Crucial effect of interleukin-17/IL-17RC signaling on bio-functions of alveolar type II epithelial cell through Akt and STAT pathways

doi:10.21203/rs.3.rs-3765797/v1

Download PDF

Article

Crucial effect of interleukin-17/IL-17RC signaling on bio-functions of alveolar type II epithelial cell through Akt and STAT pathways

https://doi.org/10.21203/rs.3.rs-3765797/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

The aim of this study was to explore the role of interleukin (IL)-17/IL-17RC signaling in the function of human alveolar type II epithelial cell-derived cell line of A549 cells. An in vitro LPS-challenged A549 cell model was established to assess the expression of IL-17RC. The effects of IL-17 alone or with LPS in A549 were evaluated by detecting the expression of surfactant protein A (SPA), epithelial sodium channel (ENaC), inflammatory cytokine tumor necrosis factor (TNF)-α and IL-8. Moreover, IL-17RC neutralizing antibody and STAT inhibitor were employed to explore the mechanism underlying IL-17/IL-17RC signaling influencing on A549 cell biological behavior. IL-17RC was expressed on A549 cells and showed a time and LPS dose dependent manner. IL-17 treatment could exert a synergistic effect with LPS, which could result in significantly elevated expression level of TNF-α and IL-8 and reduced expression level of SPA and ENaC. Activation of phosphorylation Akt and STAT were involved in the process of IL-17/IL-17RC signaling effects on A549 cell biological behavior and inhibition the Akt and STAT pathway with AG490 could reverse the effects exerted by IL-17/IL-17RC signaling. The results demonstrated that IL-17/IL-17RC signaling could modulate the biological function of human alveolar type II epithelial cell-derived A549 cells via promoting TNF-α and IL-8 expression, suppressing SPA and ENaC expression, and through activating Akt and STAT signaling pathway.

Health sciences/Diseases/Respiratory tract diseases/Respiratory distress syndrome

Biological sciences/Cell biology

Interleukin-17

IL-17RC

A549

LPS

Akt

STAT

Acute lung injury (ALI) and acute respiratory distress syndrome (ARDS) (known as severe form of ALI) are characterized by intra-lung inflammatory reactions. Inflammation in lung could result in different degrees of ventilation-perfusion mismatch, alveolar damage, reduced or lost lung compliance, accumulated hypoxemia as well as non-cardiogenic pulmonary edema (1–3). It is reported that the mortality of ALI/ARDS nearly over 40%, even though novel strategies, such as fluid-conservative therapy, prone position as well as lung-protective ventilation strategies, had been applied or proposed to treat the disease in recent decades (4–7). Accumulated evidence has revealed that the pathogenesis of ALI was associated with lung inflammation and immune reaction, which is processed by inflammatory cell infiltration, abnormal expression of proteases and pro-inflammatory cytokine, aberrant level of reactive oxygen species (ROS), and destruct alveolar capillary barrier (8–10). Pulmonary alveolar type II (ATII) cells, specialized endothelial cells, were resident in alveoli. Recent reports showed that ATII epithelial cells pathologically exert crucial role in ALI development through modulating surfactant synthesizing, secreting, recruiting and functioning(11, 12). Therefore, understanding biological function of ATII epithelial cells and modulation mechanism could be helpful in the therapeutic intervention of ALI.

IL-17 is a proinflammatory cytokine produced by activated memory CD4⁺T cells and has been shown to be involved in the pulmonary cell emigration under the condition of both local gram-negative bacterial infection (13) and antigenic stimuli (14). IL-17 over-expression or recombinant IL-17 administration into the lung could result in the induction of chemokines, such as IL-6, IL-8 and IL-1β which can recruit inflammatory cells to the airway (15–17). Although IL-17 is currently considered to be an attractive target for inflammatory responses in the lung (18), the precise role of IL-17/IL-17RC signaling in modulating ATII epithelial cell biological function has yet not been defined.

Here, we have examined the role of IL-17/IL-17RC signaling in biological function of human alveolar type II epithelial cell-derived cell line of A549 cells. The results showed that IL-17 had the ability to modulate the function of human alveolar type II epithelial cell-derived cell line of A549 cells through its receptor of IL-17RC and Akt and STAT pathway were involved in the process of IL-17/IL-17RC modulation behavior.

Reagents. Recombinant human IL-17 protein (cat. no. 7955-IL), ELISA kit for human tumor necrosis factor (TNF)-α (cat. no. DTA00C) and interleukin (IL)-8 (cat. no. D8000C) were purchased from R&D system (Minneapolis, MN, USA). Lipopolysaccharide (LPS) (cat. no. L2880-10MG) was from Sigma-Aldrich (St.Louis, MO, USA). STAT inhibitor AG490 (cat. no. 573097) was obtained from Millipore (Temecula, CA, USA). Antibodies for phospho-Akt (cat. no. 4058T), Akt (cat. no. 4691), phospho-STAT (cat. no. 9145T) and STAT (cat. no. 12640) were from Cell Signaling Technology (Danvers, MA, USA).

Cell culture. Cell line of A549 (human alveolar type II (ATII) epithelial cells) (ATCC, Manassas, VI, USA) was cultivated in 6 well plate with medium of DMEM (cat. no. 11965118, Life Technology; Carslbad, CA, USA) and 10% (v/v) fetal bovine serum (FBS) (cat. no. 16140071, Life Technology; Carslbad, CA, USA), which was supplemented with antibiotics of streptomycin (100 µg/ml) + penicillin (100 U/ml) (HyClone, USA). The cells were incubated in humidified incubator with 5% CO₂ at 37 ℃. The cells were passaged at 80–90% confluence.

Cell treatment.

A549 cells were divided into several groups. There are LPS treated groups (0.01 µg/ml, 0.1µg/ml, 1 µg/ml and 10 µg/ml of LPS were added to each group, respectively); IL-17 groups (0.1 µg/ml, 0.5 µg/ml and 1 µg/ml of IL-17 were added to each group, respectively); LPS + IL-17 group (1 µg/ml of LPS and 0.5 µg/ml of IL-17 were added to this group) and IL-17 + AG490 group (0.5 µg/ml of IL-17 and 50 µM of AG490 were added to this group). A549 cells were seeded in 6 wells or 96 wells with these reagents for 12 h or 24 h depending on conditions of subsequent experiments.

Real-time transcription-polymerase chain reaction (RT–PCR). A549 cells were harvested and lysed in TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA). Total RNA of A549 cells were extracted using RNA extraction kit (cat. no. R1200-50, Solarbio, Beijing, China) according to the manufacture’s protocol. The RNA quantification and qualification was examined using Nanodrop™ Nd-1000 spectrophotometer (Invitrogen; Thermo Fisher Scientific, Inc.). Only the RNA whose rate of A260/280 was between 1.8 to 2.0 could be used as templates for further RT-PCR. The total RNA was then transcripted into cDNA using PrimeScript first strand cDNA synthesis kit (Invitrogen; Thermo Fisher Scientific, Inc.). The transcripted cDNA was used for realtime PCR to examine expressions of indicated genes with SYBR green reagent (TaKaRa, Dalian, China) on the ABI 7000 PCR instrument (Thermo Fisher Scientific, Inc.). The 20µl of PCR reacting contents included 10 µl SYBR Premix Ex Taq (TaKaRa, Dalian, China), 2 µl cDNA template, 0.8 µl Primer (0.4 µl each forward and reverse) and 7.2 µl dH₂O. The primers for target genes are listed in Table I. The PCR process was initiated by denaturation at 95˚C for 4 min, then 40 cycles of denatured for 10 sec at 95˚C, annealed for 20 sec at 50˚C and elongated for 25 sec at 72˚C. The relative mRNA expression level after realtime PCR was calculated using the 2^−ΔΔCq method (19). Data reveal the average of triplicate experiments.

Measurement of TNF-α and IL-8 by ELISA assay. A 549 cells were seeded in 96-well plate at a concentration of 1 × 10⁴ for 24 h. The cells were then treated with indicated concentrations of LPS, IL-17 and/or AG490. After intervention with above reagents, the culture supernatant from these cells were collected and the cytokines of TNF-α and IL-8 secreted by A549 cells into supernatant were examined using a mouse enzyme-linked immunosorbent assay (ELISA) kit (R&D system, Minneapolis, MN, USA) according to the manufacturer's protocol. The OD values at 450 nm for each well were detected using a spectrometer (BioTek).

Western-blotting. A549 cells (2.5 × 10⁵ cells) were cultured in 6-well plates and harvested for examining relevant protein expression using western blot assay. Before collecting cells, the cell culture medium was replaced using new serum-free medium for starving and cultured for another twenty-four hours. The cells were then administrated with LPS, and/or IL-17, AG490 for each corresponding group. After harvesting, the cells were washed twice with cold PBS and lysed on ice using protein lysate (Beyotime, Shanghai, China). The lysate protein was quantified by BCA method (Beyotime). The proteins from each group were then separated in 10% polyacrylamide gels and transferred onto PVDF membranes (Merck Millipore, Carrigtwohill, Ireland). The proteins on PVDF membranes were then kept in blocking buffer containing 5% skimmed milk for 1 h at room temperature followed by incubation with primary antibodies overnight at 4˚C. Following this step, the membranes were rinsed for 3 times using TBST and incubated with corresponding secondary antibodies (cat. no. RPN4301, at a 1:5000 dilution; Amersham; GE Healthcare Life Sciences, Chalfont, UK) for 1 h at room temperature. The blots for target proteins reacted with a reagent of enhanced chemiluminescence (ECL) (Tanon Science and Technology, Shanghai, China) and visualized promptly on a 1 Tanon-5200 Multi-imaging System. The experiments were performed in triplicate.

Statistical analyses. SPSS 20.0 (IBM SPSS, Armonk, NY, USA) was employed to perform all data analyses. All data were depicted as mean ± standard error (number of observations). Comparisons between variables were carried out by Student’s t test; Comparisons among multiple datasets were performed by one-way analysis of variance (ANOVA). P values less than 0.05 indicate statistically significant.

IL-17RC expression in lung A549 cells. To test the effects of IL-17/IL-17RC signaling on lung ATII cells, we firstly examined the expression of IL-17RC on lung ATII cell line of A549 cells. The results showed that both of IL-17RC mRNA and protein were expressed in A549 cells (Fig. 1A and B). Furthermore, we also tested the effect of LPS stimulation on the IL-17RC expression in A549 cells. It showed that IL-17RC expression exhibited time and dose dependent manner in A549 cells under LPS stimulation (Fig. 1C and D).

IL-17 promoting the expression of TNF-α and IL-8 but suppressing the expression of SPA, ENaC in A549 cells. We then examined the effects of IL-17 on SPA, ENaC, TNF-α and IL-8 expression in A549 cells. The results showed that the mRNA expression level of SPA and ENaC was decreased, and the mRNA expression level of TNF-α and IL-8 was increased in A549 cells after stimulation with different concentrations of IL-17 (Fig. 2). Furthermore, we also observed decreased mRNA expression level of SPA and ENaC, and increased mRNA expression level of TNF-α and IL-8 in A549 cells with the time increasing (Fig. 3A-D). In addition, we found increased secretion of TNF-α and IL-8 in the culture supernatants and decreased protein level of SPA and ENaC in A549 cells with the time increasing (Fig. 3E-I).

IL-17 enhances LPS induced effects in A549 cells. We next investigated whether IL-17 had potential synergies on regulation expression of SPA, ENaC, TNF-α and IL-8 in A549 cells by LPS. The ELISA assay showed significant increases in TNF-α and IL-8 expression in IL-17 plus LPS treatment groups compared to IL-17 treatment groups or LPS treatment groups (Fig. 4A, B). The western blot results showed that there was significant reduction of SPA and ENaC expression in IL-17 plus LPS treatment groups compared to IL-17 treatment groups or LPS treatment groups (Fig. 4C-E).

IL-17RC neutralization partially abrogated IL-17 effects in A549 cell biologic behavior. In order to investigate whether the IL-17 effects in A549 cell biological behavior is mediated through IL-17RC. The neutralizing anti-IL-17RC mAb was applied to block IL-17/IL-17RC signaling. The results showed that anti-IL-17RC mAb could partially abrogate the effects induced by IL-17 in A549 cells (Fig. 5).

We also collected the A549 cells with different treatment and the results showed that application of anti-IL-17RC mAb could significantly decrease phospho-Akt and phospho-STAT expression level in A549 cells (Fig. 6).

AG490 abrogated IL-17 effects in A549 cells. We also employed the STAT inhibitor- AG490 to investigate whether IL-17/IL-17RC signaling influence on A549 cell biological functions through STAT pathway. It showed that AG490 exerted reverse effects to IL-17, resulting in decreased expression level of TNF-α and IL-8, and increased expression level of SPA and ENaC (Fig. 7).

In the present study, we first confirmed the expression of IL-17RC on A549 cells using RT-PCR and western blot. We found that the expression of IL-17RC in A549 cells was time- and LPS dose-dependent. Moreover, our results also showed that the expression pattern of SPA, ENaC, TNF-α and IL-8 in A549 cells was time and LPS dose- dependent after IL-17 stimulation. We then used the lung functional markers, SPA, ENaC, inflammatory cytokine TNF-α and IL-8, to test the effects of IL-17/IL-17RC on the biological function of A549 cells. The results showed that IL-17 treatment could exert a synergistic effect with LPS, resulting in a significantly increased expression levels of TNF-α and IL-8 and reduced expression levels of SPA and ENaC. The phosphorylation of Akt and STAT was involved in the process of IL-17/IL-17RC mediating biological function of A549 cells and inhibition with AG490 could abrogate the IL-17 effects. This is original findings about the effects of IL-17/IL-17RC signaling on the functions of human alveolar type II (ATII) epithelial cell-derived cell line A549 and mechanisms underlying IL-17/IL-17RC signaling mediating A549 cell behavior through activating Akt and STAT pathway.

Surfactant protein A (SPA) characterized as a large multimeric protein was generally located on alveoli and bronchus in lungs (20, 21). It was reported that collectin protein family includes SPA that contains NH₂-terminal collagen-like domains as well as COOH-terminal lectin domains (22–23). SPA has the ability to regulate pulmonary immune response as other Surfactant proteins, such as SPB etc., can frequently alleviate surface tension when they expressed in lungs (24). It was documented that the pathogen uptake was enhanced by SPA through promoting the event of phagocytic binding to extensive pathogens. SPA was also reported having the ability to regulate reaction of priming and enhancing inflammation. The function of SPA was exerted by suppressing secretion or expression of TNF-α and/or other pro-inflammatory cytokines when responding to stimulation of LPS(25), or potentiating the capability of eliminating various pathogens in in vivo studies using SPA-deficient (SP-A^−/−) mice (26–28). Hence, SP-A was intensively involved in multiple process of pulmonary host defense. Goto et al. have stated that SP-A have an important role in regulating inflammatory response, vascular permeability and cell apoptosis, which were documented as critical process of occurrence and development of ALI(29). Herein, in our current study, it was showed that IL-17 could suppress SP-A expression depending on IL-17 intervening duration and concentration, suggesting IL-17/IL-17RC signaling had effect on ALI development through modulating production level of SP-A.

As we known, the epithelial Na⁺ channel (ENaC), the Na⁺–K⁺-adenosine triphosphatase and aquaporin composed into an active transport system in several cells, such as alveolar epithelium. ENaC is highly selective for Na⁺ ions, as ENaC exerts its function basically on intracellular Na⁺ uptake.There are three homologous subunits, including α, β and γ, composing the structure of ENaC, which implicated in regulation of most oedema fluid absorption (30, 31). Currently, ENaC is reported to be a key role in ALI pathogenic progress (?). In our present study, we found that ENaC level reduced following IL-17 intervening, exhibiting time and dose dependent manner, suggesting IL-17/IL-17RC signaling affects ALI development through regulating expression of ENaC both in mRNA and protein level in vitro.

TNF-α has been proven to be involved in numerous inflammatory lung diseases. Chronic bronchitis (CB), asthma, acute lung injury (ALI) and its severe form acute respiratory distress syndrome (ARDS) and chronic obstructive pulmonary disease (COPD), etc. were all mediated directly or indirectly by TNF-α (32). Besides, IL-8 was also proven to be implicated in ALI/ARDS, except for its potent of attracting and activating neutrophil (33).Miller et al. revealed that the secreting level of IL-18 in bronchoalveolar lavage fluids from ARDS patients was higher than that from health patients. It was also showed that a high mortality rate was occurred in patients with higher IL-8 concentration in bronchoalveolar lavage fluids when compared to patients with lower IL-8 concentration in bronchoalveolar lavage fluids(34).

We also observed the up-regulated expression of TNF-α and IL-8 in IL-17 treated A549 cells.

IL-17 mediates signaling through distinct pathways in numerous inflammatory cells and tumor cells, such as MAPK, NF-κB, and the STAT3 pathway (35). Moreover, IL-17 was suggested to be controlled through activation of AKT signaling (36). We also confirmed the upregulation of Akt and STAT3 after IL-17 treatment, whereas anti-IL-17RC mAb could reverse the effect exerted by IL-17. Furthermore, the STAT3 inhibitor AG490 exhibited a similar effect as that of the anti-IL-17RC mAb.

In conclusion, our results demonstrated that IL-17 could modulate the function of human alveolar type II epithelial cell-derived A549 cells through IL-17RC. The Akt and STAT signaling pathway were involved in this mechanism. Our results suggest a novel therapeutic intervention target in the treatment of ALI.

Not applicable.

Funding

The present study was supported by the Suzhou municipal project for Gusu talents (Dingqi) and Suzhou Municipal Natural Science Foundation (grant no. SKJY2021056).

Availability of data and materials

All data generated or analyzed during this study are included in this published article.

Authors' contributions

QD, XJ, and FH and PY designed the study, led the experiments, prepared figures and wrote the manuscript. MW, CX and QL analyzed the data and prepared the figures. QD and XJ conceived, designed and coordinated the study as well as drafted the manuscript. All authors read and approved the final manuscript.

Ethics approval and consent to participate

Not applicable.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Rubenfeld GD, Caldwell E, Peabody E, Weaver J, Martin DP, Neff M, Stern EJ, Hudson LD: Incidence and outcomes of acute lung injury. N Engl J Med 353: 1685–1693, 2005.
Santos LAMD, Rodrigues GB, Mota FVB, França MER, de Souza Barbosa KP, Oliveira WH, Rocha SWS, Lós DB, Silva AKS, Silva TGD, Peixoto CA: New thiazolidinedione LPSF/GQ-2 inhibits NFκB and MAPK activation in LPS-induced acute lung inflammation. Int Immunopharmacol 57:91–101, 2018.
Tai W, Li J, Zheng B, Wu H, Ding J, Gao L, Dong Z: Inhibitory Effect of Circulating Fibrocytes on Injury Repair in Acute Lung Injury/Acute Respiratory Distress Syndrome Mice Model. J Cell Biochem 2018.
Acute Respiratory Distress Syndrome Network, Brower RG, Matthay MA, Morris A, Schoenfeld D, Thompson BT, Wheeler A: Ventilation with lower tidal volumes as compared with traditional tidal volumes for acute lung injury and the acute respiratory distress syndrome. N Engl J Med 342:1301–1308, 2000.
Guérin C, Reignier J, Richard JC, Beuret P, Gacouin A, Boulain T, Mercier E, Badet M, Mercat A, Baudin O, Clavel M, Chatellier D, Jaber S, Rosselli S, Mancebo J, Sirodot M, Hilbert G, Bengler C, Richecoeur J, Gainnier M, Bayle F, Bourdin G, Leray V, Girard R, Baboi L, Ayzac L; PROSEVA Study Group: Prone positioning in severe acute respiratory distress syndrome. N Engl J Med 368:2159–2168, 2013.
Matthay MA, Ware LB, Zimmerman GA: The acute respiratory distress syndrome. J Clin Invest 122:2731–2740, 2012.
Zambon M, Vincent JL: Mortality rates for patients with acute lung injury/ARDS have decreased over time. Chest 133:1120–1127, 2008.
Chopra M, Reuben JS, Sharma AC: Acute lung injury:apoptosis and signaling mechanisms. Exp Biol Med (Maywood) 234:361–371, 2009.
Pedrazza L, Cunha AA, Luft C, Nunes NK, Schimitz F, Gassen RB, Breda RV, Donadio MV, de Souza Wyse AT, Pitrez PMC, Rosa JL, de Oliveira JR: Mesenchymal stem cells improves survival in LPS-induced acute lung injury acting through inhibition of NETs formation. J Cell Physiol 232:3552–3564, 2017.
Hu X, Shen H, Wang Y, Zhao M: Liver X Receptor Agonist TO901317 Attenuates Paraquat-Induced Acute Lung Injury through Inhibition of NF-κB and JNK/p38 MAPK Signal Pathways. Biomed Res Int 2017: 4652695, 2017.
Mendelson CR: Role of transcription factors in fetal lung development and surfactant protein gene expression. Annu Rev Physiol 62: 75–915, 2000.
Rooney SA: Regulation of surfactant secretion. Comp Biochem Physiol A Mol Integr Physiol 129: 233–243, 2001.
Ye P, Garvey PB, Zhang P, Nelson S, Bagby G, Summer WR, Schwarzenberger P, Shellito JE, Kolls JK: Interleukin-17 and lung host defense against Klebsiella pneumoniae infection. Am J Respir Cell Mol Biol 25:335–340, 2001.
Hellings PW, Kasran A, Liu Z, Vandekerckhove P, Wuyts A, Overbergh L, Mathieu C, Ceuppens JL: Interleukin-17 orchestrates the granulocyte influx into airways after allergen inhalation in a mouse model of allergic asthma. Am J Respir Cell Mol Biol 28:42–50, 2003.
Laan M, Cui ZH, Hoshino H, Lötvall J, Sjöstrand M, Gruenert DC, Skoogh BE, Lindén A: Neutrophil recruitment by human IL-17 via C-X-C chemokine release in the airways. J Immunol 162:2347–2352, 1999.
Camargo LDN, Righetti RF, Aristóteles LRCRB, Dos Santos TM, de Souza FCR, Fukuzaki S, Cruz MM, Alonso-Vale MIC, Saraiva-Romanholo BM, Prado CM, Martins MA, Leick EA, Tibério IFLC: Effects of Anti-IL-17 on Inflammation, Remodeling, and Oxidative Stress in an Experimental Model of Asthma Exacerbated by LPS. Front Immunol 8:1835, 2018.
Patel D, Gaikwad S, Challagundla N, Nivsarkar M, Agrawal-Rajput R: Spleen tyrosine kinase inhibition ameliorates airway inflammation through modulation of NLRP3 inflammosome and Th17/Treg axis. Int Immunopharmacol 54:375–384, 2018.
Jones CE, Chan K: Interleukin-17 stimulates the expression of interleukin-8, growth-related oncogene-alpha, and granulocyte-colony-stimulating factor by human airway epithelial cells. Am J Respir Cell Mol Biol 26:748–753, 2002.
Ji Y, Strawn TL, Grunz EA, Stevenson MJ, Lohman AW, Lawrence DA, Fay WP: Multifaceted role of plasminogen activator inhibitor-1 in regulating early remodeling of vein bypass grafts. Arterioscler Thromb Vasc Biol 31:1781–1787, 2011.
Wright JR: Immunoregulatory functions of surfactant proteins. Nat Rev Immunol 5:58–68, 2005.
Hasegawa Y, Takahashi M, Ariki S, Saito A, Uehara Y, Takamiya R, Kuronuma K, Chiba H, Sakuma Y, Takahashi H, Kuroki Y: Surfactant protein A down-regulates epidermal growth factor receptor by mechanisms different from those of surfactant protein D. J Biol Chem 292:18565–18576, 2017.
Cau F, Pisu E, Gerosa C, Senes G, Ronchi F, Botta C, Di Felice E, Uda F, Marinelli V, Faa G, Fanos V, Moretti C, Fanni D: Interindividual variability in the expression of surfactant protein A and B in the human lung during development. Eur J Histochem 60:2678, 2016.
Goto H, Mitsuhashi A, Nishioka Y: Role of surfactant protein A in non-infectious lung diseases. J Med Invest 61:1–6, 2014.
Vieira F, Kung JW, Bhatti F: Structure, genetics and function of the pulmonary associated surfactant proteins A and D: The extra-pulmonary role of these C type lectins. Ann Anat 211:184–201, 2017.
Borron P, McIntosh JC, Korfhagen TR, Whitsett JA, Taylor J, Wright JR: Surfactant-associated protein A inhibits LPS-induced cytokine and nitric oxide production in vivo. Am J Physiol Lung Cell Mol Physiol 278:L840-847, 2000.
Giannoni E, Sawa T, Allen L, Wiener-Kronish J, Hawgood S: Surfactant proteins A and D enhance pulmonary clearance of Pseudomonas aeruginosa. Am J Respir Cell Mol Biol 34:704–710, 2006.
Atochina EN, Beck JM, Preston AM, Haczku A, Tomer Y, Scanlon ST, Fusaro T, Casey J, Hawgood S, Gow AJ, Beers MF: Enhanced lung injury and delayed clearance of Pneumocystis carinii in surfactant protein A-deficient mice: attenuation of cytokine responses and reactive oxygen-nitrogen species. Infect Immun 72:6002–6011, 2004.
Kuronuma K, Sano H, Kato K, Kudo K, Hyakushima N, Yokota S, Takahashi H, Fujii N, Suzuki H, Kodama T, Abe S, Kuroki Y: Pulmonary surfactant protein A augments the phagocytosis of Streptococcus pneumoniae by alveolar macrophages through a casein kinase 2-dependent increase of cell surface localization of scavenger receptor A. J Biol Chem 279:21421–21430, 2004.
Goto H, Ledford JG, Mukherjee S, Noble PW, Williams KL, Wright JR: The role of surfactant protein A in bleomycin-induced acute lung injury. Am J Respir Crit Care Med 181: 336–1344, 2010.
Althaus M, Clauss WG, Fronius M: Amiloride-sensitive sodium channels and pulmonary edema. Pulm Med 2011: 830320, 2011.
Luo L, Deng J, Wang DX, He J, Deng W: Regulation of epithelial sodium channel expression by oestradiol and progestogen in alveolar epithelial cells. Respir Physiol Neurobiol 216:52–62, 2015.
Mukhopadhyay S, Hoidal JR, Mukherjee TK: Role of TNFalpha in pulmonary pathophysiology. Respir Res 7:125, 2006.
Allen TC, Kurdowska A: Interleukin 8 and acute lung injury. Arch Pathol Lab Med 138: 66–269, 2014.
Miller EJ, Cohen AB, Nagao S, Griffith D, Maunder RJ, Martin TR, Weiner-Kronish JP, Sticherling M, Christophers E, Matthay MA: Elevated levels of NAP-1/interleukin-8 are present in the airspaces of patients with the adult respiratory distress syndrome and are associated with increased mortality. Am Rev Respir Dis 146:427–432, 1992.
Gaffen SL: Structure and signalling in the IL-17 receptor family. Nat Rev Immunol 9:556–567, 2009.
Gu FM, Li QL, Gao Q, Jiang JH, Zhu K, Huang XY, Pan JF, Yan J, Hu JH, Wang Z, Dai Z, Fan J, Zhou J: IL-17 induces AKT-dependent IL-6/JAK2/STAT3 activation and tumor progression in hepatocellular carcinoma. Mol Cancer 10:150, 2011.

Table I. Sequences of the primers used for reverse transcription-polymerase chain reaction analysis.

Primer	Sequence (5'→3')	Product size (bp)	Annealing temperature (˚C)	Cycles (n)
TNF-α	F: GGAGAAGGGTGACCGACTCA R: CTGCCCAGACTCGGCAA	70	60	40
IL-8	F: ATAAAGACATACTCCAAACCTTTCCAC R: AAGCTTTACAATAATTTCTGTGTTGGC	102	60	40
SPA	F: CTGTCCCAAGGAATCCAGAG R: CCGTCTGAGTAGCGGAAGTC	121	60	40
ENaC	F: GGTGGACTGGAAGGACTGGAAGATCG R: ATGAAGTTGCCCAGCGTGTCCTCCTC	189	60	40
β-actin	F: TCACCCACACTGTGCCCATCTACG R: CAGCGGAACCGCTCATTGCCAATG	295	60	40
F, forward primer; R, reverse primer; TNF, Tumor Necrosis Factor; IL, interleukin; SPA, surfactant protein A; ENaC, epithelial sodium channel

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Crucial effect of interleukin-17/IL-17RC signaling on bio-functions of alveolar type II epithelial cell through Akt and STAT pathways

Status:

Version 1

Abstract

Figures

Introduction

Materials and methods

Results

Discussion

Declarations

References

Tables

Additional Declarations

Status:

Version 1