Ionizing radiation (IR) is known to induce the formation of reactive oxygen species, which are linked to chronic diseases. Tea is the most commonly consumed beverage worldwide. Tea consumption was demonstrated to have ameliorative effects in subjects with chronic diseases, which were explained by antioxidant and anti-inflammatory effects. This cross-sectional study to evaluate the potential benefits of green tea consumption on oxidative stress and DNA repair induced by occupational exposure to IR. A cohort of hospital workers exposed to occupational levels of IR were divided into two groups based on their tea consumption. Peripheral blood cell count were counted by a automated Coulter Counter. Markers of oxidative stress and inflammatory were detected commercial kit. DNA repair gene expression was detected by RT-PCR.The subjects in the no tea-consuming group presented with significantly decreased plasma levels of total antioxidant content (TAC) and superoxide dismutase (SOD) compared to the tea drinking group. In contrast, the non-tea-drinking group showed significantly increased plasma levels of malondialdehyde (MDA) and 8-hydroxy-2 deoxyguanosine (8-OHdG), indicating oxidative stress at the tissue and DNA levels, respectively. The Tea Group subjects showed significantly lower plasma levels of C-reactive protein and TNF-α compared with the No Tea Group. However, the expressions of DNA repair genes (OGG1 and XRCC1) were not significantly different between two groups. In conclusion, green tea consumption might be a novel method for decreasing levels of oxidative stress in workers exposed to low levels of IR.
Research Article
Effects of green tea consumption on oxidative stress and DNA repair in hospital staff exposed to low dose ionizing radiation
https://doi.org/10.21203/rs.3.rs-3766255/v1
This work is licensed under a CC BY 4.0 License
Version 1
posted
You are reading this latest preprint version
green tea
ionizing radiation
oxidative stress
DNA repair
hospital staff
Currently, ionizing radiation (IR) is used extensively in the healthcare, research, and nuclear power industries. Occupational IR exposure at low doses is common, with more than two million workers are exposed to occupational IR every day [1]. The hazards of long-term, low-dose IR exposure has recently gained attention [2, 3]. Epidemiological studies found that there is a close correlation between low-dose IR and some chronic diseases, such as cancer and cardiovascular diseases[4]. The genotoxic activity of IR has been investigated, and different mechanisms have been identified. The underlying mechanism of action for toxicity is believed to be oxidative stress and DNA damage[5]. IR induces the formation of reactive oxygen species (ROS). These ROS play critical roles in cell fate, as ROS function as second messengers and modify some signaling pathways. Chronic ROS exposure may damage the cellular genome and other important biomolecules. Responses to IR exposure induced DNA damage repair and the activation of checkpoint pathways[6].
Tea is the most commonly-consumed beverage worldwide, especially in China. Many biologically active constituents are present in green tea infusions, including polyphenol polymers, amino acids, polysaccharides, saponins, and alkaloids[7]. Green tea consumption was demonstrated to have ameliorative effects in subjects with chronic diseases, and these beneficial effects were mainly explained by antioxidant and anti-inflammatory agents in the tea[8]. As the formation of ROS is critical prerequisite for the adverse health effects of IR, the present study aimed to investigate the influence of tea consumption on oxidative stress and the expression of DNA repair genes among hospital staff exposed to IR.
Study population
Subjects were recruited from a routine health check of Suzhou hospital staff in the City of Suzhou. The recruited staff members were occupationally exposed to IR from the Department of Nuclear Medicine, Radiology, Interventional Radiology and Oncological Radiotherapy. The subjects consisted of 212 staff members with at least one year of work experience. All were supplied individual dosimeters, and the effective doses were periodically recorded. All subjects agreed to participate in the study, and the research was approved by the ethical committee of Soochow University. Individual interviews were conducted by physicians. None of the subjects had clinical signs or reported symptoms of illness. Suzhou is famous for the Biluochun green tea, which is a typical non-fermented tea. People living in Suzhou are fond of drinking Biluochun green tea. So, the subjects were divided into two groups: the Tea Group (regular green tea consumption) and the No Tea Group (little or no tea consumption). The No Tea Group were considered as the controls for this study.
Blood sampling and analysis
Blood samples were collected in tubes. Red blood cell (RBC) count, hematocrit (HTC), hemoglobin concentration (Hb), white blood cell (WBC) and platelet(PLT) count were counted by a automated Coulter Counter (Beckman Coulter, Inc.). Plasma alanine transaminase (ALT), aspartate transaminase (AST), BUN and creatinine were measured according to the kit instructions. Then, the samples were centrifuged at 3000×g for 10 min and the plasma was stored at − 20°C.
Determination of oxidative stress
plasma total antioxidant capacity (TAC), total superoxide dismutase (T-SOD), catalase (CAT) enzymes, and malondialdehyde (MDA) levels were measured using kits purchased from Nanjing Jiancheng Bioengineering Institute (Jiangsu Province, China). The measurement of 8-hydroxydeoxyguanosine (8OHdG) was performed using a commercial ELISA kit with a lower detection limit of 0.25 ng/ml (BT Lab, Shanghai, China) according to the manufacturer’s instructions.
Determination of Inflammatory markers
The levels of plasma C-reactive protein (CRP), interleukin-6(IL-6), and tumor necrosis factor-α (TNF-α) were measured by commercially available analyzing kit (R&D Systems) and according to the manufacturer’s instructions.
Determination of DNA repair gene expression by RT-PCR
The total RNA was extracted from whole blood by using TRI Reagent BD (Sigma-Aldrich, USA) according to the manufacturer’s protocol, and purity was checked by the absorbance ratio of 260/280 nm. cDNA synthesis was done by using a Verso cDNA Synthesis Kit (Thermo Fisher Scientific, USA). Gene expression was estimated by real-time polymerase chain reaction (RT-PCR) in a BioRad CFX96 Real Time System using DyNAmo Color Flash SYBR Green qPCR Kit (Thermo Fisher Scientific, USA). The relative gene expression method was used to analyze the data, and fold change was determined after normalizing the data against the reference gene, β-actin. The sequences of the forward (F) and reverse (R) primers are presented in Table 1.
|
Gene name |
Forward sequence |
Reverse sequence |
|---|---|---|
|
OGG1 |
TCAGGAAAGCCGGAGAATTG |
CCCACACGGTGCTGTTTA |
|
XRCC1 |
CTGGGACCGGGTCAAAAT |
CAAGCCAAAGGGGGAGTC |
|
β-actin |
CCTGGCACCCAGCACAAT |
GCCGATCCACACGGAGTACT |
Statistical Analysis
Statistical analysis was performed using SPSS 13.0 software for windows (SPSS Inc., Chicago, IL, USA). Data are presented as means ± SD, and the means were compared using the t-test (two-sided). P values < 0.05 were considered statistically significant.
Characteristics of Subjects
The characteristics of the participants enrolled in this study are presented in Table 2. None of the individual doses monitored by dosimeter in the current study was found to exceed the occupational dose limit recommended by the International Commission on Radiological Protection (ICRP) 9).
Table 2. Characteristics of the Radiation-Exposed Staff
Hematological tests
There are no significant differences between two group regarding to the RBC, HTC, Hb, PLT and WBC counting in peripheral blood(data not shown). There are no significant differences between two group regarding to the ALT, AST, BUN and creatinine in Plasma(data not shown).
Oxidative Stress
The Tea Group subjects showed significantly increased plasma levels of TAC and T-SOD compared with the No Tea Group (P <0.01, Table 3). Conversely, the Tea Group demonstrated significantly decreased plasma levels of MDA and 8-OHdG compared with the No Tea Group (P <0.05, Table 3). There was no statistically significant difference in levels of CAT between the two groups.
Table 3. Plasma oxidative stress/damage indices of the radiation-exposed staff
Inflammatory markers
The tea Group subjects showed significantly lower plasma levels of CRP and TNF-α compared with the No Tea Group (P <0.05, Table 4). There was no statistically significant difference in levels of IL-6 between the two groups
Table 4. Plasma Inflammatory markers of the radiation-exposed staff
Expression of DNA Repair Genes
The expressions of two DNA repair genes (OGG1 and XRCC1) were not significantly different between two groups (Fig. 1).
Fig. 1. Effects of IR on the expression of DNA repair genes.
It is well known that oxidative stress is one of most important mechanisms of ionization-induced cell and tissue damage[10]. In the current cross-sectional study, we found that tea consumption was associated with decreased oxidative stress (MDA and 8-OHdG) and systemic inflammation (CRP and TNF-α). Meanwhile, tea consumption increased antioxidant levels (TAC and T-SOD) in hospital staff exposed to low levels of IR.
Protective effects of green tea on ultraviolet radiation have been extensively investigated[11]. Most studies indicated that regular green tea supplementation was associated with protection against ultraviolet radiation-induced damage[11]. Green tea has been successfully introduced into cosmetology as an anti-aging active ingredient[12]. Moreover, green tea has emerged as a natural and powerful product that exhibits significant antioxidant, chemo-preventative, and anti-inflammatory activity, as well as affecting cell proliferation pathways[13]. However, there is much less information about the efficacy of tea consumption on IR induced damages.
Oxidative stress is an imbalance between oxidant production and antioxidant defenses. ROS are generated by irradiation. The results of the current study showed that green tea consumption significantly decreased MDA and 8-OHdG concentration in low dose IR exposed staff. Additionally, green tea increased the TAC and T-SOD levels of plasma. These results indicated that as an antioxidant, green tea can reduce the oxidative damage induced by IR under the conditions of this study. Several possible mechanisms have been suggested for the antioxidative action of green tea. It is possible that green tea prevents iron-induced lipid peroxidation by chelating iron. Green tea may neutralize ferric iron to form redox-inactive iron, thereby protecting cells against oxidative damage[14]. In addition, lipid peroxidation is a chain reaction, and the scavenging property of green tea may decrease the concentration of hydroxyl radicals and lipid free radicals, thereby terminating the initiation and chain-reaction extension of lipid peroxidation[15].
8-Hydroxy-2-deoxyguanosine (8-OHdG) is one of the major ROS-induced oxidative lesions in DNA, and it is a widely used marker for oxidative DNA damage[16]. The effect of occupational exposure to acute and chronic IR on the levels of DNA damage has been previously reported[17]. Once DNA damage is triggered by free radicals, DNA damage repair can be activated. Oxoguanine-DNA glycosylase (OGG1), as a DNA glycosylase, plays an important role in the base excision repair pathway of DNA. X-ray repair cross-complementing group 1(XRCC1) is involved in excision repair or DNA double strand break repair. Both OGG1 and XRCC1 may have important roles in mitigating DNA damage. Lymphocytes in circulation are particularly sensitive to radiation. Therefore, DNA repair genes were assessed in the peripheral blood samples of the subjects occupationally exposed to IR. In contrast to another study[18], we did not find any differences in the expression of DNA repair gene between the two groups. Our data indicated that tea consumption did not up-regulate the expression of OGG1 and XRCC1 in IR exposed staff. We speculated that the prior tea consumption ameliorated or prevented DNA oxidative damage, both of which would result in decreased DNA repair. In support of this idea, a study showed that intervention with tea was associated with down-regulated levels of OGG1[19]. The underlying mechanisms remain to be elucidated.
IR also induces systemic inflammatory in the organism, which is contributed to IR-induced cardiovascular disease [20]. Significantly lower plasma levels of CRP and TNF-α were found in tea group subjects suggesting that tea consumption might benefit to IR-induced cardiovascular disease.
In conclusion, green tea consumption might be a novel method for decreasing levels of oxidative stress and inflammation in workers exposed to low levels of IR. Tea is one of the most popular beverages worldwide, especially in China. Our findings might be of importance for low dose IR exposed workers.
Ethical approval
The research was approved by the ethical committee of Soochow University
Informed consent
All the staff agreed to be enrolled in the study.
Conflict of interest
The authors declare that they have no conflict of interest.
Acknowledgment
The authors are grateful to all individuals who participated in the study.
Author Contribution: Z. Z. conceived the project. P. W., Y. H., X. G. and J. C. carried out experiments, performed analyses, and wrote the original draft manuscript. All authors read and approved the final version.
Funding
This research was a project funded by Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD).
- Linet MS, Slovis TL, Miller DL, et al. Cancer risks associated with external radiation from diagnostic imaging procedures. CA Cancer J Clin.2012;62(2):75-100.
- J. Du, C.H. Wang, J. Yang, X. He, X.L. Han, C.C. Li, et al., Chemical constituents from the fruits of Psoralea corylifolia and their protective effects on ionising radiation injury, Nat. Prod. Res. 33 (2019) 673-680.
- N. Mulinacci, A. Valletta, V. Pasqualetti, M. Innocenti, C. Giuliani, M. Bellumori, et al., Effects of ionizing radiation on bio-active plant extracts useful for preventing oxidative damages, Nat. Prod. Res. 33 (2019) 1106–1114.
- F.R. Tang, K. Loganovsky, Low dose or low dose rate ionizing radiation-induced health effect in the human, J. Environ. Radioact. 192 (2018) 32–47.
- Gao J, Dong X, Liu T, Zhang L, Ao L. Antioxidant status and cytogenetic damage in hospital workers occupationally exposed to low dose ionizing radiation. Mutat Res Genet Toxicol Environ Mutagen. 2020 Feb-Mar;850-851:503152.
- Machi A Jr, Moreira Perez M, Luciano da Veiga G, Cristiano Pereira E, Adami F, Alves B, Fonseca F. Expression of DNA repair genes in association with ionizing radiation. Acta Biomed. 2022 Jul 1;93(3):e2022232.
- Kapoor MP, Sugita M, Fukuzawa Y, Timm D, Ozeki M, Okubo T. Green Tea Catechin Association with Ultraviolet Radiation-Induced Erythema: A Systematic Review and Meta-Analysis. Molecules. 2021 Jun 17;26(12):3702.
- Oh JW, Muthu M, Pushparaj SSC, Gopal J. Anticancer Therapeutic Effects of Green Tea Catechins (GTCs) When Integrated with Antioxidant Natural Components. Molecules. 2023 Feb 24;28(5):2151.
- D.J. Rohner, et al., Cumulative total effective whole-body radiation dose in critically ill patients, Chest 144 (2013) 1481–1486
- Obrador E, Montoro A. Ionizing Radiation, Antioxidant Response and Oxidative Damage: Radiomodulators. Antioxidants (Basel). 2023 Jun 5;12(6):1219.
- Kapoor MP, Sugita M, Fukuzawa Y, Timm D, Ozeki M, Okubo T. Green Tea Catechin Association with Ultraviolet Radiation-Induced Erythema: A Systematic Review and Meta-Analysis. Molecules. 2021 Jun 17;26(12):3702.
- Koch W, Zagórska J, Marzec Z, Kukula-Koch W. Applications of Tea (Camellia sinensis) and its Active Constituents in Cosmetics. Molecules. 2019 Nov 24;24(23):4277.
- Sheng Y, Sun Y, Tang Y, Yu Y, Wang J, Zheng F, Li Y, Sun Y. Catechins: Protective mechanism of antioxidant stress in atherosclerosis. Front Pharmacol. 2023 Mar 24;14:1144878.
- Lambert JD, Elias RJ. The antioxidant and pro-oxidant activities of green tea polyphenols: a role in cancer prevention. Arch Biochem Biophys. 2010 Sep 1;501(1):65-72.
- Nanjo F, Goto K, Seto R, Suzuki M, Sakai M, Hara Y. Scavenging effects of tea catechins and their derivatives on 1,1-diphenyl-2-picrylhydrazyl radical. Free Radic Biol Med. 1996;21(6):895-902. doi: 10.1016/0891-5849(96)00237-7
- De Zwart LL, Meerman JH, Commandeur JN, Vermeulen NP. Biomarkers of free radical damage applications in experimental animals and in humans. Free Radic Biol Med. 1999 Jan;26(1-2):202-26.
- Aşcı Çelik D, Toğay VA. In vivo protective efficacy of astaxanthin against ionizing radiation-induced DNA damage. Chem Biol Drug Des. 2023 Aug 6. doi: 10.1111/cbdd.14321.
- Ru Q, Xiong Q, Tian X, Chen L, Zhou M, Li Y, Li C. Tea Polyphenols Attenuate Methamphetamine-Induced Neuronal Damage in PC12 Cells by Alleviating Oxidative Stress and Promoting DNA Repair. Front Physiol. 2019 Dec 5;10:1450.
- Panjali Z, Jafari-Tehrani B, Münzel T, Hahad O, Tansaz M, Hamidi M, Hajipour-Verdom B, Zendehdel R. Effect of tea consumption on oxidative stress and expression of DNA repair genes among metal press workers exposed to occupational noise. Toxicol Res (Camb). 2021 Jan 22;10(1):134-140.
- Nagane M, Yasui H, Kuppusamy P, Yamashita T, Inanami O. DNA damage response in vascular endothelial senescence: Implication for radiation-induced cardiovascular diseases. J Radiat Res. 2021 Jul 10;62(4):564-573. doi: 10.1093/jrr/rrab032.
No competing interests reported.