Targeted Gene-Hormone Therapy of Colorectal Cancer with Guanylin Expressing Nano-system

doi:10.21203/rs.3.rs-3770812/v1

Download PDF

Research Article

Targeted Gene-Hormone Therapy of Colorectal Cancer with Guanylin Expressing Nano-system

https://doi.org/10.21203/rs.3.rs-3770812/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background

Addressing colorectal cancer (CRC) poses a significant challenge, demanding the precise delivery of therapeutic agents to eliminate cancer cells while minimizing impact on healthy cells. The strategic selection of therapeutic targets, the utilization of nanocarriers with optimal efficacy and low toxicity, and the development of gene constructs with controlled induction in cancer cells are crucial aspects in this pursuit.

Materials and Methods

This study employed a systems biology approach to comprehensively investigate the guanylin hormone-encoding gene (GUCA2A). Exploration encompassed expression patterns across tissues and single cells, clinical endpoints, methylation profiles, mutations, immune and functional analyses. Subsequently, GUCA2A was identified as a potential target for gain of function studies, leading to its amplification and cloning into gene constructs featuring both a robust CMV promoter and a cancer-specific MUC1 promoter. The succinylated PEI-9, characterized by low toxicity and high gene transfer efficiency, was then fabricated and characterized on HCT-116 cancer cells and normal Vero cell lines.

Results

systems biology studies revealed GUCA2A’s aberrant expression patterns, methylation variations, mutational changes as well as its remarkable association with immune engagement and poor survival outcomes in CRC. Moreover, SPEI-9 was introduced as a highly efficient and safe nanocarrier for gene delivery purposes. Additionally, in vitro studies revealed that both guanylin-expressing gene constructs exhibited potential in inhibiting cell growth and proliferation, inducing apoptosis, suppressing cell migration, and curtailing colony formation. Notably, these effects were more robust but non-specific in cancer cells treated with constructs containing the CMV general promoter, while, induction via the MUC1 promoter was more specific.

Conclusion

A genetic construct featuring the strong universal CMV and specific MUC1 promoter, expressing the guanylin peptide hormone, demonstrated highly effective and specific anticancer effects when transfected with nanocarriers characterized by high efficiency and low cytotoxicity. This nano-system holds promising implications for targeted CRC therapy.

colorectal cancer

guanylin

guanylyl cyclase c

gene therapy

gene delivery

In the past decades, with increasing concerns regarding the side effects and less effectiveness of conventional treatments, researchers sought to develop new approaches to fight cancer more effectively [1]. Hence, with the rapid surge in the utilization of (multi-)omics technology and computational modeling in biological systems over the past decade, in silico analyses have played a pivotal role in the identification of novel therapeutic targets and potential drug candidates for human diseases, specifically cancers [2–5].

The most prevalent occurrence in colorectal cancer (CRC), ~ 70–80%, involves the inactivation of the tumor suppressor gene adenomatous polyposis coli (APC). This often co-occurs with the activation of oncogenic KRAS (40–50%), and the presence of mutations in other tumor suppressor genes, such as PTEN or TP53, or oncogenes like PIK3CA, is also frequently observed [6].

Previous research has shown that GUCA2A (encoding endogenous peptide hormone guanylin), experiences loss subsequent to APC inactivation in mouse models featuring conditional biallelic Apc deletion (Apc^CKO/CKO) and Apc loss of heterozygosity (Apc^min/+) [7]. Given that guanylin is a peptide stimulant for GUCY2C, encoding a member of the family of transmembrane receptor guanylyl cyclases, it fosters cGMP accumulation, which in turn, facilitates electrolyte and fluid secretion within the large intestine as well as many other important roles summarized in Fig. 1A [8, 9]. Beyond this, GUCY2C regulates essential homeostatic processes that often dysregulated during tumorigenesis, including cellular functions like metabolism, proliferation, and differentiation programs [10, 11]. Silencing GUCY2C, is a universal characteristic of colorectal tumorigenesis which contributes to the promotion of crypt hyperplasia, acceleration of the cell cycle, induction of DNA damage, and higher susceptibility to tumor development [12, 13]. The majority of tumor subtypes maintain the presence of cell-surface GUCY2C expression as they progress through different stages of the disease [14, 15]. However, transformation universally orphans the receptor due to the depletion of endogenous hormones [15, 16]. These observations suggest reactivating endogenous hormone generation via gene therapy approaches, which may be a novel therapeutic strategy for CRC [17].

An avenue that holds promise for elevating cancer gene therapy to a potent strategy is the implementation of precision-targeted gene expression facilitated by tissue-specific or tumor-specific promoters [18]. The conventional promoters like hTERT, Survivin, uPAR, COX-2, and more recently, MUC1, exhibit notably higher expression levels in a spectrum of cancer types (specifically gastrointestinal (GI) cancers), compared to normal tissues [19]. Due to its specificity, the MUC1 promoter, which demonstrates expression in excess of 90% within CRC cells, presents itself as a potent substitute for the conventional promoters employed in the context of gene therapy for CRC [20, 21]. Further, the utilization of specific enhancers tailored to tumor-specific physiological conditions, notably hypoxia, through the incorporation of the hypoxia-sensitive element (HRE) upstream of the MUC1 promoter serves to augment gene expression within cancer cells, particularly under hypoxic conditions [22].

SPEI-9 as a succinylated PEI with low succinylation degree (about 9% based on polymer weight) with lower charge density and much lower cytotoxicity reduction and higher gene transfer efficiency compared to unmodified PEI is an optimal and potential gene delivery vector for gene therapy agents [23].

In this study, we first analyze the transcriptomics data of CRC as well as pan-cancer with the gene expression data from human tissues, tumors, and single-cell types. Secondly, we devised a gene therapy construct aimed at reinstating endogenous guanylin hormone expression, with MUC1 serving as the tumor-specific promoter and CMV as the universal promoter for precise CRC therapy. Thirdly, we synthesized and characterized SPEI-9 as a robust carrier to facilitate the delivery of these gene therapy constructs. We finally conducted down-stream investigations to evaluate the anti-tumor effects of this innovative and potent gene therapy-based nanosystem in both cancer and normal cell lines. A schematic diagram of the mechanisms underlying the treatment with the developed guanylin expressing nano-system is displayed in Fig. 1B.

Exploration of GUCA2A gene expression patterns

We utilized the resources of Tabula Muris (https://tabula-muris.ds.czbiohub.org) and single cell (https://singlecell.broadinstitute.org) databases to gain insights into the broad spectrum of GUCA2A and MUC1 gene expression levels across diverse tissues in the human body, as well as within distinct epithelial cells of CRC and their adjacent normal counterparts. Additionally, we conducted a differential analysis to investigate alterations in GUCA2A gene expression across microarray and TCGA datasets. These expression data, derived from the extensive Cancer Cell Line Encyclopedia (CCLE) project (GSE36133), and a clinically homogenous dataset of CRC tumor and normal tissues, TCGA COAD-READ, which were analyzed using LIMMA and edgeR packages in R [24, 25].

Assessing GUCA2A expression as a prognostic indicator in CRC

To assess the prognostic significance of GUCA2A expression on patient outcomes, we conducted univariate Cox regression analyses. Our investigation involved different CRC datasets from multiple microarray studies and The Cancer Genome Atlas (TCGA). This comprehensive approach allowed us to make predictions concerning different clinical endpoints including Cancer-Specific Survival (CSS), Disease-Free Interval (DFI), Disease-Free Survival (DFS), Disease-Free Metastasis Survival (DFMS), Disease-Specific Survival (DSS), Overall Survival (OS), Progression-Free Interval (PFI), Progression-Free Survival (PFS), and Relapse-Free Survival (RFS). across diverse CRC datasets. Additionally, we conducted Kaplan-Meier survival analysis to explore the association between GUCA2A expression levels and OS. The log-rank test was utilized to assess the prognostic significance of GUCA2A in the TCGA COAD-READ dataset. These analyses were performed using the R packages survival, survminer, and ggplot2 [26–28].

Relationship between GUCA2A expression and immunity

We also investigate the potential link between the association of GUCA2A expression and the tumor microenvironment (TME) in pan-cancer. To achieve this, we assessed various parameters, including stromal score, ESTIMATE score, immune score, tumor purity, and immune-related pathways. Multiple algorithms, such as XCELL, QUANTISEQ, CIBERSORT-ABS, EPIC, and TIMER, were employed for this analysis. To visualize the results, we utilized the ggplot2 R package. The generated heat maps provided insights into the relationships between GUCA2A expression, the above metrics, and immune infiltrating cells across different cancers.

Mutation and methylation profile analysis

To comprehensively investigate the mutational landscape of GUCA2A across various cancer types, we utilized the capabilities of the cBioPortal tool (http://www.cbioportal.org/). Focusing our efforts on the "TCGA Pan-Cancer Atlas Studies" cohort, we conducted an extensive investigation. This analysis encompassed the assessment of specific mutation sites, genetic alteration frequencies, and mutation types influencing GUCA2A. Furthermore, we utilized methylation data obtained from the SMART App (http://www.bioinfo-zs.com/smartapp) to investigate the relationship between GUCA2A expression and methylation patterns within the TCGA COAD-READ dataset. Box plot visualizations were generated using the ggplot2 package in R.

GSVA Analyses

We employed the R package "GSVA" to conduct Gene Set Variation Analysis (GSVA) [29], aiming to identify pathways most closely associated with GUCA2A expression. Pathways that were consistently enriched through GSVA analysis were regarded as potential pathways linked to GUCA2A expression.

Amplification of GUCA2A coding sequence

The primer for the amplification of the GUCA2A coding sequence (CDS) was designed using the primer3plus online tool, and then it was analyzed with primer blast, Multiple Primer Analyzer and IDT OligoAnalyzer Tool to check the optimality of various parameters. The Kozak sequence was placed at the beginning of the Forward (F) primer to initiate translation. Also, the cut site of BamHI enzyme was placed at the 5’ end of the primer before the Kozak sequence and the XbaI enzyme cut site was placed at the 5’ end of the Reverse (R) primer (Table. 1). Following the successful PCR amplification of the GUCA2A CDS from CRC normal tissue-derived cDNA, the resulting fragment was subjected to purification using the AccuPrep® PCR/Gel Purification Kit (Bioneer, Korea) following the manufacturer's protocol. Subsequently, enzymatic digestion utilizing BamHI and XbaI restriction enzymes was employed to process the digested fragment, facilitating the removal of undesired cleavage sites through additional gel extraction steps.

Construction of the guanylin expressing vectors

In this investigation, the mammalian expression vector, pCDNA 3.1/Hygro(+) (Invitrogen) was selected as the basic genetic construct. Specifically, the MUC1 gene promoter and cassettes containing the hypoxia response element (HRE), was amplified and cloned into the pcDNA3.1/Hygro (+) basic vector to replace the CMV promoter, yielding the HRE-pMUC1-Insert construct, which was generously provided by Dr. Rahbarizadeh's lab. The HRE-pMUC1-mRNA, alongside the default pCMV-mRNA vector, both prepared with BamHI/XbaI flanking cutting sites for subsequent subcloning procedures. To propagate these vectors, GM2163 bacteria (Dam⁻ Dcm⁻), a derivative of E. coli strain K12, were employed, as the XbaI cut site is hindered by dam methylation. Following bacterial transformation, the vectors were extracted using The GeneJET Plasmid Miniprep kit. Following enzymatic digestion with BamHI and XbaI, a further gel extraction step was performed to prepare vectors for downstream procedures. The digested vectors and GUCA2A CDS fragment were subsequently ligated together. After successful transformation, colony selection was carried out via colony PCR, followed by validation through Sanger sequencing. The resulting vectors, named HRE-pMUC1-GUCA2A and pCMV-GUCA2A, were then prepared for subsequent cell culture analyses.

Synthesis and structural characterization of SPEI-9

PEI (0.5 grams) was dissolved in 8.5 mL of water and 1.5 mL of a NaCl solution (3 M). The pH of the solution was then adjusted to 5 using 1 M HCl. Precise quantities of succinic anhydride (0.1 M, for 9% modification) were dissolved in dimethyl sulfoxide (DMSO) and carefully added dropwise to the PEI solution. The reaction was conducted at room temperature for a duration of 3 h. To purify the crude products, a dialysis process was performed using an 10,000–12,000 molecular weight cutoff membrane. Initially, dialysis was carried out against a 0.25 M NaCl solution to eliminate any unreacted succinate. Subsequently, the solution was dialyzed twice against water at a temperature of 4°C to remove residual salt. Following the dialysis process, the aqueous solution was subjected to lyophilization. A schematic diagram of the reaction of succinic anhydride and basic PEI to make SPEI-9 is displayed in Fig. 4E. For the downstream tests (except structural analysis), we prepared the polymers in different concentrations with HBG buffer (20 mM HEPES in 5% glucose solution, pH 7.2) to obtain different C/P ratios.

The degree of modification was assessed using 1H nuclear magnetic resonance (NMR) spectroscopy (Varian INOVA 500MHz, Palo Alto, USA) in deuterium oxide (D2O). The presence of carboxylic acid changes on the surface of SPEI-9 was also confirmed using FT-IR (Agilent-USA-Cary 680). The spectra were analyzed using Origin software (version 9.85).

Buffering capacity of PEI and SPEI-9 nanocarriers

PEI-based nanocarriers exhibit robust pH resistance within a broad range (pH 2 to 10). This resistance eventually leads to an increase in the osmotic pressure, its bursting and the release of the polyplex into the cytosol due to proton sponge effect. To assess the buffering capacity of both PEI and SPEI-9, a 2 mg/mL solution of the nanocarriers was initially dissolved in deionized water, and its pH was measured. Subsequently, the solution's pH was adjusted to 12 using 1N NaOH and then titrated incrementally with 5 µl of 1N HCl until the pH dropped below 2.5. Throughout this process, a pH curve was generated based on the added acid. The experiment included deionized water as a negative control and PEI as a positive control.

Preparation and loading efficiency of PEI and SPEI-9 polyplexes

PEI/DNA and SPEI-9/DNA polyplexes were prepared by adding 50 µl of the polymer solution in different concentrations to 50 µl of the gene construct with the same concentration (at a concentration of 40 µg/ml in HBG buffer). After gently pipetting the mixture (10–20 times), it was allowed to incubate for 20–30 minutes at room temperature to form stable complexes. To assess the binding affinity of PEI and SPEI-9 polymers with genetic constructs, a gel retardation assay was employed. Polyplexes were prepared at various C/P ratios ranging from 0.25 to 8. Gel electrophoresis was subsequently conducted, and the results were analyzed using a Gel-Doc device.

DNase degradation assay

To assess the protective ability of PEI and SPEI-9 against enzymatic degradation of loaded DNA by serum nucleases, a DNase protection test was conducted. Polyplexes were prepared at various C/P ratios (ranging from 0.25 to 8) and exposed to 1 µl of DNase I enzyme (1 U/µl) in PBS or DNase/Mg2 + reaction buffer for 30 min at 37°C. Then, 4 µl of 50 mM EDTA were added to deactivate the enzyme by removing the Mg2 + ions present in the enzyme buffer. All microtubes were then incubated for 10 min at 65°C to inactivate the enzyme. Subsequently, 10 µl of 1 mg/ml heparin were added to facilitate the separation of the DNA from the nanocarrier. The microtubes were further incubated for 2 hours at room temperature. Finally, the samples were subjected to electrophoresis in a 1% agarose gel.

Measurements of the size and zeta potential of the polyplexes

The average hydrodynamic particle size and surface charge density of polyplexes were measured by Dynamic Light Scattering and Laser Doppler Velocimetry by Malvern Nano Zetasizer (Malvern, UK) and results were reported as mean ± SEM (n = 3).

Hemolysis test of polyplexes

The hemolysis assay was conducted using human blood to assess the blood compatibility of the synthesized polymers. Arterial blood was collected, and red blood cells (RBC) were isolated through centrifugation (3000 rpm for 10 min) and washing with PBS. Washed RBCs were then exposed to polyplexes (using 100 µl of washed RBC) with various C/P ratios, with deionized water and PBS serving as positive and negative controls, respectively. The samples were incubated at 37°C for 2 h, followed by centrifugation (13,000 rpm for 10 min), and the absorbance of the supernatant (A) was measured at 540 nm. The percentage of hemolysis was calculated as follows.

$Hemolysis \left(\text{\%}\right)=\frac{\text{A} \text{s}\text{a}\text{m}\text{p}\text{l}\text{e} - \text{A} \text{n}\text{e}\text{g}\text{a}\text{t}\text{i}\text{v}\text{e}}{\text{A} \text{p}\text{o}\text{s}\text{i}\text{t}\text{i}\text{v}\text{e} - \text{A} \text{n}\text{e}\text{g}\text{a}\text{t}\text{i}\text{v}\text{e}}$ × 100

Protein Interaction

To evaluate nonspecific protein binding interactions, 0.5 mL of a bovine serum albumin (BSA) standard solution (2 mg/ml) was mixed with 0.5 ml of each polyplex solution (using 1 mg/ml of polymers). These mixtures were incubated at 37°C for 1 h, followed by centrifugation to collect supernatant samples. The protein concentrations in these samples were quantified using a BCA assay with a BSA calibration curve. The parameter A, representing protein interaction, was defined as:

$$A=1- \frac{\text{C}\text{s}\text{V}\text{s}}{\text{C}\text{i}\text{V}\text{i}}$$

Here, Ci represents the initial BSA concentration (2 mg/ml), Cs is the BSA concentration in the supernatant determined by the BCA assay, Vi is the initial volume of the BSA solution (0.5 ml), and Vs is the total volume of the BSA solution after the adsorption measurement (1 ml). The interaction value A quantifies the extent to which protein has been removed from the initial solution through interaction with the polymer. It ranges from 0 (indicating no removal of protein) to 1 (representing complete removal of protein).

Evaluation of the gene-hormone therapy nano-system in vitro

After designing, constructing, and validating the therapeutic vectors, pCMV-GUCA2A and HRE-ERE-pMUC-GUCA2A, as well as SPEI-9 (C/P 4) as a potent gene delivery nano-system, we evaluate the therapeutic nano-system through different in vitro assays on HCT-116 as CRC cell line and the Vero, as a normal African green monkey kidney cell line. Cells were grown in Dulbecco's Modified Eagle's Medium (DMEM) medium (Bioidea, Iran) supplemented with 10% fetal bovine serum (FBS, Gibco, USA), 1% Penicillin/Streptomycin (Gibco, USA) and were maintained at 37°C and 5% CO₂

Transfection efficiency of nanocarriers

To assess cellular transfection efficiency, we employed PEI and SPEI-9 nanocarriers loaded with the pEGFP-N1 vector, which encodes the enhanced green fluorescent protein (EGFP). Briefly, HCT-116 and Vero cells were allowed to reach the required confluence in 12-well plate, after which polyplexes were introduced for transfection at 24 h, 48 h, and 72 h. This allowed us to evaluate transfection efficiency using a fluorescent microscope and determine the optimal time for subsequent treatments.

Assessment of mRNA expression levels for guanylin and downstream genes

Following transfection of HCT-116 and Vero cells with different groups (pCMV-GUCA2A, HRE-pMUC1-GUCA2A, pEGFP-N1 and control) using SPEI-9 in 6-well plate, we examined alterations in the expression of the GUCA2A gene and its downstream targets, specifically β-catenin (CTNNB1) and p21 (CDKN1A), in addition to genes associated with apoptosis (BAX and BCL-2) and cell migration (VIM and CDH2) pathways. To do this, RNA was extracted from the transfection cells 72 h upon transfection utilizing the RNX-Plus kit (CinnaGen, Iran). Subsequently, the extracted RNA was reverse transcribed into complementary DNA (cDNA) using the RevertAid First Strand cDNA Synthesis kit (Thermo Fisher Scientific, USA). The primers used in quantitative reverse transcription PCR (RT-qPCR) of the GUCA2A gene along with the primers used to evaluate the downstream pathways are given in the Table 1. For each group, RT-qPCR was conducted in duplicate using SYBR Green and a LightCycler 96 RT-qPCR detection system (Roche, USA) according to the manufacturer’s instructions. Further, changes in gene expression between tumor and adjacent healthy tissues was also evaluated utilizing CRC tissue samples (10 sample) along with their respective adjacent non-cancerous tissues (10 sample) from Iranian patients who visited the Poursina Hakim Research Institute in Esfahan, Iran, during 2021 to 2022. The RNA extraction to RT-qPCR step was performed as mentioned above. The study protocol was granted ethical approval by the Ethical Committee of Hamadan University of Medical Science (ethical code: IR.UMSHA.REC.1399.562).

Evaluation of guanylin expression changes following hypoxia treatment

After transfection with HRE-pMUC1-GUCA2A using SPEI-9, the HCT-116 cells were subjected to hypoxic conditions. This was achieved by filling the culture medium up to the top of the well and subsequently sealing it with parafilm. Following a 16-hour incubation period post-transfection, alterations in GUCA2A gene expression were assessed through RT-qPCR analysis.

Cell toxicity experiments

Cell proliferation assays were conducted to assess the impact of PEI and SPEI-9 nanocarriers with different C/P ratios, along with various gene therapy groups, on both HCT-116 and Vero cells. Initially, cells were cultured in 96-well plates until they reached the desired confluence (70–80%). Subsequently, the cytotoxicity of PEI nanocarriers (at C/P ratios of 0.25 and 1) and SPEI-9 (at different C/P ratios of 0.25, 1, 4, and 8) was evaluated after a 72 h exposure (no removal of medium post transfection), using the control pEGFP-N1 vector. Additionally, the cytotoxic effects of the gene therapy nano-systems were also investigated following 72 h transfection. To perform this evaluation, 10 µL of MTT solution (5 mg/ml in PBS) was added to each well containing cells and incubated for an additional 4 hours at 37°C. Following this incubation, the culture medium was carefully removed, and 150 µL of DMSO was added to each well to dissolve the purple formazan crystals. The absorbance was then measured at 490 nm using a microplate reader (Epoch BioTek, USA).

Annexin V-PI flow cytometry

To assess apoptosis/necrosis induced by the gene therapy nano-system, the following procedure was followed: Cells were initially cultured in individual 6-well plates and transfected the following day. After a 72-hour incubation period, the cells were trypsinized and subsequently centrifuged at 1500 g for 5 minutes. Following this, the cells were subjected to a PBS wash. To the cell pellet dissolved in binding buffer, a mixture containing 10 µl of propidium iodide (PI) dye and 5 µl of Annexin-V dye was added. The samples were then incubated in the dark at room temperature (25°C) for 10 minutes. The analysis of the cells was carried out using an Attune NxT Flow Cytometer (Thermo Fisher Scientific, USA) and then FlowJo software.

In vitro scratch assay

In this research, we employed the scratch test (wound-healing assay) to evaluate the effect of gene therapy nano-system on the migration and metastatic ability of HCT-116 and Vero cells. The procedure involved transfecting cells with various constructs and creating artificial scratches to assess cell viability. Microscopic imaging was conducted at specific time points (0, 24, and 48 h) to monitor the cells' capability to close the gap created by the scratch. Subsequently, we analyzed the gap area using Image J software to quantify and compare cell migration in relation to the control group.

Colony formation assays

Cells were seeded into 6-well plates (with 500 cells/well for the HCT-116 cell line and 1000 cells/well for the Vero cell line). The transfection procedure involving gene constructs was initiated, and the plates were incubated for a minimum of 8 days, until visible colonies were formed. Once an adequate colony growth was achieved, the plates were subjected to staining with a crystal violet solution to stain the colonies (with at least 50 cells). Subsequently, the number of colonies was quantified and analyzed using Image J software.

Statistical analysis

All data are expressed as the as mean with SD and the results are representatives of at least three independent experiments. Inferential statistical analyses were performed with an unpaired t-test, Wilcoxon signed-rank test and one-way analysis of variance (ANOVA) (*P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001). SPSS 18.0 or GraphPad Prism 9 was used for analysis.

Expression analysis reveals intestine-specific expression of GUCA2A

We conducted an investigation into the tissue distribution of GUCA2A expression utilizing the Tabula Muris and single cell databases, repositories enriched with valuable single cell RNA-seq data. The results unveiled an interesting pattern of GUCA2A expression primarily within the large intestinal tissue (Fig. 2A, 2B). Notably, within the large intestine, GUCA2A displayed marked variation in expression across distinct cell types. Notably, the highest expression was observed in enterocytes, BEST4 + epithelial cells, and goblet cells (Fig. 2C, 2D), which play pivotal roles in processes such as water and ion absorption, nutrient uptake, and vitamin absorption. Conversely, the expression of the GUCA2A gene within CRC tumor tissue cells was found to be notably low and, in many cells, entirely lost (Fig. 2C, 2F). Moreover, MUC1 expression shown elevation in goblet cells, immature goblet cells, and intestinal stem cells within normal cell populations as normally mucin is primarily localized to the apical cell membranes in these cell types. In contrast, MUC1 expression exhibited a more widespread and significant distribution across various tumor cells (Fig. 2D, 2C). Additionally, the expression analysis of GUCA2A using TCGA COAD-READ datasets displayed significant down regulation in CRC tissues compared with normal tissues (Fig. 2G). Further investigation for the GUCA2A (Fig. 2H) and MUC1 (Fig. 2I) were also performed in 55 CRC cell lines, which revealed their distributed expression levels across all CRC cell lines, with a particular emphasis on HCT-116, which aligns with the focus of our study.

GUCA2A expression level correlates with poor prognosis in CRC

We employed a univariate Cox regression model to evaluate the association between GUCA2A expression and various clinical endpoints, in different CRC datasets. Remarkably, reduced GUCA2A expression was significantly linked to adverse outcomes across multiple clinical endpoints in CRC (Fig. 3A). In this regard, GUCA2A expression significantly correlated with worse DFI, DFS, DSS, OS, PFI, PFS, and RFS, which makes it a key gene for prognosis of CRC. The HR values demonstrate that decreased GUCA2A expression is generally associated with a higher risk of unfavorable events such as disease recurrence, progression, and mortality across various clinical endpoints in CRC, except for RFS, where increased GUCA2A expression is linked to a reduced risk of disease relapse (Fig. 3A). Moreover, the survival curve analysis emphasized that decreased GUCA2A expression was also associated with significantly shorter OS time (Fig. 3B). Collectively, these discoveries underscore the potential of GUCA2A as an innovative and valuable prognostic biomarker in CRC.

Immune cell infiltration analysis of GUCA2A in CRC

To investigate the connection between GUCA2A expression and immune cell infiltration, we performed correlation analyses using data from different algorithms. The results unveiled significant positive correlations between GUCA2A expression and the infiltration of various immune cell types, including neutrophils, B cell plasma, activated myeloid dendritic cells, M1- and M2-like macrophages, CD4 + T cells, and CD8 + T cells (Fig. 3C). Conversely, GUCA2A expression exhibited negative correlations with M0-like macrophages, cancer-associated fibroblasts, NK cells, myeloid-derived suppressor cells, mast cells, and CD4 + T cells (Fig. 3C). While the correlation values ranged from ± 0.1 to ± 0.5 and were not exceptionally high, these findings suggest that GUCA2A may play a role in promoting T cell infiltration, which could contribute to its protective effects in CRC. Nonetheless, further clinical investigations are warranted to explore deeper into this finding.

DNA methylation and alterations of GUCA2A in pan-cancer

To investigate the relationship between GUCA2A gene mutations and tumor development, we conducted a pan-cancer analysis using the cBioPortal platform, with a specific focus on CRC. The primary alteration type predominantly indicated "mRNA low" in the majority of samples across various cancer types, with a lesser frequency of "mRNA high" alterations (Fig. 3D, 3F). Notably, "mRNA low" alterations were observed in over 60% of CRC samples (Fig. 3D). Moreover, the somatic mutation frequency analysis of GUCA2A revealed missense mutations in several cancer types, including Breast Prostate Adenocarcinoma, Invasive Ductal Carcinoma, Acute Myeloid Leukemia, Hepatocellular Carcinoma, Renal Clear Cell Carcinoma, Uterine Endometrioid Carcinoma, Cutaneous Melanoma, Head and Neck Squamous Cell Carcinoma, and notably in CRC (Fig. 3E). Furthermore, the analysis of GUCA2A gene methylation data unveiled a significant decrease in the promoter methylation level of GUCA2A in CRC (Fig. 3G). These findings enhance our knowledge of the genetic mechanisms underlying tumor progression and offer further research and potential therapeutic exploration of GUCA2A.

Identification of key cancer-related pathways linked to GUCA2A

To assess the potential impact of GUCA2A expression on cellular pathways, we conducted a GSVA involving 50 HALLMARK pathways. The relationship between GUCA2A expression levels and GSVA scores in CRC is illustrated in Fig. 3H. Our biological enrichment analysis revealed distinctive patterns, exhibiting upregulation in pathways associated with pancreas beta cells, bile acid metabolism, and KRAS signaling with elevated GUCA2A expression. Conversely, as GUCA2A expression increased, pathways related to mitotic spindle dynamics, protein secretion processes, G2M checkpoint regulation, and interferon alpha responses were downregulated (Fig. 3H). These findings provide insights into how GUCA2A expression may influence various pathways in CRC, shedding light on potential mechanisms and functional associations.

Construction of guanylin expressing constructs

Following the amplification and isolation of the CDS region of the GUCA2A gene (Fig. 4A) (Additional file 1. A), the obtained fragment and the plasmid constructs (HRE-pMUC1 and pCMV) underwent digestion using BamHI and XbaI enzymes. Subsequently, they were purified from the gel and linked together through ligation process. These resulting plasmids were then introduced into competent bacteria via transformation. Afterward, bacterial colonies were cultured on plates, and the colonies were verified using colony PCR to amplify a 117 bp product (Fig. 4B) (Additional file 1. B). A single colony was selected for extraction of plasmids. Finally, the validation of both the HRE-pMUC1-GUCA2A and pCMV-GUCA2A plasmids was performed through Sanger sequencing (Fig. 4C). the schematic illustration of resulting guanylin expressing constructs were shown in Fig. 4D.

Structural confirmation of SPEI-9 nanocarrier

The FT-IR analysis conducted on basic PEI and SPEI-9 revealed distinct peaks corresponding to the functional groups present in the polymer. These peaks were cross-referenced with the FT-IR spectra library for validation. Notably, the spectrum exhibited a prominent peak at approximately 1760 cm^− 1, which is associated with the stretching vibration of the carbonyl group (C = O) found in succinyl (Fig. 5A). This peak serves as an indicator of the binding of the succinyl group to the PEI structure. NMR spectroscopy was employed to perform a structural analysis of SPEI-9. Through this analysis, distinctive peaks associated with various proton environments within the polymer were identified. Notably, the observation of peaks in chemical shifts ranging from 2.5 to 3.5 ppm signified the presence of the PEI backbone (Fig. 5B). Additionally, the emergence of new peaks with chemical shifts in the range of 2.3 to 2.5 ppm provided confirmation of the succinyl group's presence. Consequently, the chemical environment of carbon atoms in the SPEI-9 sample served as confirmation of the successful modification of the polymer.

Measuring buffering capacity of SPEI-9 nanocarrier

The buffer capacity of PEI and SPEI-9 was also evaluated in this study. In this regard, compared to the negative control (deionized water), both SPEI-9 and PEI showed significant buffer capacity (Fig. 5C). The pH of the solutions remained relatively stable even with the addition of high amounts of acid, indicating their resilience to pH changes. However, since the degree of 9% succinylation was used, SPEI-9 showed relatively lower buffering capacity compared to PEI at concentrations above 80 µl of HCl (Fig. 5C). Therefore, the modification of PEI with 9% succinic anhydride largely preserved the suitable buffering properties of the basic nanocarrier, which can be useful for various applications such as drug delivery and gene therapy, where maintaining a specific pH range is very important.

Measuring the gel retardation by SPEI-9 nanocarrier

The DNA loading capacity of both PEI and SPEI-9 was assessed through a gel retardation assay, utilizing various C/P ratios ranging from 0.25 to 8. The results of the gel retardation assay revealed that at lower C/P ratios, specifically 0.25 and 1, SPEI-9 polyplexes exhibited limited DNA loading, as evidenced by their increased mobility during gel electrophoresis (Fig. 5D) (Additional file 1. C). In contrast, at C/P ratios of 4 and 8, SPEI-9 nanocarriers demonstrated complete plasmid encapsulation, signifying an optimal loading capacity conducive to efficient plasmid delivery (Fig. 5D). Conversely, the PEI-based nanocarrier displayed full DNA loading at three distinct C/P ratios: 1, 4, and 8 (Fig. 5D). Consequently, the findings from agarose gel electrophoresis underscored the suitability of SPEI-9 nanocarriers at a C/P ratio of 4 and PEI at a C/P ratio of 1 as optimal ratio for gene delivery applications.

DNase protection analysis of SPEI-9

The experiment involved treating SPEI-9 polyplexes at C/P ratios of 0.25, 4, and 8, along with a control gene construct group, with and without DNase. This simulated the presence of nucleases that could potentially break down genetic material. The results revealed that polyplexes formed at a C/P ratio of 0.25, as well as the plasmid structure, were significantly degraded after DNase treatment, as evidenced by the absence of plasmid bands in agarose gel electrophoresis (Fig. 5E) (Additional file 1. D). This indicated the vulnerability of genetic material when complexed with SPEI-9 at this specific C/P ratio. In contrast, polyplexes formed with SPEI-9 at C/P ratios of 4 and 8 displayed robust resistance against DNase degradation (Fig. 5E). The bands corresponding to the gene constructs remained well-defined and intact after DNase treatment, underscoring the effective protection provided by SPEI-9 against enzymatic digestion.

Measuring the size and surface charge of SPEI-9 nanocarrier

The size and surface charge (zeta potential) of PEI and SPEI-9 nanocarriers were determined to evaluate their physicochemical properties, which can affect their stability and interaction with genetic materials. In this regard, the results showed that the polyplexes formed with SPEI-9 had an average size of 149.6 nm with an optimum PDI, which indicates that the polyplexes are relatively homogeneous in size and have good stability (Fig. 5F). In contrast, polyplexes formed with PEI had a larger average size of 205 nm, indicating a broader size distribution compared to SPEI-9 polyplexes (Fig. 5F). Zeta potential measurements also showed that SPEI-9 polyplexes have a positive surface charge, with an average surface charge of + 11.2 mV (Fig. 5G). This positive charge is attributed to the presence of succinyl and amine groups in the PEI column, which can interact with the negatively charged genetic material. Positive zeta potential indicates good electrostatic stability and effective complexation potential with nucleic acids. In contrast, unmodified PEI polyplexes showed positive zeta potential with an average value of + 17.7 mV (Fig. 5G). This higher positive charge is due to the lack of coverage of amine groups by succinyl. With this positive zeta potential, PEI polyplexes showed good stability and the ability to form complexes with genetic materials.

Measuring the effect of SPEI-9 nanocarrier on hemolysis rate

The hemolytic activity of PEI and SPEI-9 polyplexes was evaluated to assess their potential cytotoxic effects on RBCs. The hemolysis assay included the incubation of polyplexes with RBCs and the measurement of hemoglobin release, which acts as an indicator of cell membrane damage and hemolysis. The results showed that the rate of hemolysis increases with increasing C/P ratio for SPEI-9 polyplexes (Fig. 5H). At the C/P ratio of 0.25, the amount of hemolysis was relatively low. However, with the increase of C/P ratio to 1, 4 and 8, the degree of hemolysis also increased gradually (Fig. 5H). This shows that higher concentrations of SPEI-9 polyplexes may have more potential to induce hemolysis. In comparison, PEI polyplexes at a C/P ratio of 1 had slightly similar hemolysis rates to SPEI-9 polyplexes at a C/P ratio of 4. This suggests that PEI polyplexes may also have some hemolytic activity. Although to a lesser extent compared to the SPEI-9 polyplex, the C/P ratio was higher than 8 (Fig. 5H). These results highlight the importance of carefully selecting the C/P ratio and optimizing the formulation of polyplexes to minimize potential cytotoxic effects, especially in the context of functional in vivo gene delivery purposes.

Interaction assay of SPEI-9 nanocarrier with BSA protein

The interaction of PEI and SPEI-9 polyplexes with BSA was evaluated to assess their protein interaction capabilities. The BSA interaction test included the incubation of polyplexes with BSA and measuring the removal or retention of protein in the supernatant of the interaction reaction using spectrometry. In this regard, the results showed that the SPEI-9 polyplex with a C/P ratio of 4, which was selected based on previous tests for downstream studies, had a lower interaction (with an average of 0.48) with BSA compared to PEI polyplexes of C/P ratio 1 with an average of 0.61 (p = 0.017) (Fig. 5I). The reduction of protein interaction observed with SPEI-9 polyplex indicates that modification of succinylation of PEI may change its surface characteristics and reduce its ability to interact with serum proteins such as BSA. This can be useful in gene delivery applications, as reduced protein interactions can improve stability in circulation to help transfer with higher efficiency.

Cytotoxicity assay of SPEI-9 nanocarrier

Cytotoxicity assessment of PEI and SPEI-9 was performed in two cell lines, HCT-116 and Vero. In this regard, PEI in C/P ratio 1 showed the highest cytotoxicity in both cell lines, which indicates its destructive effect on cell viability (p = 0 < 0.0001) (Fig. 5J, 5K). This can be attributed to the high cationic charge density of PEI, which leads to electrostatic interactions with negatively charged cell membranes. These interactions can eventually cause irreparable damage to the cell membrane and lead to cell lysis or necrosis. In contrast, the cytotoxicity of SPEI-9 in both cell lines at different C/P ratios was relatively lower compared to PEI 1 (p = 0.0102, 0.0004, 0 < 0.0001) (Fig. 5J, 5K). Reducing the charge density of succinylated polymers may help reduce the deleterious effects on cell viability. HCT-116 cells had the lowest toxicity in the presence of SPEI-9 at all C/P ratios, which indicates higher resistance compared to Vero cells. Furthermore, the cytotoxicity of SPEI-9 increased with increasing C/P ratio, indicating a concentration-dependent effect. Even at the highest C/P ratio (8:1), the cytotoxicity of SPEI-9 was almost equal compared to PEI at a C/P ratio of 1:1 (Fig. 5J). Cytotoxicity was observed in Vero cells treated with PEI and SPEI-9 in a more severe manner. In this context, it was observed that the cytotoxicity of Vero cells was notably lower when treated with SPEI-9 at a C/P ratio of 0.25:1 in comparison to other ratios. However, as the C/P ratio increased, there was a significant elevation in cytotoxicity among Vero cells (p = 0.017, p < 0.0001) (Fig. 5K). These findings underscore the significance of polymer modification, such as succinylation, in mitigating the cytotoxic effects associated with PEI. The reduced cytotoxicity observed with SPEI-9 implies its potential as a safer alternative for gene transfer applications, particularly in the context of cancer cells like HCT-116.

Transfection efficiency assay by SPEI-9 nanocarrier

Analysis of the images acquired via fluorescence microscopy revealed that both SPEI-9 (C/P 4) and PEI (C/P 1) nanocarriers exhibited remarkable efficacy in delivering the pEGFP-N1 plasmid construct, which contains the EGFP protein as a transfection marker. The results indicated that the optimal transfection time for plasmid treatment was 72 h, a widely accepted standard in plasmid transfection protocols. Notably, the transfection rate achieved by the SPEI-9 nanocarrier surpassed that of PEI in both the cancer cell lines HCT-116 (Fig. 6A, 6B) and the normal Vero cell line (Fig. 6C, 6D). Consequently, the SPEI-9 nanocarrier, administered for 72 h, was selected for subsequent assessments in cell culture studies.

Cell culture study design

After conducting different studies involving PEI and SPEI-9 nanocarriers at varying C/P ratios, we have determined that SPEI-9, due to its significantly lower toxicity and superior transfection efficiency during the 72 h treatment, is the optimal choice for subsequent cell culture studies. Furthermore, considering its effective loading at a C/P ratio of 4, along with its reduced toxicity compared to a C/P ratio of 8, we have selected this C/P ratio for the treatment groups in conjunction with various constructs, including pCMV-GUCA2A loaded SPEI-9, HRE-pMUC1-GUCA2A loaded SPEI-9, pEGFP-N1 loaded SPEI-9, and a control group.

Evaluation of gene expression changes

At first, the GUCA2A expression level in 10 CRC tissues and 10 adjacent healthy tissues was investigated using RT-qPCR. The results of this study showed a notable decreased and differential expression of GUCA2A in tumor tissue compared to the adjacent healthy tissue among different patients (Fig. 6E). Additionally, RT-qPCR for GUCA2A, p21 (CDKN1A), β-catenin (CTNNB1), BAX, BCL-2, Cadherin-2 (CDH2), Vimentin (VIM), and GAPDH (as reference gene) was performed to evaluate the mRNA expression changes upon treatment with different gene therapeutics. In both cell line, SPEI-9 loaded with pCMV-GUCA2A showed remarkable over expression of guanylin hormone (≈ 15-fold increase in logFC, p = 0 < 0.0001) (Fig. 6F). While, SPEI-9 nanocarrier loaded with pMUC1-GUCA2A, shown a lower level of increased expression than pCMV-GUCA2A in HCT-116 (≈ 5-fold increase in logFC, p = 0 < 0.0001) and much lower level of increased expression in Vero cells (not significant), indicating moderate but specific expression of guanylin in cancer cells lines (Fig. 6F). This result is consistent with the tumor-specific nature of the MUC1 gene promoter, which directs the expression of guanylin specifically in tumor cells and minimizes its expression in normal cells.

In addition to measuring expression changes by the gene constructs, the effects of inducing gene expression by HRE cassette were also evaluated. We chose the treatment time with and without the effects of hypoxia for 16 h, which showed a significant increase in this period of time compared to the untreated group (≈ 3.5-fold increase in fold change, p = 0.0004) (Fig. 6G).

In this regard, the pCMV-GUCA2A group showed a significant decrease of ≈ 6-fold (p = 0.0005) and ≈ 1.5-fold (p = 0.0023) decrease in β-catenin mRNA levels in HCT-116 and Vero cells, respectively (Fig. 6H). Regarding the pMUC1-GUCA2A construct, it showed a significant decrease of ≈ 2-fold (p = 0.002) and ≈ 1-fold (p = 0.113) in both HCT-116 and Vero cell lines, but with less intensity (Fig. 6H). In relation to p21, a significant increase in the expression of pCMV-GUCA2A gene construct (p = 0.001) compared to pMUC1-GUCA2A (p = 0.0019) was observed for HCT-116 cell line (Fig. 6I). However, in Vero cell line, both gene constructs showed ≈ 1-fold decrease in p21 mRNA level, that this result can be based on the fact that in this cell line the expression of p21 is naturally reduced [30] (Fig. 6I).

The effect of guanylin over expression on the levels of two key mediators of apoptosis, BAX and BCL-2 as a promoter and inhibitor of apoptosis were also investigated, respectively. In this regard, both gene constructs of pCMV-GUCA2A and pMUC1-GUCA2A showed significant increase in the expression of the apoptosis-promoting gene, BAX, for the HCT-116 cell line (p = 0.0040 and p = 0.0173) (Fig. 6J). These changes in the pCMV-GUCA2A group were more intense (≈ 2-fold), which is caused by the significant difference in guanylin expression. On the other hand, in the Vero cell line, this difference in expression was observed with less severity for both pCMV-GUCA2A (p = 0.0199) and pMUC1-GUCA2A (p = 0.0493) treatment groups (Fig. 6J). Moreover, BCL-2 levels have shown significant decrease in both gene constructs in HCT-116 (p = 0 < 0.0001) and Vero (p = 0 < 0.001) cell lines (Fig. 6K). However, these changes were more intense for pCMV-GUCA2A compare to pMUC1-GUCA2A, with tumor specific promoter (Fig. 6K).

These differential results were also repeated in the expression of two key genes involved in the epithelial-mesenchymal transition (EMT) pathway, including Vimentin and N-cadherin, due to the strong but non-specific CMV promoter and the moderate but tumor-specific promoter MUC1. Regarding Vimentin, the results showed a significant decrease in expression in HCT-116 cell line for both treatments (p = 0 < 0.0001) (Fig. 6L). For the Vero cell line, the pCMV-GUCA2A group showed a lower expression decrease (p = 0.0156) (Fig. 6L). On the other hand, in the case of pMUC1-GUCA2A treatment, this gene showed a very small increase (p = 0.0142). Additionally, for N-cadherin in both HCT-116 and Vero cell line, both treatment groups showed a significant decrease in expression (p = 0 < 0.001), while for Vero cell line, the changes in the mRNA level were less intense than HCT-116 cancer cell line (Fig. 6M). Finally, heat maps were also generated based on the expression of GUCA2A and its 6 downstream genes for both cancer and normal cell lines to better show the expression distribution between these two cell lines (Fig. 6N, 6O).

Evaluation of cytotoxicity upon guanylin gain of function

Following the evaluation of guanylin expression through RT-qPCR, we proceeded to assess the impact of different gene constructs delivered via SPEI-9 on cell viability and potential cytotoxicity. In the case of HCT-116 cells, it was evident that cell viability significantly decreased in both the pCMV-GUCA2A (p = 0.0001) and pMUC1-GUCA2A (p = 0.0030) groups when compared to the control and SPEI-9 groups (Fig. 7E). Conversely, the cytotoxicity induced by the gene therapeutics markedly increased in both groups when applied to HCT-116 cell lines. In normal Vero cells, the cytotoxicity induced by pCMV-GUCA2A was higher in comparison to pMUC1-GUCA2A (p = 0.0001) (Fig. 7F). The subsequent increase in cytotoxicity observed with pMUC1-GUCA2A was relatively lower than that associated with pCMV-GUCA2A (p = 0.0019), aligning with expectations (Fig. 7F).

Evaluation of apoptosis induction upon guanylin expressing nano-system

To assess the anti-tumor effects of the gene therapeutics, we measured the percentage of induced apoptosis using the Annexin-PI kit and analyzed the results in three categories: necrosis, apoptosis, and total cell death. In this context, we observed minimal necrosis in HCT-116 cancer cells as a result of the genetic constructs (Fig. 7A, 7B). However, in normal Vero cells, necrosis reached levels of up to 25% (Fig. 7A, 7B). This relatively higher necrosis percentage in Vero cells can be attributed to their strong adhesion to the culture plate. Additionally, mechanical scraping with a cell scraper contributed to the induction of necrosis. Furthermore, both gene constructs exhibited significant induction of apoptosis in HCT-116 cancer cells (p = 0.0001), with approximately 35% for pCMV-GUCA2A and approximately 30% for pMUC1-GUCA2A (Fig. 7A, 7C). In Vero cells, the induction of apoptosis was relatively lower, approximately 25% for pCMV-GUCA2A (p = 0.0001), and even less in the pMUC1-GUCA2A group, approximately 11% (p = 0.0120) (Fig. 7A, 7C). Finally, the overall assessment of cell death, which included both early and late apoptosis as well as necrosis, revealed similar patterns to apoptosis and necrosis (Fig. 7D).

Evaluation of cell migration ability

In order to investigate the inhibitory effect of gene constructs of cell migration, a scratch or wound healing assay was performed. The results of this test showed that pCMV-GUCA2A had stronger anti-migration effects compared to the pMUC1-GUCA2A vector. In this regard, after 24 and 48 h after treatment in HCT-116 cancer cells, the scratch assay created in the group treated with guanylin expression constructs, cell migration at a much lower speed than the nanocarrier group containing gene constructs control and group without treatment were performed (Fig. 8A, 8C). Interestingly, these effects in Vero cells were accompanied by a significant decrease in the inhibition of cell migration by treatment with the pMUC1-GUCA2A gene construct, which results from the low expression of guanylin (Fig. 8B, 8D). It is noteworthy to mention that in part A, 24 and 48 hours are separately seeded, treated and colored, and the control group shown corresponds to the 24 hours group.

Evaluation of the guanylin expressing nano-system on colony formation

In this test, the effect of different treatments through genetic constructs on the process of colony formation from a seeded cell to a colony of cells (about 50 cells) was evaluated. The obtained results, like the previous results, indicated stronger inhibitory effects of pCMV-GUCA2A treatment compared to the structure containing the specific promoter in HCT-116 cancer cell line. In this regard, both gene constructs in HCT-116 cell line showed a significant decrease in the number of colonies (p = 0 < 0.0001) (Fig. 8E, 8G). Also, in the group of normal Vero cells, far less inhibitory effects of the structure containing the MUC1 promoter (p = 0.0001) than CMV (p = 0 < 0.0001) were observed, which is consistent with the previous findings (Fig. 8F, 8G).

The application of gene therapy as a potential treatment for cancer has spurred the development of various polymer nanocarriers. The aim is to enhance non-viral vectors as safe and efficient agents for gene transfer. Among these, the PEI nanocarrier, recognized as a benchmark for polymeric vectors, demonstrates notable gene transfer efficiency in serum-free and in vitro conditions. Nevertheless, challenges arise under serum-supplemented conditions that mimic the in vivo environment. Specifically, PEI/DNA polyplexes tend to aggregate with serum proteins, leading to a reduction in overall transfection efficiency [31].

The approaches employed to enhance transfection efficiency and improve the physicochemical characteristics of PEI nanocarriers encompass the conjugation of PEI with diverse polymers, incorporation of distinct chemical moieties, and the integration of targeting components. For instance, the coupling of polyethylene glycol (PEG) or a stealth polymer, along with more complex chemical groups, establishes a charge protection layer within PEI/DNA polyplexes [32]. This layer serves to mitigate the excess positive charge of the polycation, preventing nonspecific binding to other proteins. Nevertheless, while these chemical modifications can alleviate polymer toxicity and mitigate interactions with nonspecific proteins, they may concurrently diminish the efficacy of DNA transfer into the cell by reducing its buffering capacity. Hence, the modifications contribute to enhanced gene transfer efficiency, reduced cytotoxicity, improved stability, and tunable properties were explored to make modified PEI a promising candidate for advancing gene therapy applications [33].

One approach involves attaching anionic components to PEI to reduce the cationic charge density of polyplexes, thereby mitigating cytotoxicity. The utilization of succinic anhydride as a surface modification agent for this polymer can alter its surface characteristics. Following the surface modification of PEI with succinic anhydride, carboxylic groups are introduced to the polymer surface. These carboxylic groups induce various alterations, encompassing changes in contact angle, hydrophobic properties, dispersibility, and the capacity to modify and enhance the electrical charge of the polymer [23]. The modification degree of Succinylated PEI (SPEI) can be adjusted by varying the quantity of succinic anhydride employed during the modification process, which is ranges from 9 to 55% of modified amines. This variability can result in distinct levels of modification, impacting the properties of the resulting SPEI polymer. Notably, SPEI-9, denoting SPEI with a low degree of succinylation (approximately 9% by polymer weight), usually yields lower charge density. Despite a relatively modest reduction in toxicity, it demonstrates higher gene transfer efficiency compared to unmodified PEI. Due to its efficient DNA condensation and protective attributes against degradation, SPEI-9 emerges as a promising and optimal gene delivery vector [23, 31]. In this regard, in a study conducted by Warriner et al., it was demonstrated that modifying the PEI polymer with varying degrees of succinyl groups diminishes the strength of electrostatic interactions between the plasmid and the polymer. Conversely, as the degree of succinylation increases, nonspecific interactions between the polymer and serum proteins decrease, allowing more polymer to be utilized for efficient DNA loading [31].

Additionally, the resultant SPEI-9 polyplex exhibited a size of approximately 150 nm, falling within the optimum range for endocytosis without receptor mediation [34]. It has been observed that the increase in the size of SPEI-based nanocarriers, corresponding to an escalation in the degree of succinylation (ranging from 9, the lowest, to 55, the highest), is primarily attributed to the reduction of electrostatic interactions produced by the polyplex with lower density, resulting in a larger nanocarrier. Moreover, the ζ potential of the polyplexes remained positive, albeit experiencing a slight decrease attributable to succinylation [31].

It is also possible that the end groups of carboxyl succinate may induce a hydration layer, providing protection to the nanocarrier against serum proteins. However, similar to PEG derivatives, an elevation in the degree of succinylation (45 or 55 degrees) may lead to diminished interactions, stemming either from electrostatic repulsion or physical shielding through hydrated branches. This, in turn, could enhance the polymer's potential to cause damage to the cell membrane, ultimately associated with a decrease in effective gene transfer [31, 35]. Therefore, considering that SPEI with lower degrees of succinylation offers both lower cytotoxicity and more effective gene transfer, and, in contrast, higher degrees of succinylation lead to increased interactions with serum proteins, the current study opted for the minimum degree of succinylation, 9%, on branched PEI. This choice was made to reduce cytotoxic effects and enhance the efficiency of gene transfer.

Given that prior investigations on PEI succinylation primarily employed 2 kDa linear PEI, this study stands out by conducting comprehensive structural and functional analyses on the SPEI-9 nanocarrier based on 25 kDa nanocarrier, yielding novel and promising outcomes. The results obtained from structural confirmation, utilizing FT-IR and H-NMR for the SPEI-9 nanocarrier, align with the findings presented in studies conducted by Zaaeri et al. [36] and Warriner et al.[31].

Furthermore, concerning the efficient loading of genetic material and the protective capability of the SPEI-9 nanocarrier against degradation by DNase enzyme, the findings align with the broader outcomes of the study conducted by Nouri et al. Specifically, their study focused on a succinic anhydride group-conjugated nanocarrier (PEI-SUC-PEI) with determined structural and functional characteristics. Nouri et al. demonstrated that this nanocarrier exhibited superior buffering resistance compared to both PEI-SUC and the base PEI. Interestingly, the loading efficiency and resistance to genetic structure degradation by DNase were nearly identical between PEI-SUC-PEI and PEI-SUC. Notably, the study's results indicated that the PEI-SUC-PEI nanocarrier, benefiting from the presence of two PEI groups, facilitated more effective gene transfer at higher C/P ratios compared to other groups [37].

In addition, Zintchenko et al. conducted a foundational study in 2008 where the PEI nanocarrier underwent modification with various functional groups, including ethyl acrylate (PEI-EA), acetyl (PEI-AC), succinyl (PEI-SUC), and propionic acid (PEI-PROP). These modifications were applied with varying degrees to assess siRNA transfer efficiency and cytotoxicity in HuH-7 hepatoma cells. The results regarding cell viability demonstrated a proportional increase in cytotoxicity with the escalation of modification degree for all four PEI groups. Notably, the cytotoxicity of PEI-SUC and PEI-PROP nanocarriers was significantly lower than the others. Furthermore, to evaluate the efficacy of siRNA transfer, polymers from each group were examined at different C/P ratios (ranging from 0.5 to 8). Interestingly, among all the polymers tested, PEI-PROP-18 (C/P ratio 8), PEI-EA-31 (C/P ratios 6 and 8), and PEI-SUC-9 (C/P ratios 4, 6, and 8) exhibited the most potent silencing effects of siRNA. Among these, PEI-SUC-9 demonstrated the highest efficiency, highlighting its remarkable capability for effective gene transfer. Considering the cumulative evidence, the nanocarrier based on succinylated PEI with the lowest modification degree, 9%, emerges as the optimal choice for gene transfer due to its minimal cytotoxicity and maximal gene transfer efficiency [23].

Guanylyl cyclase C (GC-C) is a transmembrane receptor prominently expressed apically in intestinal crypts and villus cells [9]. The GC-C signaling pathway has emerged as a promising therapeutic target for widespread gastrointestinal disorders, including irritable bowel syndrome with constipation (IBS-C), chronic idiopathic constipation (CIC), and inflammatory bowel disease (IBD) [9, 38]. Specifically, GC-C activation is facilitated by intracellular hormonal ligands, uroguanylin and guanylin predominantly expressed in the small intestine and large intestine, respectively. These hormones activate GC-C, setting off a cascade of downstream signaling pathways. These pathways play a pivotal role in regulating fluid and electrolyte homeostasis, maintaining the integrity of the intestinal epithelium, and influencing tumorigenesis [39].

Inactivating mutations in APC are linked to 80% of CRC tumors [40] and are also prevalent in other gastrointestinal cancers like gastric cancer [41]. In this subtype of CRCs, the loss of function in both APC alleles is a crucial step in tumor initiation. The inability of APC to regulate the stability of β-catenin protein results in uncontrolled β-catenin nuclear signaling, leading to the activation of oncogenic genes [40]. Although the APC/β-catenin signaling pathway is an appealing target for gastrointestinal cancers, achieving therapeutic effects with drug interventions targeting these molecules proves to be challenging [39].

Remarkably, the connection between the GC-C signaling pathway and CRC was initially revealed through population studies, highlighting an inverse relationship between CRC prevalence and enterotoxigenic Escherichia coli (ETEC) infections [42]. ETEC infections involve heat-stable enterotoxins that produce STs, ultimately activating the GC-C signaling pathway and causing diarrhea [39]. Additionally, the GC-C signaling pathway is implicated in CRC through the depletion of intracellular ligands, guanylin and uroguanylin. In a study encompassing around 300 tumors and their corresponding adjacent normal tissues, guanylin mRNA exhibited a loss of expression in over 85% of tumors compared to the corresponding normal epithelium [16]. Notably, recent observations in mice suggest that the loss of guanylin is a direct downstream consequence of mutant APC/β-catenin signaling [15]. Furthermore, the loss of APC heterozygosity (loss of two alleles) is pivotal for the loss of guanylin hormone expression [7]. Consequently, these findings highlight that the GUCY2C signaling pathway, mediated by guanylin and uroguanylin hormones, may be directly associated with APC/β-catenin mutant signaling in CRC tumorigenesis. Thus, investigating the gain of function of these two hormones holds promise for advancing CRC treatment, representing the primary objective of this study.

Furthermore, based on our prior study involving an integrative transcriptome analysis, we identified the peptide hormone guanylin as the primary therapeutic target for gain of function studies [43]. Subsequently, guanylin was amplified and cloned into gene constructs containing CMV and MUC1 promoters. Conversely, considering the synthesis and characterization of the SPEI-9 nanocarrier as an efficient and safe gene delivery agent for gene constructs, diverse cell culture studies were conducted to assess the anti-tumor effects of this therapeutic system.

Initially, to validate the transfection efficiency, the SPEI-9 nanocarrier, with a C/P ratio of 4 and loaded with pCMV-GUCA2A and pMUC1-GUCA2A gene constructs, was applied to HCT-116 cancer cells and normal Vero cells. The optimal transfection period of 72 h was chosen to induce maximal peptide hormone expression within the cells. The results of the transfection process, as indicated by GUCA2A mRNA expression levels, revealed that the pCMV-GUCA2A gene construct exhibited significantly higher expression with lower specificity compared to the construct containing the MUC1-specific promoter. It can be inferred that the efficacy of the MUC1 promoter is contingent on its tissue-specific expression in the relevant cancer. For instance, in a study by Farokhimanesh et al., the PEI nanocarrier loaded with a gene construct containing the MUC1 promoter and encoding the pro-apoptotic gene truncated BID (tBid) demonstrated specific and elevated expression in breast cancer in contrast to the construct with the CMV promoter. Their findings suggested that this heightened and specific expression could potentially induce apoptosis in breast cancer cells (MCF7, T47D, and SKBR3) with minimal impact on normal AGO skin fibroblast cells. Moreover, the induction of expression through the specific MUC1 promoter in the CRC cell line HT-29 exhibited a notable increase, albeit less pronounced than in breast cancer cell lines. Considering that the expression of MUC1 in this cell line differs from HCT-116, it holds more potential for inducing expression [22]. However, according to diverse investigations, HCT-116 cells are identified as non-differentiated and highly aggressive, with a p53 mutation occurring in the advanced stages of cancer. These cells exhibit low expression of MUC1. In contrast, HT-29 cells are recognized as more differentiated and less aggressive cell lines with mutations in APC observed in the early stages of cancer. Additionally, HT-29 cells have the capability to differentiate into enterocytes and MUC1-expressing cells [44, 45]. Conversely, given the markedly reduced or absent expression of the guanylin hormone in the progression of CRC and the demonstrated enhanced therapeutic effects in advanced disease stages, the HCT-116 cell line was selected as a tumor model. As a counterpart, the Vero cell line, characterized by very low MUC1 expression, was chosen as a normal model (177).

In addition to assessing the specific induction effects of the MUC1 promoter, we explored the impact of this stimulus using the HRE upstream of the promoter. Recognizing that prolonged exposure to hypoxia can inhibit apoptosis through therapeutic interventions, a treatment duration of 16 h was chosen based on literature findings. This short period yielded favorable results in terms of expression, as evaluated by RT-qPCR. However, it's important to note that this aspect remained focused on the measurement of expression levels, with the primary emphasis of the study directed towards investigating the therapeutic effects of the promoters, GUCA2A gene, and the SPEI-9 nanocarrier [22, 46, 47].

In alignment with the signaling pathways associated with the guanylin hormone, this study focused on the expression of β-catenin and p21 genes as direct components engaged in the downstream pathway. Additionally, to explore the impact on apoptosis induction and the inhibition of cell migration pathways, measurements were conducted on BAX/BCL-2, Cadherin 2, and Vimentin genes. The results demonstrated that elevating guanylin expression, facilitated by both gene constructs, led to suppressed apoptosis induction and diminished expression of genes associated with cell migration pathways.

Notably, in the group treated with the gene construct featuring the specific MUC1 promoter, there was a quantitative increase in tumor suppressor genes and a decrease in oncogene expression, as observed in the normal Vero cell group. These outcomes signify a specific expression pattern. In this context, Basu et al.'s study yielded interesting findings. In Gucy2c^+/+ model mice, where the guanylate cyclase C pathway was activated, treatment with bacterial heat-resistant enterotoxin (ST) led to potent antitumor effects. This activation positively regulated the expression of p21 and p38 MAPK genes, culminating in a significant reduction in formed colonies. Notably, these effects were absent in the Gucy2c^−/− mouse model, underscoring the critical role of the combined GC-C/cGMP signaling pathway in colorectal carcinogenesis [48].

Considering the dual regulation (up- and down-regulation) of genes involved in diverse carcinogenic pathways upon increased guanylin hormone function, its potential therapeutic effects were systematically assessed through various assays. Notably, tests focusing on cytotoxicity and apoptosis induction revealed a significant augmentation in both parameters in HCT-116 cancer cells in groups containing both CMV and MUC1 promoters, correlating with elevated guanylin hormone function. However, distinctive patterns were observed between the two promoters. The induction of guanylin hormone by the CMV promoter exhibited stronger inhibitory effects on cytotoxicity and apoptosis induction, indicating robust but less specific impacts. Conversely, the induction by the MUC1 promoter demonstrated slightly weaker effects but showcased greater specificity. In the Vero cell line, induction of the hormone from the CMV promoter displayed obvious inhibitory effects, an aspect that remains relatively unexplored in the current body of research.

Existing studies in this domain have predominantly centered on activating the GC-C pathway through bacterial ST. For instance, Li et al.'s 2017 study elucidated the effects of GC-C paracrine pathway activation via oral administration of bacterial ST in a mouse model of radiation-induced gastrointestinal syndrome and in different cancer cells. The outcomes highlighted the significant induction of apoptosis in CRC cells (HCT-116) upon GC-C activation by ST. Interestingly, these antitumor effects were contingent on the p53 pathway, as evidenced by their absence in the HCT-116 cell line with an altered phenotype of p53^int−/− (with biallelic loss of p53). Moreover, in mouse models of gastrointestinal syndrome, oral administration of bacterial ST manifested substantial reductions in disease symptoms and mortality rates, underscoring its potential therapeutic efficacy [49].

The comprehensive findings from these investigations highlight the pivotal role of the GC-C signaling pathway in leading the digestive system, encompassing both the small and large intestine. Disruption of this pathway, whether through alterations in the receptor itself or via exogenous ligands like guanylin and uroguanylin, can precipitate lethal effects on digestive system health. It's noteworthy that the bulk of existing research has predominantly focused on activating this pathway using chemical stimuli such as bacterial ST and analogous pharmaceutical agents. In contrast, the present study introduces a novel approach, evaluating the potential antitumor effects arising from the targeted induction of the guanylin hormone. Both specifically and universally, the outcomes of this study can be characterized as promising.

Acknowledgement

In memory of Prof. Massoud Saidijam, who is no longer with us, but continues to inspire his students over the course of his career. I also extend my deepest wishes to the people of IRAN. May the dawn of a new era bring forth the life that my resilient people truly deserve.

Funding

This work is supported by a grant from Hamadan University of Medical Sciences, Hamadan, Iran (No. 9907295351).

Availability of supporting data

All the data employed in this study are comprehensively presented within the article, and availability upon reasonable request from the corresponding author is ensured. The relevant datasets can also be accessed through direct web links: TCGA - https://www.cancer.gov/ ; GTEx - https://commonfund.nih.gov/GTEx/; GDC-https://gdc.cancer.gov/; cBioPortal-https://www.cbioportal.org/; DAVID-https://david.ncifcrf.gov/; TIMER2.0- http://timer.cistrome.org/; Smartapp-www.bioinfo-zs.com/smartapp/; TISDB- http://cis.hku.hk/TISIDB/index.php. Further inquiries are available from the corresponding author on reasonable request.

Ethical Approval and Consent to participate

All procedures were performed in accordance with the Declaration of Helsinki and approved by the ethics committee of the Hamadan university of medical sciences (IR.UMSHA.REC.1399.562). Informed consent was obtained from all subjects and or their legal guardians. Patient samples were collected from Poursina Hakim Research Institute (Esfahan, Iran).

Competing interests

The authors declare that there are no conflicts of interest.

Consent for publication

Not applicable.

Authors' information

Affiliations

Research Center for Molecular Medicine, Hamadan University of Medical Sciences, Hamadan, Iran

PS, AJ & RN

Department of Pharmaceutical Biotechnology, School of Pharmacy, Hamadan University of Medical Sciences, Hamadan, Iran

MS & FN

Department of Medical Biotechnology, Faculty of Medical Sciences, Tarbiat Modares University, Tehran, Iran

Student Research Committee, Hamadan University of Medical Sciences, Hamadan, Iran

Authors' contributions

PS designed the research, performed the experiments, analyzed the bioinformatics data and prepared the original draft. MS, FN and RN supervised the synthesis of nanocarrier, edited and revised the manuscript and evaluated the final data. FR prepared the HRE-pMUC1 plasmid, edited and revised the manuscript. AJ conceptualized the project, revised the manuscript, and providing final suggestions. All authors read and approved the final manuscript.

^* Correspondence:

Correspondence to Akram Jalali, Research Center for Molecular Medicine, Hamadan University of Medical Sciences, Hamadan, Iran. Email: [email protected]

Debela DT, Muzazu SG, Heraro KD, Ndalama MT, Mesele BW, Haile DC, Kitui SK, Manyazewal T. New approaches and procedures for cancer treatment: Current perspectives. SAGE open medicine. 2021;9:20503121211034366.
Katsila T, Spyroulias GA, Patrinos GP, Matsoukas M-T. Computational approaches in target identification and drug discovery. Comput Struct Biotechnol J. 2016;14:177–84.
Wang Y, Wang Z, Xu J, Li J, Li S, Zhang M, Yang D. Systematic identification of non-coding pharmacogenomic landscape in cancer. Nat Commun. 2018;9:3192.
Zhang Y, Chen F, Chandrashekar DS, Varambally S, Creighton CJ. Proteogenomic characterization of 2002 human cancers reveals pan-cancer molecular subtypes and associated pathways. Nat Commun. 2022;13:2669.
Chen F, Chandrashekar DS, Varambally S, Creighton CJ. Pan-cancer molecular subtypes revealed by mass-spectrometry-based proteomic characterization of more than 500 human cancers. Nat Commun. 2019;10:5679.
Vande Voorde J, Steven RT, Najumudeen AK, Ford CA, Dexter A, Gonzalez-Fernandez A, Nikula CJ, Xiang Y, Ford L, Maneta Stavrakaki S. Metabolic profiling stratifies colorectal cancer and reveals adenosylhomocysteinase as a therapeutic target. Nat Metabolism 2023:1–16.
Pattison AM, Barton JR, Entezari AA, Zalewski A, Rappaport JA, Snook AE, Waldman SA. Silencing the intestinal GUCY2C tumor suppressor axis requires APC loss of heterozygosity. Cancer Biol Ther. 2020;21:799–805.
Waldman SA, Camilleri M. Guanylate cyclase-C as a therapeutic target in gastrointestinal disorders. Gut. 2018;67:1543–52.
Kuhn M. Molecular physiology of membrane guanylyl cyclase receptors. Physiol Rev. 2016;96:751–804.
Pitari GM, Di Guglielmo M, Park J, Schulz S, Waldman SA. Guanylyl cyclase C agonists regulate progression through the cell cycle of human colon carcinoma cells. Proceedings of the National Academy of Sciences 2001, 98:7846–7851.
Lin JE, Li P, Snook AE, Schulz S, Dasgupta A, Hyslop TM, Gibbons AV, Marszlowicz G, Pitari GM, Waldman SA. The hormone receptor GUCY2C suppresses intestinal tumor formation by inhibiting AKT signaling. Gastroenterology. 2010;138:241–54.
Wang R, Kwon I-K, Thangaraju M, Singh N, Liu K, Jay P, Hofmann F, Ganapathy V, Browning DD. Type 2 cGMP-dependent protein kinase regulates proliferation and differentiation in the colonic mucosa. Am J Physiology-Gastrointestinal Liver Physiol. 2012;303:G209–19.
Steinbrecher KA, Tuohy TM, Goss KH, Scott MC, Witte DP, Groden J, Cohen MB. Expression of guanylin is downregulated in mouse and human intestinal adenomas. Biochem Biophys Res Commun. 2000;273:225–30.
Bashir B, Merlino DJ, Rappaport JA, Gnass E, Palazzo JP, Feng Y, Fearon ER, Snook AE, Waldman SA. Silencing the GUCA2A-GUCY2C tumor suppressor axis in CIN, serrated, and MSI colorectal neoplasia. Hum Pathol. 2019;87:103–14.
Blomain ES, Rappaport JA, Pattison AM, Bashir B, Caparosa E, Stem J, Snook AE, Waldman SA. APC-β-catenin-TCF signaling silences the intestinal guanylin-GUCY2C tumor suppressor axis. Cancer Biol Ther. 2020;21:441–51.
Wilson C, Lin JE, Li P, Snook AE, Gong J, Sato T, Liu C, Girondo MA, Rui H, Hyslop T. The paracrine hormone for the GUCY2C tumor suppressor, guanylin, is universally lost in colorectal cancer. Cancer Epidemiol Biomarkers Prev. 2014;23:2328–37.
Rappaport JA, Waldman SA. The guanylate cyclase C—cGMP signaling axis opposes intestinal epithelial injury and neoplasia. Front Oncol. 2018;8:299.
Wang Y, Sun S, Zhang Z, Shi D. Nanomaterials for cancer precision medicine. Adv Mater. 2018;30:1705660.
Montaño-Samaniego M, Bravo-Estupiñan DM, Méndez-Guerrero O, Alarcón-Hernández E, Ibáñez-Hernández M. Strategies for targeting gene therapy in cancer cells with tumor-specific promoters. Front Oncol. 2020;10:605380.
Pourjafar M, Samadi P, Saidijam M. MUC1 antibody-based therapeutics: The promise of cancer immunotherapy. Immunotherapy. 2020;12:1269–86.
Guo M, You C, Dou J. Role of transmembrane glycoprotein mucin 1 (MUC1) in various types of colorectal cancer and therapies: Current research status and updates. Biomed Pharmacother. 2018;107:1318–25.
Farokhimanesh S, Rahbarizadeh F, Rasaee MJ, Kamali A, Mashkani B. Hybrid promoters directed tBid gene expression to breast cancer cells by transcriptional targeting. Biotechnol Prog. 2010;26:505–11.
Zintchenko A, Philipp A, Dehshahri A, Wagner E. Simple modifications of branched PEI lead to highly efficient siRNA carriers with low toxicity. Bioconjug Chem. 2008;19:1448–55.
Ritchie ME, Phipson B, Wu D, Hu Y, Law CW, Shi W, Smyth GK. limma powers differential expression analyses for RNA-sequencing and microarray studies. Nucleic Acids Res. 2015;43:e47–7.
Robinson MD, McCarthy DJ, Smyth GK. edgeR: a Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics. 2010;26:139–40.
Kassambara A, Kosinski M, Biecek P, Fabian S. Package ‘survminer’. Drawing Survival Curves using ‘ggplot2’(R package version 03 1) 2017, 3.
Therneau TM, Lumley T. Package ‘survival’. R Top Doc. 2015;128:28–33.
Wickham H, Chang W, Wickham MH. Package ‘ggplot2’. Create elegant data visualisations using the grammar of graphics Version. 2016;2:1–189.
Hänzelmann S, Castelo R, Guinney J. GSVA: gene set variation analysis for microarray and RNA-seq data. BMC Bioinformatics. 2013;14:1–15.
Yang L, Wang C, Shu J, Feng H, He Y, Chen J, Shu J. Porcine epidemic diarrhea virus induces vero cell apoptosis via the p53-PUMA signaling pathway. Viruses. 2021;13:1218.
Warriner LW, Duke JR III, Pack DW, DeRouchey JE. Succinylated polyethylenimine derivatives greatly enhance polyplex serum stability and gene delivery in vitro. Biomacromolecules. 2018;19:4348–57.
Yang S, Wang Z, Ping Y, Miao Y, Xiao Y, Qu L, Zhang L, Hu Y, Wang J. PEG/PEI-functionalized single-walled carbon nanotubes as delivery carriers for doxorubicin: synthesis, characterization, and in vitro evaluation. Beilstein J Nanotechnol. 2020;11:1728–41.
Han X-M, Zheng K-W, Wang R-L, Yue S-F, Chen J, Zhao Z-W, Song F, Su Y, Ma Q. Functionalization and optimization-strategy of graphene oxide-based nanomaterials for gene and drug delivery. Am J Translational Res. 2020;12:1515.
Sheikhsaran F, Sadeghpour H, Khalvati B, Entezar-Almahdi E, Dehshahri A. Tetraiodothyroacetic acid-conjugated polyethylenimine for integrin receptor mediated delivery of the plasmid encoding IL-12 gene. Colloids Surf B Biointerfaces. 2017;150:426–36.
Stefani S, Sharma SK, Haag R, Servin P. Core-shell nanocarriers based on PEGylated hydrophobic hyperbranched polyesters. Eur Polymer J. 2016;80:158–68.
Zaaeri F, Khoobi M, Rouini M, Akbari Javar H. pH-responsive polymer in a core–shell magnetic structure as an efficient carrier for delivery of doxorubicin to tumor cells. Int J Polym Mater Polym Biomaterials. 2018;67:967–77.
Nouri F, Sadeghpour H, Heidari R, Dehshahri A. Preparation, characterization, and transfection efficiency of low molecular weight polyethylenimine-based nanoparticles for delivery of the plasmid encoding CD200 gene. Int J Nanomed 2017:5557–69.
Shailubhai K, Palejwala V, Arjunan KP, Saykhedkar S, Nefsky B, Foss JA, Comiskey S, Jacob GS, Plevy SE. Plecanatide and dolcanatide, novel guanylate cyclase-C agonists, ameliorate gastrointestinal inflammation in experimental models of murine colitis. World J Gastrointest Pharmacol Ther. 2015;6:213.
Entezari AA, Snook AE, Waldman SA. Guanylyl cyclase 2C (GUCY2C) in gastrointestinal cancers: recent innovations and therapeutic potential. Expert Opin Ther Targets. 2021;25:335–46.
Zhang L, Shay JW. Multiple roles of APC and its therapeutic implications in colorectal cancer. JNCI: J Natl Cancer Inst. 2017;109:djw332.
Clément G, Bosman FT, Fontolliet C, Benhattar J. Monoallelic methylation of the APC promoter is altered in normal gastric mucosa associated with neoplastic lesions. Cancer Res. 2004;64:6867–73.
Pitari G, Zingman L, Hodgson D, Alekseev A, Kazerounian S, Bienengraeber M, Hajnoczky G, Terzic A, Waldman S. Bacterial enterotoxins are associated with resistance to colon cancer. Proceedings of the National Academy of Sciences 2003, 100:2695–2699.
Samadi P, Soleimani M, Nouri F, Rahbarizadeh F, Najafi R, Jalali A. An integrative transcriptome analysis reveals potential predictive, prognostic biomarkers and therapeutic targets in colorectal cancer. BMC Cancer. 2022;22:1–22.
Szaryńska M, Olejniczak A, Kobiela J, Łaski D, Śledziński Z, Kmieć Z. Cancer stem cells as targets for DC-based immunotherapy of colorectal cancer. Sci Rep. 2018;8:12042.
Yeung TM, Gandhi SC, Wilding JL, Muschel R, Bodmer WF. Cancer stem cells from colorectal cancer-derived cell lines. Proceedings of the National Academy of Sciences 2010, 107:3722–3727.
Minassian LM, Cotechini T, Huitema E, Graham CH. Hypoxia-induced resistance to chemotherapy in cancer. Hypoxia and Cancer Metastasis 2019:123–39.
Peters MC, Maas RG, van Adrichem I, Doevendans PA, Mercola M, Šarić T, Buikema JW, van Mil A, Chamuleau SA, Sluijter JP. Metabolic maturation increases susceptibility to hypoxia-induced damage in human iPSC-derived cardiomyocytes. Stem Cells Translational Medicine. 2022;11:1040–51.
Basu N, Saha S, Khan I, Ramachandra SG, Visweswariah SS. Intestinal cell proliferation and senescence are regulated by receptor guanylyl cyclase C and p21. J Biol Chem. 2014;289:581–93.
Li P, Wuthrick E, Rappaport JA, Kraft C, Lin JE, Marszalowicz G, Snook AE, Zhan T, Hyslop TM, Waldman SA. GUCY2C signaling opposes the acute radiation-induced GI syndrome. Cancer Res. 2017;77:5095–106.

Table 1. Characteristics of primers and oligomers used in amplification and RT-qPCR.

Product size	Gene ID	Antisense strand	Sense strand	Gene
369 bp	2980	TTCTCTAGACTAGCATCCGGTACAGGCAG	ACGGGATCCGCCATGAATGCCTTCCTGCTCTCC	GUCA2A CDS for cloning
117 bp	2980	GGTTGCTACAGAGGATGG	TGGAGTCAGTGAAGAAGC	GUCA2A
248 bp	2597	GCGTCAAAGGTGGAGGAGTGG	AAGGCTGTGGGCAAGGTCATC	GAPDH
188 bp	7431	CGTTGATAACCTGTCCATC	CATTGAGATTGCCACCTAC	VIM
100 bp	1000	CCCACAATCCTGTCCACATC	ATTCGGGTAATCCTCCCAAATC	CDH2
138 bp	1026	AGTCGAAGTTCCATCCCTCA	ATGTCCGTCAGAACCCATGC	CDKN1A
98 bp	1499	CCTTCCATCCCTTCCTGTTTAG	CTTCACCTGACAGATCCAAGTC	CTNNB1
198 bp	581	TGTCCAGCCCATGATGGTTC	CAGAGGCGGGGGATGATTG	BAX
121 bp	596	GTCTACTTCCTCTGTGATGTTGTAT	TGGAGAGTGCTGAAGATTGA	BCL2

No competing interests reported.

Additionalfile1.jpg

Download PDF

Version 1

posted

You are reading this latest preprint version

Targeted Gene-Hormone Therapy of Colorectal Cancer with Guanylin Expressing Nano-system

Status:

Version 1

Abstract

Background

Materials and Methods

Results

Conclusion

Figures

Introduction

Materials and methods

Exploration of GUCA2A gene expression patterns

Assessing GUCA2A expression as a prognostic indicator in CRC

Relationship between GUCA2A expression and immunity

Mutation and methylation profile analysis

GSVA Analyses

Amplification of GUCA2A coding sequence

Construction of the guanylin expressing vectors

Synthesis and structural characterization of SPEI-9

Buffering capacity of PEI and SPEI-9 nanocarriers

Preparation and loading efficiency of PEI and SPEI-9 polyplexes

DNase degradation assay

Measurements of the size and zeta potential of the polyplexes

Hemolysis test of polyplexes

Protein Interaction

Transfection efficiency of nanocarriers

Assessment of mRNA expression levels for guanylin and downstream genes

Evaluation of guanylin expression changes following hypoxia treatment

Cell toxicity experiments

Annexin V-PI flow cytometry

In vitro scratch assay

Colony formation assays

Statistical analysis

Results

Construction of guanylin expressing constructs

Structural confirmation of SPEI-9 nanocarrier

Measuring buffering capacity of SPEI-9 nanocarrier

Measuring the gel retardation by SPEI-9 nanocarrier

DNase protection analysis of SPEI-9

Measuring the size and surface charge of SPEI-9 nanocarrier

Measuring the effect of SPEI-9 nanocarrier on hemolysis rate

Interaction assay of SPEI-9 nanocarrier with BSA protein

Cytotoxicity assay of SPEI-9 nanocarrier

Transfection efficiency assay by SPEI-9 nanocarrier

Cell culture study design

Evaluation of gene expression changes

Evaluation of cytotoxicity upon guanylin gain of function

Evaluation of apoptosis induction upon guanylin expressing nano-system

Evaluation of cell migration ability

Discussion

Conclusion

Declarations

References

Tables

Additional Declarations

Supplementary Files

Status:

Version 1