pivotal role in thymus involution by regulating thymic epithelial cell (TECs) functions. However, the role of Estrogen on miRNA expression in TECs has not been fully elucidated.

Methods Cell proliferation assays, such as the cell-counting kit-8 (CCK-8), 5-Ethynyl-2'-deoxyuridine (EdU) and flow cytometry assays were conducted. Next-generation sequencing (NGS)-based miRNA profiling was performed and validated using Quantitative polymerase chain reaction (qPCR). Additionally, the mechanism of 17β-Estradiol(E2) regulation of miRNA expression in MTEC1 cells was investigated using anti-estrogen ICI 182, 780 and ERα siRNA.

Results A total of 3356 candidate miRNAs across the six miRNA libraries were subjected to analysis, among these, 69 miRNAs displayed notable changes in expression patterns, with 33 miRNAs exhibiting downregulation and 36 miRNAs showing upregulation. Further investigation focused on miR-99a-5p, miR-99b-5p, miR-378a-5p, miR-361-5p, miR-16-5p, and miR-22-3p due to their elevated expression levels. Subsequent examination through Gene ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analyses revealed a significant association between the dysregulated miRNAs and the functional role of cell proliferation. Furthermore, the regulatory impact of E2 on miRNA expression can be modified by the anti-estrogen ICI 182 780 or inhibited by ERαsiRNA in MTEC1 cells.

Conclusions E2 canalter miRNA expression in TECs, and this miRNA expression may be closely associated with post-transcriptional regulation of cell proliferation in an ERα-dependent manner. Our data indicated the good performance of these miRNAs as potential biomarkers in E2-related thymic involution in TECs.

miRNA

17β-Estradiol

Thymic epithelial cells

Cell proliferation

Thymus atrophy

The thymus is the primary site for T cell development and differentiation(1, 2). By providing the necessary signals to T cell precursors, thymic epithelial cells (TECs) are essential in multiple stages of T cell development and differentiation (1, 3). However, with increasing age, the thymus is involved. The major feature of aged thymus is the reduced TEC numbers (4), which are accompanied by impaired TEC development, which causes severe T cell deficiency(1, 5). Despite the crucial roles of TECs in age-related thymus involution, the underlying mechanisms of TEC-associated thymic atrophy have not been elucidated.

Estrogen, as one of the most important sex steroids, exerts its effects through estrogen receptors (ER), which are expressed in different tissues and cells, including the thymus(6). However, there is a direct correlation between thymic atrophy and sex hormones(7, 8). For example, in vivo, the administration of 17β-Estradiol(E2) and synthetic analogs of cortisol were shown to induce thymic atrophy(9). During pregnancy, high circulating levels of estrogen-induced transient thymic atrophy. In mice thymus, increased thymic weight and cellularity were observed when ovariectomy(10–12). Similarly, with diminishing effects of E2 in mice, thymic involution was reduced(4, 13). It has also been reported that E2 induces thymic involution by directly acting on TECs(4, 11, 14).

MicroRNAs (miRNAs) are endogenous non-coding small RNAs whose effects are being studied, including in the process of thymus atrophy (15). miRNAs and estrogen signaling regulation are necessary for regulating cell and tissue homeostasis, and their interactions in cells contribute to cell-specificity and fine-tuning of transcriptional regulation(16). Moreover, estrogen-regulated miRNAs have been shown to control estrogen responses and cell growth in different kinds of cells (6). On the other hand, estrogen-regulated genes in mice thymus were shown could control cell proliferation and survival (17), but the effects of estrogen on gene expression at the post-transcriptional level in TECs have not been documented.

Given the crucial roles of estrogen and miRNA in regulating TEC proliferation and thymic involution, we hypothesized that there is an altered miRNA expression pattern in TECs, and this miRNA expression may have a crucial role in TECs function. Therefore, the E2 was added to MTEC1 cells for 24 h, and the miRNA expression profiles in MTEC1 cells with or without E2 were analyzed by sRNA-seq. The Kyoto Encyclopedia of Genes and Genomes (KEGG) and gene ontology (GO) were used to evaluate the potential roles of differentially expressed miRNAs. The regulatory mechanisms of E2 on miRNA expression in MTEC1 were determined by anti-estrogen ICI 182 780 and ERα siRNA. We found that the miRNA expression was altered via ERα in this process, and these miRNA expressions have a link with cell proliferation function.

Cell culture and treatment

Murine thymic epithelial cell line 1(MTEC1) was provided by Peking University Health Science Center (Beijing, China), and was grown in Dulbecco's Modified Eagle Medium (DMEM) (Gibco, Grand Island, USA) with 10% fetal bovine serum(FBS) (Gibco) in a humidified atmosphere containing 5% CO₂ at 37°C. MTEC1 cells were treated with 17-β-estradiol (Sigma, St. Louis, MO) following a previously described method (18). For the fulvestrant (ICI 182 780) treatment, the MTEC1 cells were firstly serum-starved (phenol red-free DMEM with 2% charcoal-stripped FBS) for 24 h, after incubation for 6 h with 1 µmol/L ICI 182 780, the supernatant was discarded and then the 50 nmol/L E2 was added and further incubated for 24 h before harvest (19).

Cell viability and cell cycle assays

MTEC1 cells were cultured and treated as described in Cell Culture and Treatment. After MTEC1 cells had been exposed to different E2 concentrations(1 nmol/L, 10 nmol/L, 25 nmol/L, 50 nmol/L, 100 nmol/L) for 24 h, cell viability was detected using a cell-counting kit-8 (CCK-8, Beyotime) according to the manufacturer’s instructions. For the cell cycle, 50 nmol/L of E2 or ethanol (vehicle control, 0.01% final volume) were added to MTEC1 cells and incubated for 24 h, after which the cells were fixed in 70% ethanol overnight at − 20°C. Cell cycle progression was analyzed using a Cell Cycle Analysis Kit (Beyotime), according to the manufacturer’s instructions.

5-ethynyl‑20‑deoxyuridine (EdU) assays

MTEC1 cells were cultured and treated as described in Cell Culture and Treatment. After cells had been fixed with 4% polyformaldehyde (60 min at room temperature), the supernatant was removed and cells were washed using PBS. Then, 0.5% Triton X-100 was added to the cells and incubated for an additional 15 min. Cell proliferation was assessed by a Cell-Light™EdUCell Proliferation Detection assay kit (RiboBio, Guangzhou, China).

MiRNA sequencing

Cells from the treatment and control groups were collected at 24 h. Six sample groups were denoted E2-1, E2-2, E2-3, C-1, C-2, and C-3, and the preparation of miRNA libraries for high-throughput sequencing was performed by LC-BIO(Hangzhou, China). Briefly, Total Ribonucleic acid (RNA) was extracted from each pool, corresponding to the six sample groups, treatment group, and control samples. The integrity and concentration of RNA were measured by a Bioanalyzer 2100 and RNA 6000 Nano LabChip Kit (Agilent, CA, USA). Based on the TruSeq Small RNA Sample Prep Kits (Illumina, San Diego, USA) protocol, a small RNA library was prepared from 1 µg total RNA with RIN number > 7.0. These libraries were sequenced on an Illumina HiSeq 2500 at the LC-BIO (Hangzhou, China), and 36 bp single-end sequencing was generated.

Identification and analysis of known and potential novel miRNAs

Briefly, the Illumina pipeline filter (Solexa 0.3) was used to filter the raw data. Then, through further processing of the obtained data with an in-house program, ACGT101-miR (LC Sciences, Houston, TX, USA), the 3ADT&length filter, Junk reads, Rfam, mRNA, and Repeats were removed. Subsequently, the known miRNAs and novel 3p- and 5p- derived miRNAs were identified once the unique sequences with 18–25 bp were mapped to specific species precursors using miRBase 21.0 (http://www.mirbase.org/). During alignment, the criteria of one mismatch inside the sequence and length variation at both 3′ and 5′ ends were allowed. Depending on the design of the experiments, differences in miRNA expression levels based on normalized deep-sequencing counts were compared using Fisher’s exact test and Student’s t-test. Significance thresholds were set at P < 0.05 (significant) and P < 0.01 (highly significant) in each test.

Quantitative polymerase chain reaction (qPCR)

To determine the expression levels of miRNA in MTEC1 cells, bulge-loop miRNA qRT-PCR Primer Sets (including one reverse transcription primer and a pair of quantitative PCR primers for each set) specific for these miRNAs were designed by RiboBio (Guangzhou, China). U6 was used to normalize the relative abundance of miRNA expression. To measure mRNA expression levels in MTEC1 cells, gene-specific primers for ERα and ERβ were designed by the Primer Premier 5.0 software according to the published genome sequences. The ERα primers, F: CACCAGATCCAAGGGAA and R: CGGCGTTGAACTCGTAG were used for amplification of ERα(XM_017313797.1, 148 bp). The ERβ primers, F: GGCCATGATTCTCCTC and R: CATCTGTCACTGCGTTC were used to amplify ERβ(NM_207707.1, 104 bp), while the β-actin primers, F: CATCCGTAAAGACCTCTATGCCAACC and R: ATGGAGCCACCGATCCACA were used to amplify β-actin (NM_007393, 171 bp). The qPCRs were performed on the Bio-Rad CFX96 Real-Time PCR system (Bio-Rad, Hercules, USA). The relative expression levels for each gene were evaluated from three different experiments and were determined using the 2^−ΔΔCT method. All experiments were repeated at least three times.

Functional analysis

Gene Ontology (GO) (http://www.geneontology.org) enrichment and Kyoto Encyclopedia of Genes and Genomes (KEGG) (http://www.genome.ad.jp/kegg/mapper.html) analyses were performed for functional analysis of the significantly differentially expressed miRNAs. Significantly enriched GO terms and KEGG-enriched pathways of differentially expressed miRNAs were evaluated with P < 0.05 as the significance threshold.

Cell transfection

One day before transfection, MTEC1 cells were cultured in an appropriate culture dish in a DMEM medium with 10% FBS. Once the cell density reached 70 ~ 80%, 100 nmol/L siRNAs, including siERα(sense, 5'-GCAGUAACGAGAAAGGAAAdtdt-3', and antisense, 3'-dtdtCGUCAUUGCUCUUUCCUUU-5') and siRNA Control (sense, 5'-UUCUCCGAACGUGUCACGUTT-3', and antisense, 5'-ACGUGACACGUUCGGAGAATT-3'), designed by RiboBio (Guangzhou, China), were transfected into MTEC1 cells and incubated for 24 h. Then, 50 nmol/L E2 was added and incubation at 37 ℃ continued for an additional 24 h. The assays were performed using a Lipofectamine 3000 reagent (Invitrogen, Carlsbad, USA) according to the manufacturer’s instructions.

Statistical analysis

All the experiments were repeated at least three times. All data were presented as the mean ± SD. For statistical analyses, SPSS 25.0 (SPSS, Chicago, USA) was used. A value of P < 0.05 was accepted as statistically significant.

E2 inhibited cell viability and induced cell cycle arrest in G2/M in MTEC1 cells

To assess the impact of E2 on the functions of TECs, MTEC1 cells were subjected to various concentrations of E2 (1 nmol/L, 10 nmol/L, 25 nmol/L, 50 nmol/L and 100 nmol/L) and incubated for a duration of 24 h. The results indicated a dose-dependent decline in both cell viability and proliferation of MTEC1 cells. This observation is supported by the data presented in Fig. 1a, where concentrations of E2 exceeding 25 mmol/L exhibited a significant reduction in MTEC1 cell viability as determined by CCK-8 assays. Additionally, the morphological analysis revealed a noticeable inhibition in the growth of MTEC1 cells following exposure to E2 at concentrations of 25 nmol/L, 50 nmol/L, and 100 nmol/L, Cells treated with E2 exhibited a reduction in size and a noteworthy decrease in cell count in comparison to the control cells(Fig. 1b). Furthermore, analysis of the cell cycle demonstrated that E2 treatment significantly augmented the population of cells in the S and G2/M phases, while concurrently diminishing the number of cells in the G0/G1 phases (Fig. 1c). Moreover, an evident decline in EdU + cells was observed with escalating concentrations of E2 (Fig. 1d), suggesting a hindrance in cellular proliferation.

For small RNA library construction analyses

MTEC1 cells from the E2 and control group cells were collected 24 h after treatment, after which RNA was isolated to construct the small RNA (sRNA) libraries for deep sequencing. Total reads of 6,050,538 (E2-1), 7,613,368 (E2-2), 4,493,368 (E2-3), 7,844,892 (C-1), 6,133,296 (C-2), and 6,713,520 (C-3), in six libraries, were generated by Illumina HiSeq. Unique reads of 174,112 (E2-1), 232,387 (E2-2), 163,139 (E2-3), 174,994 (C-1), 150,192 (C-2), and 169,037 (C-3) were obtained after removal of the 3ADT&length filter, Junk reads, Rfam, mRNA and Repeats (Table. S1).

Identification of E2-altered miRNAs in MTEC1 cells by E2

Based on the sequencing findings, the count distribution of sequences and unique sRNAs in this study were annotated. Figure 2a shows that the six sRNA libraries exhibited a similar distribution pattern, with the largest RNA number being 22 bp, followed by 21 bp and 23 bp, indicating that the length distribution of miRNAs in MTEC1 cells conformed to the cleavage characteristics of the Dicer enzyme. Then, we evaluated the miRNA expression profiles of the E2 (4554 mature miRNA)and control groups༈4820 mature miRNA༉, and a total of 3356 miRNA sequences were detected in all the experimental groups (Table. S2). Using a cut-off with adjusted P < 0.05, a total of 69 miRNAs were found to be significantly differentially expressed, including 33 downregulated and 36 upregulated miRNAs (Fig. 2b).

miRNA expression profiles in MTEC1 cells were validated by qPCR

To confirm the sequencing accuracy, qPCR was performed. Figure 3a shows that the expression levels of 6 miRNAs, including miR-16-5p, miR-22-3p, miR-99a-5p, miR-99b-5p and miR-361-5p were significantly different between the E2 and control group cells. These findings are in tandem with our sequencing results. However, even though differences in miR-378a-5p expression levels were not significant, the trend in expression patterns was consistent with the sequencing data. Furthermore, 6 miRNAs, including miR-21a-5p, miR-125b-5p, miR-27a-3p, miR-140-3p, miR-30e-5p and miR-181a-5p whose expression levels were not significantly different in RNA-seq results were also detected(Fig. 3b). These findings were in concordance with those of RNA-seq analysis.

Functional analysis of E2-altered miRNAs

To establish the functions of miRNAs that were deregulated in MTEC1 cells under 50 nmol/L E2 treatment, GO was used to classify and annotate the predicted target genes. A total of 658 GO terms (P < 0.05) were obtained, with most of them being involved in biological processes. A total of 443 GO terms accounted for 67.32% of the GO terms. There were 139 molecular functions, accounting for 21.12% of the GO terms, with a relatively small number (76; 11.55%) of cellular components (Table. S3). The significantly enriched GO terms are shown in Fig. 4a. KEGG analysis revealed 79 significantly enriched signaling pathways (Table. S4). The significantly enriched KEGG pathways are shown in Fig. 4b.

The ER is required in E2-altered miRNAs in MTEC1 cells

To assess the roles of ER subtypes in E2-altered miRNA changes, both ERα and ERβ expression levels in MTEC1 cells were determined by qPCR. Elevated and suppressed Ct values were respectively observed in ERβ (Ct values = 34.56 26) and ERα (Ct values = 27.26) expression abundance (Fig. 5a), indicating that the expression levels of ERα were strongly and positively correlated with the expression of these miRNAs.

To evaluate the correlations between ERα and miRNA expression in MTEC1 cells under the E2 treatment, ICI 182 780 was used to determine whether E2-altered miRNA expression can be abrogated by anti-estrogens. As shown in Fig. 5b, significant differences in miR-16-5p, miR-22-3p, miR-99a-5p, and miR-99b-5p were used to clarify the relationships between miRNA and ER. As we have shown, E2 changes in miRNA expression were impaired by ICI 182 780, and a reversed effect was observed in the ICI 182 780 cells group when compared to the E2 group for this significant miRNA expression.

E2-altered miRNA expression in MTEC1 cells is ERα-dependent

To further determine whether miRNA regulation by E2, siRNA was used to knock down ERα. After 48 h of transfection, Fig. 6a demonstrates a decrease of approximately 60% in ERα expression in the cells treated with siERα compared to the cells treated with scrambled siRNA. Then, we detected the changes in miRNA expression levels following siRNA treatment. As shown in Fig. 6b, compared to the siRNA control + E2 group, the expression levels of miR-16-5p (P < 0.05) and miR-22-3p (P < 0.05) were significantly suppressed in the siERα + E2 group. Moreover, there were no significant differences in expression levels between the siERα + E2 and control group (0.01% ethanol) cells. However, compared to the control group (0.01% ethanol) cells, the expression levels of miR-16-5p (P < 0.05) and miR-22-3p (P < 0.05) were significantly elevated in the siRNA control + E2 group. In addition, compared to the siRNA control + E2 group cells, the expression levels of miR-99a-5p (P < 0.05) and miR-99b-5p (P < 0.01) were significantly elevated in the siERα + E2 group. However, there were no significant differences in expression levels between the siERα + E2 group versus the control group (0.01% ethanol). Moreover, the expression levels of miR-99a-5p (P < 0.01) and miR-99b-5p (P < 0.05) in the siRNA control + E2 group were significantly suppressed when compared to the control group (0.01% ethanol). These findings show that E2-altered miRNA expression in MTEC1 cells is ERα dependent.

Studies have reported that estrogen contributes to thymic involution by directly acting on TECs, due to the cells that highly express ERs, that direct T-cell development and that modulate cytokines and chemokine expression, signals that enable thymocytes' differentiation journey through the thymus(14, 17, 20). In addition, miRNA is an important modulator for TEC proliferation(21). However, it has not been established whether the expression patterns of miRNAs in TECs can be influenced by estrogen. In this study, we found that the E2 at concentrations greater than 25 mmol/L significantly decreased the viability and cell proliferation in MTEC1 cells, and the 50 nmol/L E2 in MTEC1 cells was chosen to be studied in the following experiments because the normal morphology of MTEC1 cells was not changed by the concentration of E2, which also exhibits a strong inhibits effect in MTEC1 cells.

As previously reported(17), our results showed that only 2.05% (69 miRNAs out of 3356) of the analyzed miRNAs were significantly affected by E2, indicating that E2 alters a small subset of miRNAs, despite their proliferation inhibitory effects. To understand the importance of characteristic miRNA profiles in E2-treated MTEC1 cells, we focused on miRNA expression that has a higher expression level in the MTEC1 cells. Therefore, the miR-99a-5p, miR-99b-5p, miR-378a-5p, miR-361-5p, miR-16-5p and miR-22-3p were chosen for further analysis.

The firstly, GO enrichment analysis was performed, and we found that the most significant GO term is the molecular function ‘protein binding’(GO Id:0005515), which is essential for DNA replication, regulation of mitotic nuclear division, cell cycle progression, cell proliferation, and regulation of chromosomal segregation in cells(22, 23). Furthermore, among the biological processes, the ‘cellular protein modification process’(GO Id:0006464), ‘biosynthetic process’(GO Id:0009058) and ‘protein phosphorylation’(GO Id:0006468) were the significantly enriched GO terms. These GO terms have a very close association with cell proliferation (24–30). Moreover, other enriched GO terms that are directly associated with cell proliferation, such as the ‘negative regulation of cell proliferation (GO Id:0008285), ‘growth’(GO Id:0040007), ‘cell proliferation’(GO Id:0008283), ‘positive regulation of the apoptotic process’(GO Id:0043065), etc are also were significantly enriched in the these GO terms. These findings imply that E2-altered miRNA expression in MTEC1 cells may be important in cell proliferation regulation.

Furthermore, cell proliferation pathways were also found to be enriched by KEGG analysis. ‘Pathways in cancer’(ko05200)are cell signal transduction systems that play a major role in cell cycle progression and cell proliferation(31, 32). In addition, the ‘Fc gamma R-mediated phagocytosis’(ko04666) signaling pathway(33, 34), ‘Insulin signaling pathway'(ko04910) and E2-related signaling pathways(35, 36), all of which play important signaling roles in the regulation of cell proliferation (6, 37, 38). On the other hand, N-glycan branching can regulate cell proliferation by mediating growth-promoting and growth-arrest receptors that differ in the number of N-glycan sites(39). Moreover, it was reported that the ‘focal adhesion pathway’(ko04510) plays a crucial role in regulating cell motility, cell proliferation, cell differentiation, and cell survival (40).

The estrogen can directly act on ER in TECs[14], however, ERα and ERβ exhibit different physiological functions (41). The ERβ is expressed in thymocytes and thymic stromal cells(42, 43), and its expression levels are relatively higher in the human thymus, and very low or even absent in mice thymus(44–47). To clarify the regulatory role of ER in MTEC1, ERα and ERβ expression levels were evaluated by qPCR. In line with previous reports, our results showed that ERα is the predominant receptor in MTEC1 cells, with ERβ being barely detectable.

To confirm the functional role of ER in E2-altered miRNA expression in MTEC1 cells, we used a competitive antagonist of E2, ICI 182 780, which can block the transcriptional activation properties of ERs(48, 49). We found that the expression of miR-16-5p, miR-22-3p, miR-99a-5p, and miR-99b-5p were significantly reversed by ICI 182 780 in E2-treated MTEC1 cells. The E2-altered miRNA expression was blocked by ICI 182 780 pretreatments, indicating a nuclear ER effect(50). To further determine whether miRNA regulation is ERα-dependent, a similar result was observed after the knockdown of ERα by siRNA in MTEC1 cells. Consistent with our results, E2 leads to transcriptional regulation of genes involved in the control of cell growth by binding ERα in breast cancer cells (19). Therefore, the miRNA expression in response to E2 is mediated by ERα in MTEC1 cells.

E2 can alter miRNA expression in MTEC1 cells by regulating the ERα subtypes, and expression of these miRNAs that are E2-responsive, which may play a modulation role in MTEC1 cell proliferation at the post-transcriptional level. Therefore, our study elucidates that the changes in miRNA expression play an important role in the regulation of E2 on TEC proliferation. Although further studies are required to verify the potential functions of these miRNAs, we believe that our results provide a basis for further studies on characterizing the role of specific miRNAs in TECs mediated by E2.

E2:17β-Estradiol;

MTEC1: Mouse medullar thymic epithelial cells;

miRNA: MicroRNA;

KEGG: Kyoto Encyclopedia of Genes and Genomes;

GO: Gene ontology ;

ERα: Estrogen receptor α;

ERβ: Estrogen receptor β;

DMEM: Dulbecco’s modified Eagle medium;

EdU: 5-Ethynyl-2'-deoxyuridine;

qPCR: Quantitative polymerase chain reaction;

SD: Standard deviation;

TECs: Thymic epithelial cells;

siRNA: Small interfering RNA;

FBS: Fetal bovine serum;

ICI 182 780: A competitive antagonist of E2, fulvestrant;

Acknowledgments We would like to give our sincere gratitude to the reviewers for their constructive comments.

Author contributions All authors contributed to the study conception and design. DGG and MYC performed the majority of experiments and data analysis. YJH and JHT helped to collect and analyze the data. DGG wrote the manuscript and helped with experiments. YGL revised the manuscript critically for important intellectual content.

Funding

This work was supported by the National Natural Scientific Foundation of China (Grant No. 32102632 and 31572475) and the Doctoral Scientific Research Foundation of Xinxiang University (Grant No. 1366020120), Key Scientific Research Projects in Colleges and Universities of Henan (Grant No. 24A180023)

Data availability The datasets generated during and/or analysed during the current study are available from the corresponding author on reasonable request.

Conflict of interest The authors have no relevant financial or non-financial interests to disclose.

Ethical approval Not applicable

Informed consent Informed consent was obtained from all individual participants included in the study.

Cowan JE, Takahama Y, Bhandoola A, Ohigashi I. Postnatal Involution and Counter-Involution of the Thymus. Front Immunol 2020; 11:897.https://doi.org/10.3389/fimmu.2020.00897.
Liang Z, Dong X, Zhang Z, Zhang Q, Zhao Y. Age-related thymic involution: Mechanisms and functional impact. Aging Cell 2022; 21:e13671.https://doi.org/10.1111/acel.13671.
Xing Y, Hogquist KA. Isolation, identification, and purification of murine thymic epithelial cells. J Vis Exp 2014:e51780.https://doi.org/10.3791/51780.
Dooley J, Liston A. Molecular control over thymic involution: from cytokines and microRNA to aging and adipose tissue. Eur J Immunol 2012; 42:1073-1079.https://doi.org/10.1002/eji.201142305.
Lagou MK, Karagiannis GS. Obesity-induced thymic involution and cancer risk. Semin Cancer Biol 2023; 93:3-19.https://doi.org/10.1016/j.semcancer.2023.04.008.
Vidal-Gomez X, Perez-Cremades D, Mompeon A, Dantas AP, Novella S, Hermenegildo C. MicroRNA as Crucial Regulators of Gene Expression in Estradiol-Treated Human Endothelial Cells. Cell Physiol Biochem 2018; 45:1878-1892.https://doi.org/10.1159/000487910.
Sutherland JS, Goldberg GL, Hammett MV, Uldrich AP, Berzins SP, Heng TS, et al. Activation of thymic regeneration in mice and humans following androgen blockade. J Immunol 2005; 175:2741-2753.https://doi.org/10.4049/jimmunol.175.4.2741.
Min H, Montecino-Rodriguez E, Dorshkind K. Reassessing the role of growth hormone and sex steroids in thymic involution. Clin Immunol 2006; 118:117-123.https://doi.org/10.1016/j.clim.2005.08.015.
Zubkova I, Mostowski H, Zaitseva M. Up-regulation of IL-7, stromal-derived factor-1 alpha, thymus-expressed chemokine, and secondary lymphoid tissue chemokine gene expression in the stromal cells in response to thymocyte depletion: implication for thymus reconstitution. J Immunol 2005; 175:2321-2330.https://doi.org/10.4049/jimmunol.175.4.2321.
Li J, McMurray RW. Effects of estrogen receptor subtype-selective agonists on immune functions in ovariectomized mice. Int Immunopharmacol 2006; 6:1413-1423.https://doi.org/10.1016/j.intimp.2006.04.019.
Staples JE, Gasiewicz TA, Fiore NC, Lubahn DB, Korach KS, Silverstone AE. Estrogen receptor alpha is necessary in thymic development and estradiol-induced thymic alterations. J Immunol 1999; 163:4168-4174
Hince M, Sakkal S, Vlahos K, Dudakov J, Boyd R, Chidgey A. The role of sex steroids and gonadectomy in the control of thymic involution. Cell Immunol 2008; 252:122-138.https://doi.org/10.1016/j.cellimm.2007.10.007.
Olsen NJ, Olson G, Viselli SM, Gu X, Kovacs WJ. Androgen receptors in thymic epithelium modulate thymus size and thymocyte development. Endocrinology 2001; 142:1278-1283.https://doi.org/10.1210/endo.142.3.8032.
Merrheim J, Villegas J, Van Wassenhove J, Khansa R, Berrih-Aknin S, le Panse R, et al. Estrogen, estrogen-like molecules and autoimmune diseases. Autoimmun Rev 2020; 19:102468.https://doi.org/10.1016/j.autrev.2020.102468.
Perez-Cremades D, Mompeon A, Vidal-Gomez X, Hermenegildo C, Novella S. miRNA as a New Regulatory Mechanism of Estrogen Vascular Action. Int J Mol Sci 2018; 19.https://doi.org/10.3390/ijms19020473.
Vrtacnik P, Ostanek B, Mencej-Bedrac S, Marc J. The many faces of estrogen signaling. Biochem Med (Zagreb) 2014; 24:329-342.https://doi.org/10.11613/BM.2014.035.
Selvaraj V, Bunick D, Finnigan-Bunick C, Johnson RW, Wang H, Liu L, et al. Gene expression profiling of 17beta-estradiol and genistein effects on mouse thymus. Toxicol Sci 2005; 87:97-112.https://doi.org/10.1093/toxsci/kfi219.
Wei C, Guo D, Li Y, Zhang K, Liang G, Li Y, et al. Profiling analysis of 17beta-estradiol-regulated lncRNAs in mouse thymic epithelial cells. Physiol Genomics 2018; 50:553-562.https://doi.org/10.1152/physiolgenomics.00098.2017.
Yu X, Zhang X, Dhakal IB, Beggs M, Kadlubar S, Luo D. Induction of cell proliferation and survival genes by estradiol-repressed microRNAs in breast cancer cells. BMC Cancer 2012; 12:29.https://doi.org/10.1186/1471-2407-12-29.
Sakazaki F, Ueno H, Nakamuro K. 17beta-estradiol enhances contact hypersensitivity in a hair cycle-dependent manner and retards thymic atrophy with age. Immunopharmacol Immunotoxicol 2007; 29:597-609.https://doi.org/10.1080/08923970701513146.
Guo D, Ye Y, Qi J, Tan X, Zhang Y, Ma Y, et al. Age and sex differences in microRNAs expression during the process of thymus aging. Acta Biochim Biophys Sin (Shanghai) 2017; 49:409-419.https://doi.org/10.1093/abbs/gmx029.
Guo J, Wang X, Lu X, Jing R, Li J, Li C, et al. Unraveling molecular effects of ADAR1 overexpression in HEK293T cells by label-free quantitative proteomics. Cell Cycle 2016; 15:1591-1601.https://doi.org/10.1080/15384101.2016.1176657.
Kobayashi M, Miki Y, Ebina M, Abe K, Mori K, Narumi S, et al. Carcinoembryonic antigen-related cell adhesion molecules as surrogate markers for EGFR inhibitor sensitivity in human lung adenocarcinoma. Br J Cancer 2012; 107:1745-1753.https://doi.org/10.1038/bjc.2012.422.
Drabikowski K, Ferralli J, Kistowski M, Oledzki J, Dadlez M, Chiquet-Ehrismann R. Comprehensive list of SUMO targets in Caenorhabditis elegans and its implication for evolutionary conservation of SUMO signaling. Sci Rep 2018; 8:1139.https://doi.org/10.1038/s41598-018-19424-9.
Lu CC, Chiang JH, Tsai FJ, Hsu YM, Juan YN, Yang JS, et al. Metformin triggers the intrinsic apoptotic response in human AGS gastric adenocarcinoma cells by activating AMPK and suppressing mTOR/AKT signaling. Int J Oncol 2019; 54:1271-1281.https://doi.org/10.3892/ijo.2019.4704.
Bizzarri M, Delledonne M, Ferrarini A, Tononi P, Zago E, Vittori D, et al. Whole-Transcriptome Analysis Unveils the Synchronized Activities of Genes for Fructans in Developing Tubers of the Jerusalem Artichoke. Front Plant Sci 2020; 11:101.https://doi.org/10.3389/fpls.2020.00101.
Lorkiewicz PK, Gibb AA, Rood BR, He L, Zheng Y, Clem BF, et al. Integration of flux measurements and pharmacological controls to optimize stable isotope-resolved metabolomics workflows and interpretation. Sci Rep 2019; 9:13705.https://doi.org/10.1038/s41598-019-50183-3.
Escobar-Nino A, Lineiro E, Amil F, Carrasco R, Chiva C, Fuentes C, et al. Proteomic study of the membrane components of signalling cascades of Botrytis cinerea controlled by phosphorylation. Sci Rep 2019; 9:9860.https://doi.org/10.1038/s41598-019-46270-0.
Qin S, Liao Y, Du Q, Wang W, Huang J, Liu P, et al. DSG2 expression is correlated with poor prognosis and promotes early-stage cervical cancer. Cancer Cell Int 2020; 20:206.https://doi.org/10.1186/s12935-020-01292-x.
Ang Z, Koean RAG, Er JZ, Lee LT, Tam JKC, Guo H, et al. Novel AU-rich proximal UTR sequences (APS) enhance CXCL8 synthesis upon the induction of rpS6 phosphorylation. PLoS Genet 2019; 15:e1008077.https://doi.org/10.1371/journal.pgen.1008077.
Yang-Chun F, Sen-Yu W, Yuan Z, Yan-Chun H. Genome-Wide Profiling of Human Papillomavirus DNA Integration into Human Genome and Its Influence on PD-L1 Expression in Chinese Uygur Cervical Cancer Women. J Immunol Res 2020; 2020:6284960.https://doi.org/10.1155/2020/6284960.
Peng Q, Cheng M, Li T, Chen X, Shen Y, Zhu Y, et al. Integrated characterization and validation of the prognostic significance of microRNA-200s in colorectal cancer. Cancer Cell Int 2020; 20:56.https://doi.org/10.1186/s12935-020-1142-1.
Wang H, Hu H, Zhang Q, Yang Y, Li Y, Hu Y, et al. Dynamic transcriptomes of human myeloid leukemia cells. Genomics 2013; 102:250-256.https://doi.org/10.1016/j.ygeno.2013.06.004.
Wang J, Fu D, Senouthai S, Jiang Y, Hu R, You Y. Identification of the Transcriptional Networks and the Involvement in Angiotensin II-Induced Injury after CRISPR/Cas9-Mediated Knockdown of Cyr61 in HEK293T Cells. Mediators Inflamm 2019; 2019:8697257.https://doi.org/10.1155/2019/8697257.
Iida M, Tsuboi K, Niwa T, Ishida T, Hayashi SI. Compensatory role of insulin-like growth factor 1 receptor in estrogen receptor signaling pathway and possible therapeutic target for hormone therapy-resistant breast cancer. Breast Cancer 2019; 26:272-281.https://doi.org/10.1007/s12282-018-0922-0.
Song RX, Zhang Z, Chen Y, Bao Y, Santen RJ. Estrogen signaling via a linear pathway involving insulin-like growth factor I receptor, matrix metalloproteinases, and epidermal growth factor receptor to activate mitogen-activated protein kinase in MCF-7 breast cancer cells. Endocrinology 2007; 148:4091-4101.https://doi.org/10.1210/en.2007-0240.
Choi NH, Lucchetta E, Ohlstein B. Nonautonomous regulation of Drosophila midgut stem cell proliferation by the insulin-signaling pathway. Proc Natl Acad Sci U S A 2011; 108:18702-18707.https://doi.org/10.1073/pnas.1109348108.
Gao C, He XF, Xu QR, Xu YJ, Shen J. Sevoflurane downregulates insulin-like growth factor-1 to inhibit cell proliferation, invasion and trigger apoptosis in glioma through the PI3K/AKT signaling pathway. Anticancer Drugs 2019; 30:e0744.https://doi.org/10.1097/CAD.0000000000000744.
Yale AR, Nourse JL, Lee KR, Ahmed SN, Arulmoli J, Jiang AYL, et al. Cell Surface N-Glycans Influence Electrophysiological Properties and Fate Potential of Neural Stem Cells. Stem Cell Reports 2018; 11:869-882.https://doi.org/10.1016/j.stemcr.2018.08.011.
Shimada S, Hirose T, Takahashi C, Sato E, Kinugasa S, Ohsaki Y, et al. Pathophysiological and molecular mechanisms involved in renal congestion in a novel rat model. Sci Rep 2018; 8:16808.https://doi.org/10.1038/s41598-018-35162-4.
O'Lone R, Knorr K, Jaffe IZ, Schaffer ME, Martini PG, Karas RH, et al. Estrogen receptors alpha and beta mediate distinct pathways of vascular gene expression, including genes involved in mitochondrial electron transport and generation of reactive oxygen species. Mol Endocrinol 2007; 21:1281-1296.https://doi.org/10.1210/me.2006-0497.
Luconi M, Muratori M, Forti G, Baldi E. Identification and characterization of a novel functional estrogen receptor on human sperm membrane that interferes with progesterone effects. J Clin Endocrinol Metab 1999; 84:1670-1678.https://doi.org/10.1210/jcem.84.5.5670.
Kuiper GG, Enmark E, Pelto-Huikko M, Nilsson S, Gustafsson JA. Cloning of a novel receptor expressed in rat prostate and ovary. Proc Natl Acad Sci U S A 1996; 93:5925-5930.https://doi.org/10.1073/pnas.93.12.5925.
Tremblay GB, Tremblay A, Copeland NG, Gilbert DJ, Jenkins NA, Labrie F, et al. Cloning, chromosomal localization, and functional analysis of the murine estrogen receptor beta. Mol Endocrinol 1997; 11:353-365.https://doi.org/10.1210/mend.11.3.9902.
Couse JF, Lindzey J, Grandien K, Gustafsson JA, Korach KS. Tissue distribution and quantitative analysis of estrogen receptor-alpha (ERalpha) and estrogen receptor-beta (ERbeta) messenger ribonucleic acid in the wild-type and ERalpha-knockout mouse. Endocrinology 1997; 138:4613-4621.https://doi.org/10.1210/endo.138.11.5496.
Brandenberger AW, Tee MK, Lee JY, Chao V, Jaffe RB. Tissue distribution of estrogen receptors alpha (ER-alpha) and beta (ER-beta) mRNA in the midgestational human fetus. J Clin Endocrinol Metab 1997; 82:3509-3512.https://doi.org/10.1210/jcem.82.10.4400.
Kuiper GG, Carlsson B, Grandien K, Enmark E, Haggblad J, Nilsson S, et al. Comparison of the ligand binding specificity and transcript tissue distribution of estrogen receptors alpha and beta. Endocrinology 1997; 138:863-870.https://doi.org/10.1210/endo.138.3.4979.
Robertson JF. Faslodex (ICI 182, 780), a novel estrogen receptor downregulator--future possibilities in breast cancer. J Steroid Biochem Mol Biol 2001; 79:209-212.https://doi.org/10.1016/s0960-0760(01)00138-8.
Wakeling AE, Dukes M, Bowler J. A potent specific pure antiestrogen with clinical potential. Cancer Res 1991; 51:3867-3873
Zhang X. Hepatocyte growth factor system in the mouse uterus: variation across the estrous cycle and regulation by 17-beta-estradiol and progesterone. Biol Reprod 2010; 82:1037-1048.https://doi.org/10.1095/biolreprod.109.079772.

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Unveiling the Impact of 17β-Estradiol on Thymic Epithelial Cell Proliferation: A miRNA Perspective

Status:

Version 1

Abstract

Figures

Introduction

Materials and methods

Cell culture and treatment

Cell viability and cell cycle assays

5-ethynyl‑20‑deoxyuridine (EdU) assays

MiRNA sequencing

Identification and analysis of known and potential novel miRNAs

Quantitative polymerase chain reaction (qPCR)

Functional analysis

Cell transfection

Statistical analysis

Results

E2 inhibited cell viability and induced cell cycle arrest in G2/M in MTEC1 cells

For small RNA library construction analyses

Identification of E2-altered miRNAs in MTEC1 cells by E2

miRNA expression profiles in MTEC1 cells were validated by qPCR

Functional analysis of E2-altered miRNAs

Discussion

Conclusion

Abbreviations

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1