Astragalus Polysaccharides Augment BMSCs Homing via SDF-1/CXCR4 Modulation: A Novel Approach to Counteract Peritoneal Mesenchymal Transformation and Fibrosis

doi:10.21203/rs.3.rs-3766714/v1

Download PDF

Research Article

Astragalus Polysaccharides Augment BMSCs Homing via SDF-1/CXCR4 Modulation: A Novel Approach to Counteract Peritoneal Mesenchymal Transformation and Fibrosis

https://doi.org/10.21203/rs.3.rs-3766714/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Purpose

This study aims to investigate whether pretreatment with bone marrow mesenchymal stromal cells (BMSCs) and Astragalus polysaccharide (APS) can enhance their capacity to engraft in the peritoneum after in vitro transplantation, thereby strengthening the anti-fibrotic effect of BMSCs and elucidating the possible mechanisms involved.

Methods

Forty male SD rats were randomly divided into the control, PDF, PDF + BMSCs and PDF + ^APSBMSCs group, to establish rat peritoneal fibrosis models. The homing and anti-fibrotic effects of fluorescently labeled BMSCs and APS-BMSCs were studied. Stromal cell-derived factor-1 (SDF-1) levels were evaluated using ELISA, and the expression of CXCR4 (chemokine receptor type 4) in BMSCs following APS intervention was assessed using PCR and immunofluorescence staining. The effects of APS on BMSC migration and its role in the SDF-1/CXCR4 axis were investigated through Transwell migration assays and the CXCR4 antagonist AMD3100.

Results

In vivo and in vitro experiments confirmed that APS can promote the targeted homing of BMSCs to the peritoneum of PDF-induced rats, enhance the therapeutic effect, and increase the expression of CXCR4 in BMSCs. PDF-induced peritoneal and serum SDF-1 levels were significantly increased, promoting the homing of CXCR4-expressing BMSCs. Blocking the SDF-1/CXCR4 axis with AMD3100 reduced the migration of BMSCs, further weakening the therapeutic effect on peritoneal mesenchyme-to-mesothelial transition (MMT). APS upregulated the expression of CXCR4 in BMSCs, enhanced the activation of downstream pathways in the SDF-1/CXCR4 axis, and partially reversed the effects of AMD3100.

Conclusion

APS enhances the activation of downstream pathways in the SDF-1/CXCR4 axis by upregulating the expression of CXCR4 in BMSCs, promoting the targeted homing of BMSCs in peritoneal tissue, and enhancing its inhibitory effect on MMT and improvement of peritoneal fibrosis.

astragalus polysaccharide

bone marrow mesenchymal stromal cells

peritoneal fibrosis

SDF-1/CXCR4 axis

homing ability

anti-fibrotic effect

Peritoneal dialysis (PD) is an important renal replacement therapy for end-stage renal disease, offering several advantages including preservation of residual kidney function, simple operation, low cost, high societal return, and comparable survival outcomes to hemodialysis¹. However, the long-term implementation of PD is limited by the gradual deterioration of peritoneal structure and function. Peritoneal mesothelial cells (PMCs), as the first barrier to contact with peritoneal dialysis fluid (PDF), are the first to be damaged, secreting inflammatory cytokines and undergoing mesothelial-mesenchymal transition (MMT), eventually causing progressive peritoneal fibrosis (PF)^{2, 3}. Therefore, the development of new strategies to regulate PMC-MMT and counteract peritoneal fibrosis is crucial for maintaining long-term peritoneal dialysis.

Mesenchymal stem cells (MSCs), especially bone marrow-derived mesenchymal stem cells (BMSCs), have emerged as promising therapeutic agents for various fibrotic diseases due to their multidifferentiation potential, high proliferation capacity, low immunogenicity, tissue repair abilities, and chemotactic homing abilities^{4, 5}. BMSCs have been shown to migrate to damaged sites and promote the structural and functional recovery of tissues and organs through paracrine mechanisms in diseases like post-infarction fibrosis, cirrhosis, and renal fibrosis^{6, 7}. However, the efficacy of BMSCs therapy is limited by their engraftment efficiency, and studies suggest that pretreatment strategies of MSCs can enhance their therapeutic effectiveness⁸.

The SDF-1/CXCR4 axis plays a crucial role in the homing process of stem cells and has garnered significant interest in the treatment of fibrotic diseases^{9, 10, 11}. SDF-1 binding to CXCR4 activates multiple intracellular signaling pathways, such as MAPK and PI3K/Akt, leading to changes in cell motility and migration^{12, 13, 14}. The activation of this axis is essential for the specific homing of BMSCs and their anti-fibrotic action.

Recent studies on medicinal plants have shown that phytochemical derivatives can enhance the expression of the SDF-1/CXCR4 axis¹⁵. Astragalus polysaccharide (APS), a major component of the traditional Chinese medicine Huangqi, has been proven to inhibit the inflammation and fibrosis by inhibiting NF-κB and TGF-β1/SMADs pathway activation^{16, 17, 18}. Furthermore, series of studies have found that APS and Astragaloside IV acting on MSCs can promote cell proliferation, reverse the impaired function and increase the cell homing to ischemic myocardial sites, suggesting that the intervention of APS can increase the number of cells and the survival rate of bone marrow mesenchymal stem cells in the process of their homing, and improve the tissue repair of damaged tissues^{19, 20, 21}.

This study aims to investigate whether pretreatment of BMSCs with APS can enhance their homing capacity to the peritoneum and enhance the anti-fibrotic effects of BMSCs, while elucidating its possible mechanism. Through in vitro and in vivo experiments, the impact of APS on BMSCs migration and homing will be thoroughly analyzed, with particular focus on how APS achieves these effects through regulating the SDF-1/CXCR4 axis. The findings of this study are of significant scientific and clinical significance for understanding the mechanism of action of APS in stem cell therapy and improving the application of BMSCs in the treatment of peritoneal fibrosis.

Isolation, Culture, and Characterization of BMSCs

We purchased male Sprague-Dawley (SD) rats, aged 4–5 weeks old, weighing 100–120 grams, from Beijing Vita River Experimental Animal Technology Co., Ltd. BMSCs were obtained from the femurs of rats by flushing the femurs and tibias with DMEM/F12 medium (Gibco, CA, USA). The obtained cells were cultured under conditions of 5% CO2 at 37°C. After 48 hours, non-adherent cells were discarded. The culture medium was changed every 2–3 days, and when the cell confluence reached approximately 80%, the cells were reseeded after trypsin treatment. The third generation of BMSCs was identified using antibodies against CD29 (Thermo-Fisher Scientific, Bremen, Germany), CD90, CD45, and CD11b (Biolegend, CA, USA) through flow cytometry. Oricell commercial kits (Guangzhou, China) were used to induce the differentiation of BMSCs into adipocytes and osteocytes to confirm their stem cell characteristics. BMSCs from the 2nd to 5th passages were used for the experiments.

Isolation, Culture, and Characterization of PMCs

Under aseptic conditions, peritoneal tissue was excised from SD rat retina and mechanically minced. Digestion was performed using 0.25% trypsin (Gibco) at 37°C for 25 minutes, and the process was terminated by adding DMEM/F12 medium (Gibco) containing 10% fetal bovine serum (FBS). The cell suspension was then filtered through a 70 µm cell strainer, and the filtrate was collected by centrifugation at 1000 rpm for 5 minutes. The cell pellet was resuspended in DMEM/F12 medium (Gibco) containing 10% FBS, 100 IU/ml penicillin, and 100 mg/ml streptomycin, reaching a final volume of 4 ml, and seeded onto a 25 cm² tissue culture flask (NEST Biotechnology Co., Ltd., Wuxi, China). The medium was changed after 24 hours of incubation at 37°C, and cell fusion was observed within 5–7 days. Immunocytochemical staining using antibodies targeting Vimentin (1:1000, CST, MA, USA) and pan-Cytokeratin (1:1000–4000, Proteintech, Wuhan, China) was performed to identify the first-generation PMCs.

Transmembrane migration experiment: assessing the response of BMSCs to APS and SDF-1

In the transmembrane chamber provided by Labselect (Beijing, China), an in vitro cell migration model was established using a membrane filter with a pore diameter of 8 micrometers. Prior to the experiment, BMSCs were pretreated with or without APS (1 mg/mL) for 24 hours. BMSCs were seeded in the upper chamber of a 24-well plate provided by NEST Biotechnology Co., Ltd. (China) at a density of 2 × 10⁵ in serum-free culture medium. SDF-1 at concentrations of 0, 25, 50, 100, or 150 ng/mL was added to the lower chamber. For inhibitor treatments, BMSCs were pre-incubated with AMD3100 (Plerixafor, a specific inhibitor of CXCR4) (MCExpress, New Jersey, USA) for 1 hour. The BMSCs on the lower side of the filter were stained with crystal violet solution, and 5 random fields (200× magnification) were selected for counting using a microscope (Olympus, Tokyo, Japan).

In a 6-well plate provided by NEST Biotechnology Co., Ltd., the PMCs were cultured in the lower chamber with or without 3% PDF (Deerfield, IL, USA), while BMSCs were seeded in the upper chamber at a density of 2 × 10⁵. After allowing BMSCs to migrate for 24 hours, the transwell was washed, and a cotton swab was used to remove non-migrated BMSCs from the upper side of the membrane. The migrated BMSCs were imaged and randomly selected for observation under a microscope in five fields of view at 40× magnification.

Animals

40 male SD rats were randomly divided into four groups: control, PDF, PDF + BMSCs, and PDF + ^APSBMSCs, with 10 rats in each group. To establish the PF model, rats in the PDF group received intraperitoneal injections of 10 ml/100g/day PDF solution for a duration of 4 weeks. Rats in the control group received an equivalent volume of physiological saline. Subsequently, in the rats of the PDF + BMSCs and PDF + ^APSBMSCs groups, a weekly tail vein injection of 0.3 ml cell suspension containing 3×10⁶ BMSCs or ^APSBMSCs was administered, while rats in the control and PDF groups received 0.3 ml of phosphate-buffered saline (PBS). Twenty-four hours after the final cell transplantation, all rats were euthanized under sodium pentobarbital anesthesia at specified time points, and samples were collected for subsequent experiments. The animal study was approved by the Animal Ethics Committee of Nanjing University of Chinese Medicine (ACU230205) and conducted in accordance with the Guide for the Care and Use of Laboratory Animals (1985, National Institutes of Health, USA).

Tracking study of DiL-labeled BMSCs after transplantation

12 SD rats were randomly divided into three groups: the control group, the PDF + BMSCs group, and the PDF + APSBMSCs group, each consisting of 4 rats. A peritoneal fibrosis (PF) model was established by intraperitoneal injection of 10 mL/100g/day of PDF solution for a duration of 4 weeks. BMSCs and APSBMSCs were labeled using DiL dye provided by Beyotime Biotechnology. These labeled cells were then injected into the rats via the tail vein. To verify the migration of BMSCs to the peritoneal tissue, the peritoneal tissue was prepared as frozen sections 24 hours after transplantation. These sections were first fixed, then washed, and incubated with DAPI provided by Beyotime Biotechnology. Finally, all sections were imaged using a fluorescence microscope from Nikon Corporation (Tokyo, Japan).

Histology and immunohistochemical (IHC) analysis of peritoneal samples

To evaluate the pathological condition and thickness of the peritoneum, we performed histological and immunohistochemical analysis on samples taken from the lateral peritoneal wall. Initially, the samples were fixed in 4% formaldehyde for 24 hours, followed by dehydration and embedding in paraffin. Subsequently, the samples were sectioned into 5-micrometer slices. The pathological condition and thickness of the peritoneum were quantified using hematoxylin-eosin (HE) staining and Masson's trichrome staining for histological examination. For immunohistochemical (IHC) analysis, the sections were stained with primary antibodies against collagen protein (1:1200, Abcam, Cambridge, UK) and fibronectin (1:800, CST, Massachusetts, USA), followed by appropriate secondary antibody incubation.

Immunocytochemical staining analysis of PMCs and BMSCs

We used immunocytochemical staining methods to identify PMCs and further confirmed the expression of CXCR4 in BMSCs through immunofluorescence staining. Cells were fixed, washed, and permeabilized for 30 minutes in Triton X-100 (Beyotime Biotechnology). After washing, cells were blocked for 1 hour with 5% bovine serum albumin (BSA) (BioFroxx, Einhausen, Germany), then incubated overnight at 4°C with primary antibodies. After another wash, cells were incubated for 2 hours with appropriate secondary antibodies. Subsequently, nuclear staining was performed using DAPI, and cells were observed using fluorescence inverted microscopy. The antibodies used were as follows: vimentin (1:1000, CST), cytokeratin (1:1000–4000, Proteintech, Wuhan, China), CXCR4 (1:1000–4000, Proteintech), Alexa Fluor 594 goat anti-rabbit IgG (1:100, Proteintech), and Alexa Fluor 488 goat anti-mouse IgG (1:100, Proteintech).

Enzyme-linked immunosorbent assay (ELISA) method is used to detect SDF-1 levels

To determine the levels of SDF-1 in the peritoneal and serum samples of rats, we collected peritoneal and serum samples from rats in the control group and the PDF group. Peritoneal tissues were first homogenized, and the supernatant was collected. The concentration of SDF-1 in the collected cell culture supernatant was measured using a commercially available ELISA assay kit (provided by AiFang Biotechnology, Wuhan, China), following the manufacturer's protocol. The specific steps included sample and standard preparation, incubation of the ELISA plate, washing, substrate addition, termination of the reaction, and measurement of absorbance.

Analysis of protein expression changes in co-cultured PMCs and BMSCs using Western Blot method

To analyze changes in protein expression after co-culturing with BMSCs, PMCs were first seeded in a 6-well plate at a density of 2×10⁵ cells per well. After overnight attachment, the cells were treated with 3% PDF for 24 hours, followed by co-culturing with BMSCs or pre-treated BMSCs with AMD3100 (25 µg/mL, pre-incubated for 1 hour). After 24 hours of co-culture, the cells in the lower compartment were lysed using ice-cold RIPA lysis buffer (Thermo, Massachusetts, USA) containing 2% protease and phosphatase inhibitors (Beyotime Biotechnology). The cell lysates were sonicated, centrifuged, and the supernatants were collected. Protein concentration was determined using the protein quantification reagent kit from Beyotime Biotechnology. The extracted protein lysates (20 µg per lane) were separated on SDS-PAGE and transferred onto PVDF membranes. After blocking the membranes with PBS containing 5% BSA, they were incubated overnight at 4°C with primary antibodies, followed by incubation with secondary antibodies (mouse/rabbit IgG conjugated with horseradish peroxidase) for 1 hour. Finally, the bands were visualized using the immobilon ECL Super Western HRP substrate from Biosharp (Anhui, China) and imaged with a chemidoc imaging system. The antibodies used include E-cadherin (1:1000–4000, Proteintech), polyclonal antibodies against smooth muscle α-SMA (1:1000–8000, Proteintech), Vimentin, β-actin (1:1000, Santa, USA), and secondary antibodies (mouse/rabbit IgG conjugated with horseradish peroxidase) (1:20000, Zhongshanjinqiao, Beijing, China).

Analysis of gene expression in peritoneum and PMCs using real-time quantitative PCR technique

In order to analyze gene expression in peritoneum and PMCs, total RNA was extracted from these samples using TRIzol reagent (provided by Vazyme Biotech Co., Ltd., Nanjing, China). Subsequently, cDNA synthesis was performed using the All-In-Two RT SuperMix for qPCR Kit from the same company. Real-time quantitative PCR analysis was carried out using the ABI PRISM 7500 PCR instrument (Applied Biosystems, New York, USA) to detect the SYBR Green signal. The gene sequences examined are listed in Table 1.

Table 1

List of Primers Used for qRT-PCR in This Study
Gene	Forward sequence ( 5'-3’)	Reverse sequence ( 5 − 3’)
β-actin	TCACCCACACTGTGCCCATCTATGA	CATCGGAACCGCTCATTGCCGATAG
vimentin	AATGCTTCTCTGGCACGTCT	GTGAGGTCAGGCTTGGAAAC
α-SMA	ATCCGATAGAACACGGCATC	CATACATGGCAGGGACATTG
E-cadherin	CCTACAATGCTGCCATCGCCTAC	GGGTAACTCTCTCGGTCCAGTCC
CXCR4	CATACATGGCAGGGACATTG	CCTACAATGCTGCCATCGCCTAC
SDF-1	GGGTAACTCTCTCGGTCCAGTCC	TCACCCACACTGTGCCCATCTATGA

Statistical analysis

In this study, we utilized GraphPad Prism software (GraphPad Software Inc., California, USA), version 9.5, and SPSS software (IBM Corp., Armonk, USA), version 26.0, for data analysis and graphical representation. All data were calculated as mean ± standard deviation. Differences in the measured data were analyzed using t-tests or one-way analysis of variance (ANOVA). Multiple comparisons between groups were performed using the LSD-t test. Statistical significance was considered when the p-value was less than 0.05 (P < 0.05).

Identification and differentiation potential of BMSCs: in vitro culture and surface marker analysis

Research on BMSCs is increasingly important in the field of cell therapy and tissue engineering. This study aimed to investigate the morphological features, proliferative capacity, and differentiation potential of BMSCs through in vitro cultivation and analysis of surface markers. In the experimental process, BMSCs exhibited a typical spindle shape after 48 hours of cultivation, tightly adhered and formed individual colonies. Approximately 7 to 9 days later, BMSCs reached 80–90% confluence and aligned in a helical arrangement (Fig. 1A-B), consistent with the standards set by the International Society for Cellular Therapy (ISCT)²². Passaged cells maintained a fibroblast-like morphology. Flow cytometric analysis showed that the expression rates of surface markers CD90 and CD29 in the third passage of BMSCs were 94.63%±6.23% and 98.82%±1.16%, respectively, while the expression rates of CD45 and CD11b were 5.34%±0.64% and 0.2%±0.07%, indicating the characteristic features of BMSCs (Fig. 1E). Furthermore, in vitro induction demonstrated the potential of BMSCs to differentiate into adipocytes and osteocytes, which were validated by Oil Red O and Alizarin Red S staining, respectively (Fig. 1C-D). The results of this study demonstrate that BMSCs cultivated under specific conditions not only exhibit morphological characteristics that meet the ISCT standards but also possess the potential to differentiate into adipocytes and osteocytes.

APS enhances the ability of BMSCs to improve peritoneal fibrosis in a rat model

After confirming the morphological features and differentiation potential of BMSCs, this study further investigates the therapeutic effects of ^APSBMSCs in a rat model of peritoneal fibrosis. When severe damage occurs to the peritoneum, there is an increase in proliferation and repair of the interstitial fibrous connective tissue, resulting in fibrotic lesions. Therefore, the degree of peritoneal fibrosis can directly reflect the extent of peritoneal injury and the effectiveness of stem cell therapy. Experimental results demonstrated that intervention with 1 mg/mL APS exhibited the strongest cell vitality in BMSCs (Figure S1), hence this concentration was selected for further investigation. Compared to the control group, significant differences were observed in the peritoneum damaged by PDF (Peritoneal Dialysis Fluid) in HE (Hematoxylin and Eosin) and Masson's Trichrome staining (Fig. 2A). Peritoneal damage caused by PDF leads to severe adhesions compared to normal peritoneum, with the muscular layer being replaced by collagen proteins. Intraperitoneal injection of BMSCs and ^APSBMSCs reduces peritoneal thickening caused by PDF. Immunohistochemical staining results demonstrate a significant increase in the expression of collagen proteins and fibronectin in the peritoneum of PDF-induced rats. However, after treatment with BMSCs and ^APSBMSCs, these expression levels significantly decrease, with ^APSBMSCs demonstrating superior reparative effects compared to BMSCs (Fig. 2B).

In addition, α-SMA and vimentin mRNA and protein expression levels were found to be significantly increased in the PDF group, as detected by Western blot and qRT-PCR analysis. The enhanced effects were significantly reduced by treatment with BMSCs and ^APSBMSCs. Furthermore, the downregulation of E-cadherin induced by PDF was also significantly inhibited by transplantation of BMSCs and ^APSBMSCs (Fig. 2C-E). These results suggest that ^APSBMSCs demonstrate a more significant therapeutic effect in improving peritoneal fibrosis in rats compared to BMSCs alone.

APS pre-processing enhanced the homing activity of BMSCs in rats

After confirming the advantages of ^APSBMSCs in improving peritoneal fibrosis, this study further investigates the impact of APS preconditioning on the homing ability of BMSCs. The effective homing of BMSCs is a key factor in their therapeutic efficacy, especially in the treatment of peritoneal fibrosis. To track and locate the transplanted BMSCs in vivo, DiL labeling was employed.

Before transplantation, BMSCs were pre-labeled with DiL to track and locate the transplanted BMSCs in vivo. DiL-labeled BMSCs and ^APSBMSCs exhibited red fluorescence. After 24 hours of transplantation, the homing and positioning of DiL-labeled BMSCs in the rat peritoneum were traced. As a negative control, BMSCs were also injected into the control group. In the peritoneum of rats in the PDF + BMSCs and PDF + ^APSBMSCs groups, recruited and localized DiL-labeled BMSCs with red fluorescence were observed. The number of DiL-labeled BMSCs found in the control group was relatively small. The quantity of BMSCs in the peritoneal tissues of rats in the ^APSBMSCs group was higher than that in the PDF + BMSCs group (Fig. 3A). We therefore hypothesize that the augmented antifibrotic effect of BMSCs, following APS pretreatment, may be attributed to the enhanced homing of BMSCs to peritoneal tissues, which in turn increases their interaction with PMCs.

APS enhances the ability of BMSCs to reverse MMT induced by PDF

This study further investigates how APS enhances the mechanism of BMSCs in improving peritoneal fibrosis. To evaluate the effect of BMSCs on the reversal of MMT induced by PDF, we extracted PMCs from the rat peritoneal tissue.

In vitro experiments demonstrated that PMCs exhibited a cobblestone-like growth pattern under optical microscopy. Immunofluorescence analysis confirmed positive staining for vimentin and pan-cadherin, which are characteristic markers of PMCs. Initially, PMCs were treated with 3% PDF for 24 hours to induce MMT, followed by co-culturing with BMSCs in a transwell system for another 24 hours. After 24 hours of PDF treatment, PMCs exhibited elongated morphology, reduced cobblestone-like cell arrangement, and fibroblast-like alterations (Fig. 3B-C). Western blot analysis was employed to evaluate the protein expression levels of E-cadherin, α-smooth muscle actin (α-SMA), and vimentin in PMCs. Compared to the control group, the PDF group showed significant upregulation of α-SMA and vimentin expression, whereas the PDF + ^APSBMSCs and PDF + BMSCs groups demonstrated decreased expression levels. Additionally, ^APSBMSCs exhibited better efficacy in reducing α-SMA/vimentin expression compared to other treatments. Following PDF intervention, E-cadherin expression significantly decreased (Fig. 3D-E), while in the PDF + ^APSBMSCs and PDF + BMSCs groups, E-cadherin expression slightly increased but did not significantly differ from the control group. Quantitative real-time polymerase chain reaction analysis supported the protein data, revealing decreased expression of α-SMA and vimentin, and increased expression of E-cadherin in the PDF + ^APSBMSCs and PDF + BMSCs groups, with ^APSBMSCs demonstrating superior recovery effects (Fig. 3F). These results indicate that APS can enhance the ability of BMSCs to reverse PDF-induced MMT, and ^APSBMSCs exhibit enhanced therapeutic effects. Thus, APS pretreated BMSCs may hold promise as a novel therapeutic approach for MMT.

APS pretreatment enhances the migration ability of BMSCs through SDF-1/CXCR4 chemotaxis

The SDF-1/CXCR4 axis is one of the most effective chemotactic factors/receptor pairs involved in cell homing ^{22, 23, 24}. To assess the influence of APS on the migration ability of BMSCs in response to the SDF-1/CXCR4 axis, we conducted this study.

The levels of SDF-1 were determined by ELISA in the serum, peritoneum, intra-abdominal lavage fluid, and supernatant of PMCs in the control and PDF groups to investigate whether peritoneal dialysis induces the secretion of SDF-1. Compared to the control group, the PDF group showed a significant increase in SDF-1 levels (Fig. 4A). Quantitative Real-Time Polymerase Chain Reaction experiments further confirmed a significant upregulation of SDF-1 in PMCs treated with PDF, compared to the control group (Fig. 4F).

To assess the ability of SDF-1 to promote the migration of BMSCs, a transwell migration assay was conducted using 0, 50, 100, or 150 ng/mL of SDF-1. Under treatment with 0-100 ng/mL SDF-1, the chemotactic response of CXCR4-transfected cells displayed a dose-dependent increase. Importantly, the migratory capacity of BMSCs was further enhanced when pre-treated with 1 mg/mL APS, surpassing the migration levels of untreated BMSCs (Fig. 4B-C).

To investigate how APS can enhance the engraftment efficiency of BMSCs, the mRNA expression levels of CXCR4, which plays a crucial role in MSCs chemotaxis, were examined. The results revealed that treatment with APS significantly elevated the mRNA levels of CXCR4. Immunofluorescence analysis confirmed the PCR data, demonstrating the upregulation of CXCR4 in the APS-treated BMSCs group (Fig. 4D-E).

In order to gain a deeper understanding of the role of the SDF-1/CXCR4 axis in the in vitro migration of BMSCs induced by SDF-1, a selective antagonist of CXCR4 called AMD3100 was employed for transwell migration assays. Based on the results of 100 ng/mL SDF-1 induced migration of BMSCs in vitro, we chose a concentration of 25 µg/mL of AMD3100 for subsequent studies (Figure S2). The BMSCs, with or without pre-treatment of AMD3100, either untreated or pre-treated with 1mg/mL APS, were seeded in the upper transwell chamber, while the control group (PMCs) or PMCs treated with PDF were added to the lower chamber. After 24 hours, the number of migrated BMSCs in each group was counted. The results demonstrated that BMSCs were significantly recruited when co-cultured with PMCs treated with PDF, and the migration of APS pre-treated BMSCs exceeded that of untreated BMSCs. However, these results were inhibited when the SDF-1/CXCR4 axis was blocked by AMD3100 (Fig. 5A). In conclusion, APS pre-treatment significantly enhances the migration ability of BMSCs through the SDF-1/CXCR4 chemotaxis axis.

Blocking the SDF-1/CXCR4 axis reduces the therapeutic effect of BMSCs on MMT induced by PDF

In order to further explore the role of the SDF-1/CXCR4 axis in the therapeutic effects of BMSCs, this study evaluated the impact of blocking the SDF-1/CXCR4 axis on the treatment of MMT induced by PDF using BMSCs and ^APSBMSCs. The levels of expression of E-cadherin, α-SMA, and vimentin were determined through Western blot and qRT-PCR analysis (Fig. 5B-C). Compared to the PDF group, the co-cultured group of BMSCs and ^APSBMSCs showed a significant decrease in vimentin and α-SMA expression, and a significant increase in E-cadherin expression. However, compared to the PDF + ^APSBMSCs group or PDF + BMSCs group, the expression levels of vimentin and α-SMA were significantly higher, and the expression level of E-cadherin was significantly lower in the BMSCs + AMD3100 group and ^APSBMSCs+AMD3100 group. PCR results were consistent with the Western blot results (Fig. 5D). These findings revealed that blockade of the SDF-1/CXCR4 axis reduced the reparative effects of BMSCs and ^APSBMSCs. The improved therapeutic effects of APS were associated with the migration mediated by the SDF-1/CXCR4 chemotactic action specific to BMSCs.

The effect of APS on the downstream signaling pathway of SDF-1/CXCR4 in BMSCs

To investigate the mechanism of SDF-1/CXCR4 chemotactic homing signals in BMSCs and the impact of APS, the protein levels of key signaling pathways including ERK1/2, p38, and Akt were examined. The protein levels of ERK1/2, p38, and Akt signaling pathways were measured in BMSCs after exposure to SDF-1 and APS using Western blot analysis. SDF-1 significantly increased the phosphorylation levels of ERK1/2, p38, and Akt, and co-treatment with APS further enhanced their phosphorylation levels (Fig. 6A-B). Pretreatment with AMD3100 significantly reduced the SDF-1-induced phosphorylation levels, while intervention with APS partially reversed this effect (Fig. 6C-D). These results confirm that the binding of SDF-1 to CXCR4 activates the ERK1/2, p38, and Akt signaling pathways. Additionally, in the context of SDF-1 presence, APS is observed to further augment the levels of downstream phosphorylation. This effect appears to counteract the inhibitory influence of AMD3100 on the phosphorylation downstream of the SDF-1/CXCR4 axis, potentially through upregulating CXCR4 expression on BMSCs.

Recent studies have indicated that transplantation of mesenchymal stem cells from bone marrow may be an effective treatment for fibrosis²⁵. MSCs have been shown to prolong the lifespan of peritoneum and protect PMCs from the harmful effects of PDF^{26, 27}. In comparison to previous research, our study further demonstrates the enhanced impact of pre-treatment with APS on the MMT and anti-fibrotic effects of bone marrow-derived MSCs.

Transplanted MSCs release anti-fibrotic cytokines, such as hepatocyte growth factor and tumor necrosis factor alpha-stimulating gene (TSG-6), to inhibit fibrosis pathways like TGF-β1, Wnt/β-catenin, and glucosamine, thus suppressing the development of MMT^{28, 29}. In our study, BMSCs maintained epithelial integrity and suppressed fibrosis by reducing PMC dedifferentiation, consistent with previous findings. However, we further investigated the role of APS in this process. Despite evidence showing that intraperitoneal injection of MSCs promotes repair of the peritoneal mesothelium, no significant MSCs aggregation was observed in damaged peritoneum^{30, 31}. In contrast, our study found that APS-pretreated BMSCs were more significantly located in peritoneal tissue, providing a novel perspective for the application of MSCs in peritoneal fibrosis treatment.

SDF-1 is a key chemokine factor that maintains, mobilizes, and attracts stem cells, and its expression is elevated at the site of injury, attracting MSCs expressing CXCR4 to the damaged area^{32, 33}. Our study found that treatment with PDF significantly increased the levels of SDF-1 in the supernatant of cell cultures of rat peritoneum, abdomen, peripheral blood, and PMCs. Pre-treated BMSCs with APS exhibited increased sensitivity to SDF-1 and showed significant cell migration promotion³⁴. Through PCR and immunofluorescence experiments, we observed that APS pre-treatment enhanced the expression of CXCR4 on the surface of BMSCs^{35, 36}. This is consistent with previous research, indicating that increasing the expression of CXCR4 can activate the migration ability of MSCs^{37, 38, 39}. Our study further demonstrates that APS promotes the activity and migration of BMSCs by upregulating the expression of CXCR4. The activation of the SDF-1/CXCR4 binding activates downstream signaling pathways including MAPK and Akt, participating in cell homing, migration, apoptosis, and gene expression^{40, 41}. In the presence of SDF-1, our study shows that APS can further enhance the increased phosphorylation levels downstream, partially reversing the inhibitory effect of AMD3100 on SDF-1/CXCR4 phosphorylation, which may be achieved by increasing the expression of CXCR4 on the surface of BMSCs.

This study reveals a new therapeutic strategy for peritoneal fibrosis by demonstrating that APS enhance the homing ability of BMSCs through the modulation of the SDF-1/CXCR4 axis. This approach offers potential advantages, including improved biocompatibility and reduced side effects. The application of APS also opens up new opportunities for the development of personalized medicine, making individualized treatment plans based on individual differences possible. This finding not only contributes to increasing the efficacy of peritoneal fibrosis treatment but also paves the way for the exploration and application of natural drugs in regulating stem cell function. In this experiment, we demonstrate that BMSCs alleviate the dedifferentiation of PMCs, thereby maintaining epithelial integrity and suppressing fibrosis. Both in vivo and in vitro experiments confirm that APS pretreatment enhances the inhibitory effect of BMSCs on collagen transformation and anti-fibrotic effects (Fig. 7).

Despite the promotion of BMSCs by APS shown in animal models, its effectiveness and safety in human patients still require further validation. Differences between animal models and humans prevent the direct extrapolation of research results to humans. Additionally, the optimal dosage of APS has not yet been determined, and the long-term effects and safety of its application remain unknown. Therefore, further research is needed to explore the dosage effects, long-term outcomes, and safety of APS to ensure its clinical application. To apply APS in the clinical treatment of peritoneal fibrosis, future studies should focus on conducting more extensive clinical trials to verify its effectiveness and safety in humans. These efforts will help fully harness the potential of APS in treating fibrotic diseases and provide patients with more effective treatment options.

This study reveals that APS pretreatment enhances the homing ability of BMSCs by modulating the SDF-1/CXCR4 axis, presenting a novel approach to treat peritoneal fibrosis. APS enhances BMSCs' anti-fibrotic effects, promoting their migration to and localization in damaged peritoneal tissue, thus maintaining epithelial integrity and reducing fibrosis. The increased expression of CXCR4 on BMSCs, induced by APS, leads to enhanced cell migration and sensitivity to SDF-1. Furthermore, APS counteracted the inhibitory effect of AMD3100 on phosphorylation of the SDF-1/CXCR4 downstream pathway.These findings suggest a new role for natural drugs like APS in regulating stem cell functions and open up possibilities for personalized medicine and treatment of various fibrotic diseases. However, further research is required to confirm these results in humans, establish optimal dosages, and explore APS's long-term effects and safety.

APS, Astragalus polysaccharide;

BMSCs, bone marrow mesenchymal stromal cells;

PDF, peritoneal dialysis fluid;

MMT, mesothelial-mesenchymal transition;

SDF-1, stromal cell-derived factor-1;

CXCR4, chemokine receptor type 4;

PD, Peritoneal dialysis;

PF, Peritoneal fibrosis;

PMCs, Peritoneal mesothelial cells ;

PBS, phosphate-buffered saline;

FBS, Fetal bovine serum;

SD, Sprague-Dawley;

α-SMA, α-Smooth Muscle Actin;

TSG-6, tumor necrosis factor alpha-stimulating gene ;

ELISA, Enzyme-linked immunosorbent assay;

HE, hematoxylin-eosin;

IHC, immunohistochemical

Ethics approval and consent to participate

The animal experiments were approved by the Experimental Animal Ethics Committee of Nanjing University of Chinese Medicine (ACU230205) and carried out in accordance with the Guidelines for the Care and Use of Laboratory Animals (1985, NIH). The study is reported in accordance with ARRIVE guidelines.

Consent for publication

Not applicable.

Availability of data and materials

All data generated or analysed during this study are included in this published article and its supplementary information files.

Competing interests

The authors declare that they have no competing interests.

Funding

This work was supported by the National Natural Science Foundation of China (Grant No. 82074351, 82004295, 82305161); the Peak Academic Talent Project of Jiangsu Provincial Hospital of Traditional Chinese Medicine (No. y2021rc10); the Young Talent Project of Jiangsu Administration of Traditional Chinese Medicine (No. QN202207); the Innovation and Development Fund Special Project of Jiangsu Provincial Hospital of Traditional Chinese Medicine (No. Y2021CX01).

Authors' contributions

Funing Wang and Huibo Dai jointly conceived and designed the study. Funing Wang, Huibo Dai, and Ziren Zhou performed the experiments. Yun Shan, Manshu Yu, Jinyi Sun, Li Sheng, Liyan Huang, Xiaohui Meng, Yongqing You and Meixiao Sheng participated in data analysis. Funing Wang and Huibo Dai wrote the manuscript. All authors participated in the discussion and revision of the manuscript and reviewed and approved the final version. Meixiao Sheng, as the supervising mentor, was responsible for correspondence.

Acknowledgements

Not applicable.

Brown EA, Zhao J, McCullough K, et al. Burden of Kidney Disease, Health-Related Quality of Life, and Employment Among Patients Receiving Peritoneal Dialysis and In-Center Hemodialysis: Findings From the DOPPS Program. Am J Kidney Dis. 2021;78(4):489–500e1. 10.1053/j.ajkd.2021.02.327.
Masola V, Bonomini M, Borrelli S, et al. Fibrosis of Peritoneal Membrane as Target of New Therapies in Peritoneal Dialysis. Int J Mol Sci. 2022;23(9):4831. 10.3390/ijms23094831. Published 2022 Apr 27.
Terri M, Trionfetti F, Montaldo C, et al. Mechanisms of Peritoneal Fibrosis: Focus on Immune Cells-Peritoneal Stroma Interactions. Front Immunol. 2021;12:607204. 10.3389/fimmu.2021.607204. Published 2021 Mar 29.
Adelipour M, Lubman DM, Kim J. Potential applications of mesenchymal stem cells and their derived exosomes in regenerative medicine. Expert Opin Biol Ther. 2023;23(6):491–507. 10.1080/14712598.2023.2211203.
Yuan M, Hu X, Yao L et al. Mesenchymal stem cell homing to improve therapeutic efficacy in liver disease. Stem Cell Res Ther. 2022;13(1):179. Published 2022 May 3. 10.1186/s13287-022-02858-4.
Todorova VB, Baxan N, Delahaye M, et al. Drug-based mobilisation of mesenchymal stem/stromal cells improves cardiac function post myocardial infarction. Dis Model Mech. 2023;16(5):dmm049630. 10.1242/dmm.049630.
Kim SR, Jiang K, Chen X, et al. Selective kidney targeting increases the efficacy of mesenchymal stromal/stem cells for alleviation of murine stenotic-kidney senescence and damage. J Tissue Eng Regen Med. 2022;16(6):550–8. 10.1002/term.3299.
Yu S, Yu S, Liu H et al. Enhancing mesenchymal stem cell survival and homing capability to improve cell engraftment efficacy for liver diseases. Stem Cell Res Ther. 2023;14(1):235. Published 2023 Sep 4. 10.1186/s13287-023-03476-4.
Ullah M, Liu DD, Thakor AS. Mesenchymal Stromal Cell Homing: Mechanisms and Strategies for Improvement. iScience. 2019;15:421–38. 10.1016/j.isci.2019.05.004.
Teicher BA, Fricker SP. CXCL12 (SDF-1)/CXCR4 pathway in cancer. Clin Cancer Res. 2010;16(11):2927–31. 10.1158/1078-0432.CCR-09-2329.
Jiang Q, Huang K, Lu F, et al. Modifying strategies for SDF-1/CXCR4 interaction during mesenchymal stem cell transplantation. Gen Thorac Cardiovasc Surg. 2022;70(1):1–10. 10.1007/s11748-021-01696-0.
Xiong W, Guo X, Cai X. SDF-1/CXCR4 axis promotes osteogenic differentiation of BMSCs through the JAK2/STAT3 pathway. Folia Histochem Cytobiol. 2021;59(3):187–94. 10.5603/FHC.a2021.0020.
Schmuhl E, Ramer R, Salamon A, et al. Increase of mesenchymal stem cell migration by cannabidiol via activation of p42/44 MAPK. Biochem Pharmacol. 2014;87(3):489–501. 10.1016/j.bcp.2013.11.016.
Samakova A, Gazova A, Sabova N, et al. The PI3k/Akt pathway is associated with angiogenesis, oxidative stress and survival of mesenchymal stem cells in pathophysiologic condition in ischemia. Physiol Res. 2019;68(Suppl 2):131–S138. 10.33549/physiolres.934345.
Maeda A. Recruitment of Mesenchymal Stem Cells to Damaged Sites by Plant-Derived Components. Front Cell Dev Biol. 2020;8:437. 10.3389/fcell.2020.00437. Published 2020 Jun 9.
Yu M, Shi J, Sheng M, et al. Astragalus Inhibits Epithelial-to-Mesenchymal Transition of Peritoneal Mesothelial Cells by Down-Regulating β-Catenin. Cell Physiol Biochem. 2018;51(6):2794–813. 10.1159/000495972.
Zheng Y, Ren W, Zhang L, et al. A Review of the Pharmacological Action of Astragalus Polysaccharide. Front Pharmacol. 2020;11:349. 10.3389/fphar.2020.00349.
Wei Y, Qi M, Liu C, et al. Astragalus polysaccharide attenuates bleomycin-induced pulmonary fibrosis by inhibiting TLR4/NF-κB signaling pathway and regulating gut microbiota. Eur J Pharmacol. 2023;944:175594. 10.1016/j.ejphar.2023.175594.
Zhang LY, Yong WX, Wang L, et al. Astragalus Polysaccharide Eases G1 Phase-Correlative Bystander Effects through Mediation of TGF-β R/MAPK/ROS Signal Pathway After Carbon Ion Irradiation in BMSCs. Am J Chin Med. 2019;47(3):595–612. 10.1142/S0192415X19500319.
Xie J, Wang H, Song T, et al. Tanshinone IIA and astragaloside IV promote the migration of mesenchymal stem cells by up-regulation of CXCR4. Protoplasma. 2013;250(2):521–30. 10.1007/s00709-012-0435-1.
Li M, Yu L, She T, et al. Astragaloside IV attenuates Toll-like receptor 4 expression via NF-κB pathway under high glucose condition in mesenchymal stem cells. Eur J Pharmacol. 2012;696(1–3):203–9. 10.1016/j.ejphar.2012.09.033.
Dominici M, Le Blanc K, Mueller I, et al. Minimal criteria for defining multipotent mesenchymal stromal cells. The International Society for Cellular Therapy position statement. Cytotherapy. 2006;8(4):315–7. 10.1080/14653240600855905.
Xiong W, Guo X, Cai X. SDF-1/CXCR4 axis promotes osteogenic differentiation of BMSCs through the JAK2/STAT3 pathway. Folia Histochem Cytobiol. 2021;59(3):187–94. 10.5603/FHC.a2021.0020.
Al-Amoodi AS, Li Y, Al-Ghuneim A, et al. Refining the migration and engraftment of short-term and long-term HSCs by enhancing homing-specific adhesion mechanisms. Blood Adv. 2022;6(15):4373–91. 10.1182/bloodadvances.2022007465.
Huang Y, Yang L. Mesenchymal stem cell-derived extracellular vesicles in therapy against fibrotic diseases. Stem Cell Res Ther. 2021;12(1):435. 10.1186/s13287-021-02524-1. Published 2021 Aug 4.
Fan YP, Hsia CC, Tseng KW, et al. The Therapeutic Potential of Human Umbilical Mesenchymal Stem Cells From Wharton's Jelly in the Treatment of Rat Peritoneal Dialysis-Induced Fibrosis. Stem Cells Transl Med. 2016;5(2):235–47. 10.5966/sctm.2015-0001.
Nagasaki K, Nakashima A, Tamura R, et al. Mesenchymal stem cells cultured in serum-free medium ameliorate experimental peritoneal fibrosis. Stem Cell Res Ther. 2021;12(1):203. 10.1186/s13287-021-02273-1. Published 2021 Mar 23.
Huang Y, Ma J, Fan Y, et al. Mechanisms of human umbilical cord mesenchymal stem cells-derived exosomal lncRNA GAS5 in alleviating EMT of HPMCs via Wnt/β-catenin signaling pathway. Aging. 2023;15(10):4144–58. 10.18632/aging.204719.
Ueno T, Nakashima A, Doi S, et al. Mesenchymal stem cells ameliorate experimental peritoneal fibrosis by suppressing inflammation and inhibiting TGF-β1 signaling. Kidney Int. 2013;84(2):297–307. 10.1038/ki.2013.81.
Bazhanov N, Ylostalo JH, Bartosh TJ, et al. Intraperitoneally infused human mesenchymal stem cells form aggregates with mouse immune cells and attach to peritoneal organs. Stem Cell Res Ther. 2016;7:27. 10.1186/s13287-016-0284-5. Published 2016 Feb 10.
Wang N, Shao Y, Mei Y, et al. Novel mechanism for mesenchymal stem cells in attenuating peritoneal adhesion: accumulating in the lung and secreting tumor necrosis factor α-stimulating gene-6. Stem Cell Res Ther. 2012;3(6):51. 10.1186/scrt142. Published 2012 Dec 6.
Tulotta C, Stefanescu C, Chen Q, et al. CXCR4 signaling regulates metastatic onset by controlling neutrophil motility and response to malignant cells. Sci Rep. 2019;9(1):2399. 10.1038/s41598-019-38643-2. Published 2019 Feb 20.
Chin S, Furukawa KI, Kurotaki K, et al. Facilitation of Chemotaxis Activity of Mesenchymal Stem Cells via Stromal Cell-Derived Factor-1 and Its Receptor May Promote Ectopic Ossification of Human Spinal Ligaments. J Pharmacol Exp Ther. 2019;369(1):1–8. 10.1124/jpet.118.254367.
Zhang L, Luo Y, Lu Z, et al. Astragalus Polysaccharide Inhibits Ionizing Radiation-Induced Bystander Effects by Regulating MAPK/NF-kB Signaling Pathway in Bone Mesenchymal Stem Cells (BMSCs). Med Sci Monit. 2018;24:4649–58. 10.12659/MSM.909153. Published 2018 Jul 6.
Xiu G, Li X, Yin Y, et al. SDF-1/CXCR4 Augments the Therapeutic Effect of Bone Marrow Mesenchymal Stem Cells in the Treatment of Lipopolysaccharide-Induced Liver Injury by Promoting Their Migration Through PI3K/Akt Signaling Pathway. Cell Transpl. 2020;29:963689720929992. 10.1177/0963689720929992.
Tan C, Tan S, Zhang H, et al. Enhanced migration and immunoregulatory capacity of BMSCs mediated by overexpression of CXCR4 and IL-35. Mol Immunol. 2022;150:1–8. 10.1016/j.molimm.2022.07.005.
Ji F, Wang Y, Yuan J, et al. The potential role of stromal cell-derived factor-1α/CXCR4/CXCR7 axis in adipose-derived mesenchymal stem cells. J Cell Physiol. 2020;235(4):3548–57. 10.1002/jcp.29243.
Zheng XB, He XW, Zhang LJ, et al. Bone marrow-derived CXCR4-overexpressing MSCs display increased homing to intestine and ameliorate colitis-associated tumorigenesis in mice. Gastroenterol Rep (Oxf). 2019;7(2):127–38. 10.1093/gastro/goy017.
Jiang DT, Tuo L, Bai X et al. Prostaglandin E1 reduces apoptosis and improves the homing of mesenchymal stem cells in pulmonary arterial hypertension by regulating hypoxia-inducible factor 1 alpha. Stem Cell Res Ther. 2022;13(1):316. Published 2022 Jul 16. 10.1186/s13287-022-03011-x.
Xiang Y, Li Y, Yang L, et al. miR-142-5p as a CXCR4-Targeted MicroRNA Attenuates SDF-1-Induced Chondrocyte Apoptosis and Cartilage Degradation via Inactivating MAPK Signaling Pathway. Biochem Res Int. 2020;2020:4508108. 10.1155/2020/4508108. Published 2020 Jan 24.
Chen X, Zhou C, Xu D et al. Peptide hormone ELABELA promotes rat bone marrow-derived mesenchymal stem cell proliferation and migration by manipulating the cell cycle through the PI3K/AKT pathway under the hypoxia and ischemia microenvironment. Stem Cell Res Ther. 2022;13(1):32. Published 2022 Jan 28. 10.1186/s13287-021-02691-1.

No competing interests reported.

Download PDF

Editor invited by journal
23 Jan, 2024
Submission checks completed at journal
23 Jan, 2024
First submitted to journal
17 Dec, 2023

You are reading this latest preprint version

Astragalus Polysaccharides Augment BMSCs Homing via SDF-1/CXCR4 Modulation: A Novel Approach to Counteract Peritoneal Mesenchymal Transformation and Fibrosis

Status:

Version 1

Abstract

Purpose

Methods

Results

Conclusion

Figures

Introduction

Material and methods

Isolation, Culture, and Characterization of BMSCs

Isolation, Culture, and Characterization of PMCs

Transmembrane migration experiment: assessing the response of BMSCs to APS and SDF-1

Animals

Tracking study of DiL-labeled BMSCs after transplantation

Histology and immunohistochemical (IHC) analysis of peritoneal samples

Immunocytochemical staining analysis of PMCs and BMSCs

Enzyme-linked immunosorbent assay (ELISA) method is used to detect SDF-1 levels

Analysis of protein expression changes in co-cultured PMCs and BMSCs using Western Blot method

Analysis of gene expression in peritoneum and PMCs using real-time quantitative PCR technique

Statistical analysis

Results

Identification and differentiation potential of BMSCs: in vitro culture and surface marker analysis

APS enhances the ability of BMSCs to improve peritoneal fibrosis in a rat model

APS pre-processing enhanced the homing activity of BMSCs in rats

APS enhances the ability of BMSCs to reverse MMT induced by PDF

APS pretreatment enhances the migration ability of BMSCs through SDF-1/CXCR4 chemotaxis

Blocking the SDF-1/CXCR4 axis reduces the therapeutic effect of BMSCs on MMT induced by PDF

The effect of APS on the downstream signaling pathway of SDF-1/CXCR4 in BMSCs

Discussion

Conclusion

Abbreviations

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1