Transcriptomic Alterations in the Hippocampus and Prefrontal Cortex of Chronic Unpredictable Stress Rats Induced by Low-Intensity Pulsed Ultrasound.

doi:10.21203/rs.3.rs-3775894/v1

Download PDF

Research Article

Transcriptomic Alterations in the Hippocampus and Prefrontal Cortex of Chronic Unpredictable Stress Rats Induced by Low-Intensity Pulsed Ultrasound.

https://doi.org/10.21203/rs.3.rs-3775894/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Neuromodulation techniques have shown promise in the treatment of depression. In our previous study, we demonstrated that low-intensity pulsed ultrasound stimulation (LIPUS), a novel noninvasive neuromodulation tool, effectively ameliorated depression-like behaviors in a rat model of depression. However, the underlying mechanisms of its therapeutic effect remain unclear. The present study aims to elucidate the relevant mechanisms through transcriptomic research. To induce depression-like phenotypes, rats were subjected to chronic unpredictable stress (CUS) for six weeks. Throughout these six weeks, LIPUS was administered daily to the CUS rats, utilizing a pulse repetition frequency of 200 Hz. The transcriptome expression profiles in the hippocampus and prefrontal cortex (PFC) were subsequently analyzed by RNA sequencing techniques. We found that the CUS rats exhibited 3,464 differentially expressed genes (DEGs) in the hippocampus and 1,781 DEGs in the PFC when compared to the control group. Ultrasound stimulation was able to reverse the expression of 592 genes in the hippocampus and 254 genes in the PFC. Functional analysis revealed a significant enrichment of DEGs related to oxygen carrier activity and sugar metabolism. Subsequently, the alterations in the top ten genes were validated using real-time quantitative polymerase chain reaction. The significant changes in the expression of hemoglobin subunit beta, growth hormone 1, and glucokinase were confirmed. The results suggest that LIPUS may ameliorate depression-related manifestations by regulating cerebral oxygenation and sugar metabolism processes in the brain.

depression

low-intensity pulsed ultrasound

transcriptome

hippocampus

cortex

According to the China Mental Health Survey, the weighted lifetime prevalence of depressive disorders was found to be 8.0% in females and 5.7% in males [1]. While the precise etiology of depression remains unclear, it is widely recognized that a combination of environmental and genetic factors contribute to its development. Recent studies have highlighted the role of environmental factors, such as stress, in influencing gene expression through epigenetic mechanisms including DNA methylation, histone modification, and micro-RNA expression, thereby playing a significant role in the pathogenesis of depression [2, 3].

Antidepressants are the most commonly used treatment in clinical practice and have demonstrated significant improvement in depressive disorders. However, their delayed onset of action and the occurrence of various distressing side effects, such as headache, insomnia, nausea, and weight changes, have limited their utility [4, 5]. For example, the first-line pharmaceuticals typically require 4 ~ 6 weeks or even longer to take effect [6]. Additionally, more than 30% of patients do not respond to antidepressant therapy, placing a substantial burden both on families and society. Therefore, we need to continue the search for alternative effective therapies.

Neuromodulation therapy serves as an adjunct therapeutic approach for neuropsychiatric disorders. Among various neuromodulation techniques, ultrasound stimulation has emerged as a promising strategy for treating central nervous system diseases due to its high efficiency, non-invasiveness, and favorable side effect profile [7, 8]. Furthermore, accumulating evidence supports the effectiveness of ultrasound stimulation as a therapeutic intervention for depression. For instance, a study by Kim et al demonstrated a reduction in depression and anxiety symptoms in patients with refractory obsessive-compulsive disorder following ultrasound stimulation [9]. Additionally, animal experiments have shown that ultrasound stimulation significantly improves depressive-like behaviors in rat models of depression, as evidenced by an increased sucrose preference index in the sucrose preference test and reduced immobility time in the forced swimming test [10].

In our previous studies, we established that low-intensity pulsed ultrasound stimulation (LIPUS) effectively alleviated depressive symptoms in rats subjected to chronic unpredictable stress (CUS) [11]. Importantly, we observed no evidence of micro-hemorrhage, edema, necrosis, or inflammation following LIPUS treatment. While we provided evidence linking the antidepressant effects of LIPUS to the mammalian target of rapamycin (mTOR) signaling pathway, the limited exploration of the underlying mechanisms hampers the clinical utility of LIPUS.

Therefore, the objective of this study is to investigate the changes in the transcriptome profile induced by ultrasound stimulation and explore the molecular mechanisms underlying the effects of LIPUS. We aimed to assess RNA expression in the hippocampus and prefrontal cortex (PFC), validate the differentially expressed genes through quantitative PCR (qPCR) analysis, and elucidate the effect of ultrasound stimulation on gene expression. Finally, we sought to identify the pathways involved in mediating the effects of ultrasound stimulation.

2.1 Animal experiment

The samples utilized in this experiment comprised the remaining right hippocampus and prefrontal cortex obtained from animals employed in a previously published study [11]. Our previous study identified the appropriate stimulus parameter as 200HZ, which significantly reduced immobility time in forced swimming test (FST) and increased the number of c-Fos-positive cells in ventromedial PFC. The experimental animal conditions, the method for establishing the depression model through chronic unpredictable stress, the LIPUS parameters, and the sample collection methods were consistent with the details outlined in that previous publication. The experimental schedule is as follows: after 1 week of adaptation, the control group were fed normally in pairs. Rats in the CUS group were housed in individual cages and subjected to one or two of fourteen randomly selected different stressors per day for six consecutive weeks. After completion of the CUS exposure, each rat was fixed with an ultrasound collimator on the skull and was allowed 1 week to recover from surgery. Normal control rats had holes drilled into the skull, but the collimator was not affixed. Then, ultrasound stimulation was applied to awake and freely moving rats in the CUS + LIPUS group, for twenty minutes each day for four consecutive weeks. Rats in the control and CUS + sham LIPUS groups underwent the same procedures, but the power was turned off. Behavioral tests were conducted immediately after LIPUS. After that, rats were sacrificed by intraperitoneal injection of pentobarbital sodium 150mg/kg, and their brains were removed for morphological and biochemical experiments (Fig. 1A).

2.2 Experimental Animals

A total of thirty 6 ~ 8-week-old male Sprague-Dawley rats (150-180g), provided by Beijing Vital River Laboratory Animal Technology Co., Ltd. were housed at a controlled ambient temperature of 23 ± 2 ℃, 50 ± 10% relative humidity under a 12-h light-dark cycle with free access to food and water. The protocol was approved by the Animal Use and Care Committee at Capital Medical University (AEEI-2018-003). All efforts were made to minimize animal suffering.

2.3 CUS procedures

All the rats were stratified randomly divided into control (n = 8) and CUS group (n = 22) based on the sucrose performance index and housed separately. The control group rats were pair-housed in cages with ad libitum access to food and water, except during performance tests. The CUS group rats were individually housed and subjected to 1 ~ 2 stressors per day over six weeks. The stressors including 36 V electric foot-shock, forced swimming in cold water (4 ℃) or hot water (45 ℃), immobilization, water and food deprivation, tail clamp, wet bedding, no padding, soiled cage, cage titling at 45°, 85 dB noise, continuous illumination and stroboscopic illumination. At the conclusion of the 6-week CUS procedure, 16 depression rat models were established successfully, defined by the significantly reduced body weight and sucrose preference indices (SPI) comparing with control group rats. And the 16 models were redistributed into CUS and LIPUS group based on the SPI, which was calculated as follow: sucrose consumption (g)/total fluid consumption (g) × 100%.

2.4 Low-intensity pulsed ultrasound

Rats in the LIPUS group underwent surgical procedures to affix a collimator with drilled holes in the skull. LIPUS was transduced by a home-made wearable transducer (frequency: 800 kHz), made by 1–3 PZT-5H/epoxy composite, epoxy backing, and Parylene layer. A polymethyl methacrylatecollimator was fabricated to fix the transducer onto the target region of the rat skull. The total length of the collimator was approximately 9 mm from the face of the transducer to the end of the collimator, with an upper internal diameter of 14 mm. At 4 mm from the face of the transducer, there was a step in the collimator, and the diameter at the end of the collimator was 8 mm. During ultrasound stimulation, the transducer would be connected to the collimator. The collimator was filled with deionized, degassed water, to ensure successful delivery of ultrasound energy into the brain. The parameters of LIPUS were applied with 200 Hz pulse repetition frequency, 4% duty cycle, 0.2 ms tone burst duration, 1 second sonication duration, and 3 seconds inter-stimulus interval.

2.5 Behavioral tests

In novelty suppressed feeding test (NSFT), the animals had been fasted for 24 hours before the experiment. An open field (100×100×40cm) was used in novelty suppressed feeding test. Place blocks of rat chow in the center and gently place the rat, facing outward, in the corner of the box. The whole procedure was video-recorded. To some extent, the latency time before rats’head goes into the middle cell and it begins to bite the food reflects the degree of anxiety/depression in rats.

Light-dark transition test (LDT) is based on the innate aversion of rodents to the brightly illuminated and open areas. Dark box hasthe top cover and the light box are open and illuminated. There is ahole between the two boxes for animals to pass through.The rat were gently put into the light box and allowed to move freely in the dark and light box. The first shuttle latency time and the number of times shuttle throught the partition hole within 5 minutes were recorded.

2.6 Clustering and sequencing

For index-coded sample clustering, a cBot Cluster Generation System with the TruSeq PE Cluster Kit v3-cBot-HS (Illumia) was employed by following the manufacturer’s instructions. After cluster generation, library preparations were sequenced on an Illumina Novaseq platform, generating 150 bp paired-end reads. To quantify gene expression, Feature Counts vl.5.0-p3 was utilized to count the number of reads numbers mapped to each gene. Subsequently, the FPKM (Fragments Per Kilobase of transcript per Million mapped reads) value for each gene was calculated, considering both the gene length and the count of reads mapped to the gene. FPKM is a commonly used method for estimating gene expression levels as it accounts for sequencing depth and gene length simultaneously. To determine differential expression, the DESeq2package (v1.16.1) was utilized. DESeq2 employs a statistical model based on the negative binomial distribution to analyze digital gene expression. The resulting p-values were adjusted using the Benjamini and Hochberg approach to control the false discovery rate. Genes with an adjusted p value < 0.05, as determined by DESeq2, were designated as differentially expressed.

2.7 Real-time reverse transcription polymerase chain reaction (RT-PCR)

RNA was isolated from tissues using TRIzol reagent (Takara, Dalian, China), followed by DNase I treatment. Subsequently, 1 µg of total RNA from each sample was reverse transcribed into cDNA using reverse-transcription enzymes (Takara 6210A, Dalian, China). The primer sequences used in the Quantitative real-time PCR (qRT-PCR) analysis are shown in Table 1. The qRT-PCR reactions were conducted using SYBR Premix Ex Taq (Takara) and an ABI StepOnePlus Real-Time PCR instrument. Briefly, each 20 µL qRT-PCR reaction contained 0.2 µg of cDNA, 10 µL of 2× SYBR reaction mix, and 0.4 µM of the appropriate primers. The thermocycler settings were as follows: initial denaturation at 95°C for 30 s, followed by 40 cycles of denaturation at 95°C for 10 s and annealing/extension at 60°C for 30 s.

Table 1

Sequences of the utilized primers
Gene	Sequence
β-actin F	GGAGATTACTGCCCTGGCTCCTAGC
β-actinR	GGCCGGACTCATCGTACTCCTGCTT
hemoglobin beta F	GCACCTGACTGATGCTGA
hemoglobin beta R	TCCAAGGGTAGACAACCAG
ATP synthase peripheral stalk-membrane subunit b F	TCAACAGGGAGAAGGCACA
ATP synthase peripheral stalk-membrane subunit bR	ATGGTAGTCCAGGCGATT
beta-globin F	GATGCTGAGAAGGCTACTGT
beta-globinR	TGATAGCAGAGGCAGAGGA
hemoglobin alpha F	GTGGTGAATATGGCGAGGA
hemoglobin alphaR	TCTTGCCGTGAGCCTTGA
growth hormone 1 F	AATGCCCAGGCTGCGTTCT
growth hormone 1 R	GATGAGCAGCAGCGAGAA
Pgk1 phosphoglycerate kinase 1 F	TGGAACGGTCCTGTTGGG
Pgk1 phosphoglycerate kinase 1 R	CAGCAAGTGGCGGTGTCT
Gck glucokinase F	GATGAAAGCTCAGCGAACC
Gck glucokinase R	CCACTTGTGACACGAAACG
claudin 2 F	AGCGAACAGGTTCCGAAGA
claudin 2 R	GCTGGCACCAACATAAGA
Occludin F	TGCTGGTTGCTGGAGAAG
Occludin R	GAGACAGGAAACGGATGG

2.8 Statistical analysis

Three independent biological replicates were evaluated for each sample. The relative gene expression was determined using the 2-ΔΔCt approach, with β-actin serving as the normalization control. Statistical analysis for determining group differences was performed using GraphPad prism 7 software by one-way analysis of variance (ANOVA) tool. Statistical significance is indicated by asterisks (*P < 0.05, **P < 0.01). Figures show the means and the error bars indicate the SEMs.

3.1 LIPUS ameliorates depression-like behaviors in CUS rats.

Based on previous works, LIPUS significantly reduced the state of anhedonia, which mainly reflected by significantly increasing percentage of sucrose water intake of CUS rats with LIPUS. Such improvement also shown in FST that LIPUS rats experienced less immobility time than CUS, but no difference was found in open field test, the result has been published in our previous article[11]. Further, we added two behavioral experiments to verify the effect of LIPUS for depression. In NSFT, there was no statistical difference in the latency time of animals' head exploration of food in the area, but the latency time of animals' beginning to bite food in CUS group was significantly longer than that in control and LIPUS (Fig. 1B, C). The Light /dark box evaluated rodent anxiety by recording the number of shuttle times. Our results showed that after the first day of box adaptation and shuttle leading, the latency time of the CUS group was significantly longer than that of the LIPUS and the control group during the second day. And the number of shuttle times was the LIPUS group, the control group and the CUS group in descending order, even without statistical difference (Fig. 1D, E). Together, these results suggested that the LIPUS in the current study was successfully induced antidepressant-like effects.

3.2 LIPUS and CUS altered the hippocampus and prefrontal cortex transcriptome profile

Previously published work indicated that LIPUS effectively mitigated anhedonia in CUS rats, as evidenced by increased sucrose consumption in the sucrose preference test and reduced immobility time in FST. In this study, we tested the mRNA expression profiles in the PFCs and hippocampus, two brain regions that are closely associated with depression, in control, CUS, and LIPUS-treated rats. The number of differentially expressed genes (DEGs) among the groups is shown in Table 2.

Table 2

Statistics of the differentially expressed genes
Comparisons	Hippocampus		Prefrontal cortex
Comparisons	Up	Down	Up	Down
Ctrl vs. CUS	1805	1659	923	858
Ctrl vs. LIPUS	1583	1304	1466	1482
CUS vs. LIPUS	897	700	1029	1081

Ctrl, control group; CUS, chronic unpredictable stress group; LIPUS, low-intensity pulsed ultrasound group.

In the hippocampus, the CUS group exhibited 3,464 DEGs, including 1,805 up-regulated and 1,659 down-regulated genes (Fig. 2A), when compared to the control group. Following ultrasound stimulation, we observed significant differential expression of 1,597 genes in the LIPUS group relative to CUS rats, comprising 897 up-regulated and 700 down-regulated genes (Fig. 2B). In the PFC, we identified 1,781 DEGs in the comparison between the CUS and control groups (Fig. 2C). Similarly, in the comparison between the LIPUS and CUS groups, 2,110 DEGs were identified (Fig. 2D). Among the DEGs, 923 genes were up-regulated and 858 were down-regulated in the CUS group, while in the LIPUS group, 1,029 genes were up-regulated and 1,081 were down-regulated. Venn diagrams show the overlaps of regulated genes (Fig. 2E, F). Notably, in the hippocampus, ultrasound stimulation reversed the expression of 592 genes, with 359 being up-regulated and 233 being down-regulated in the LIPUS groups. Similarly, in the PFC, ultrasound stimulation reversed the expression of 254 genes in the CUS group, of which 118 were up-regulated and 136 were down-regulated (Table 3).

Table 3

Statistics of the gene changes induced by LIPUS, compared with CUS
Position	Down in CUS but up in LIPUS	Up in CUS but down in LIPUS
Hippocampus	359	233
Prefrontalcortex	136	118

Ctrl, control group; CUS, chronic unpredictable stress group; LIPUS, low-intensity pulsed ultrasound group.

3.3 Functional analysis of DEGs in LIPUS and CUS rats

To explore the functional changes induced by LIPUS, we performed pathway analysis using the identified DEGs. We utilized the Gene Ontology (GO) database, which classifies gene functions into three categories: biological process (BP), cellular component (CC), and molecular function (MF). Enriched GO terms with a p-adj < 0.05 were considered to be significantly enriched.

In the hippocampus, the down-regulated genes in the depressive model rats, compared to the control group, were primarily associated with catalytic activity, oxygen carrier activity, and cofactor binding in the MF category (Fig. 3A). Conversely, the up-regulated genes in the MF category were related to GTPase binding and protein binding. The differentially expressed mRNAs in the BP category were mainly involved in catabolic processes and regulation of neuron projection development. In terms of the CC category, the differentially expressed mRNAs were associated with nuclear speck and envelope (Fig. 3B). Following ultrasound stimulation, the LIPUS rats showed 897 up-regulated genes compared to the CUS group. In the BP category, the enriched genes were significantly associated with oxygen and gas transport. In the CC category, most of the genes were anchored components of the synaptic membrane and plasma membrane, while some were involved in oxygen carrier activity and oxygen binding in the MF category (Fig. 3D). Additionally, we analyzed the 700 down-regulated genes in the LIPUS group. According to the GO enrichment analysis, these genes were associated with various biological processes, including epithelial cell migration, ameboidal-type cell migration, tissue migration, and substrate adhesion-dependent cell spreading (Fig. 3C).

In the PFC, we analyzed the top ten enriched terms of down-regulated and up-regulated genes in the CUS and LIPUS groups (Fig. 3E, H). The down-regulated genes in the depressive model rats, compared to the control group, were primarily associated with organic anion transmembrane transporter activity and anion transmembrane transporter activity in the MF category. In terms of biological processes, these genes were involved in sterol metabolic process, sterol biosynthetic process, secondary alcohol biosynthetic process, and antigen processing and presentation in the BP category (Fig. 3E). Conversely, the up-regulated genes identified in the PFC were associated with protein folding, the establishment of protein localization to organelle, and response to the topologically incorrect protein in the BP category. In the MF category, these genes were involved in unfolded protein binding, heat shock protein binding, and in the CC category, they were associated with ribonucleoprotein granules (Fig. 3F).

After ultrasound stimulation, we observed 1,029 up-regulated genes and 1,081 down-regulated genes in the PFC. The down-regulated genes were associated with functions such as dendritic spine membrane, C₂H₂ zinc finger domain binding, metallopeptidase activity, cell adhesion molecular binding, and heart development, among others (Fig. 3G). On the other hand, the up-regulated genes were involved in defense response to other organisms, response to viruses, innate immune response, production of molecular mediators of the immune response, immunoglobulin production, double-stranded RNA binding, and others (Fig. 3H).

We utilized the Kyoto Encyclopedia Genes and Genomes (KEGG) database to analyze the enriched pathways with p-adj < 0.05. In the hippocampus, the CUS group exhibited several inhibited pathways compared to the control group, including amino sugar and nucleotide sugar metabolism, spliceosome, pentose phosphate pathway, and steroid biosynthesis (Fig. 4A). Conversely, several pathways were activated in the CUS group, including protein processing in endoplasmic reticulum, longevity regulating pathways (multiple species), the Forkhead box, class O signaling pathway, autophagy, longevity regulating pathway, and Rap1 signaling pathway (Fig. 4B). In the comparison between the LIPUS and CUS groups, ultrasound stimulation down-regulated several pathways in the hippocampus, including proteoglycans in cancer, transforming growth factor-𝛽 signaling pathway, mitogen-activated protein kinase (MAPK) signaling pathway, phosphoinositide 3-kinase-protein kinase B (PI3K-Akt) signaling pathway, focal adhesion, and amino sugar and nucleotide sugar metabolism (Fig. 4C). On the other hand, ultrasound stimulation activated pathways such as African trypanosomiasis, malaria, terpenoid backbone biosynthesis, leishmaniasis, circadian entrainment, and steroid biosynthesis (Fig. 4D).

In the PFC, the KEGG pathway analysis revealed that the CUS group exhibited inhibition of pathways such as steroid biosynthesis, Epstein-Barr virus infection, type1 diabetes mellitus, retinoic acid-inducible gene-1 (RIG-1)-like receptor signaling pathway, ATP binding cassette transporters, and Parkinson’s disease (Fig. 5A). The up-regulated genes in the CUS group were enriched in pathways including protein processing in the endoplasmic reticulum, antigen processing and presentation, mRNA surveillance pathway, RNA degradation, and circadian rhythm (Fig. 5B).

In comparison, ultrasound stimulation down-regulated pathways such as the MAPK signaling pathway, PI3K-Akt signaling pathway, and human papillomavirus infection in the PFC (Fig. 5C). Conversely, ultrasound stimulation activated pathways including the nucleotide oligomerization domain (NOD)-like receptor signaling pathway, Herpes simplex virus 1 infection, Epstein-Barr virus infection, Kaposi sarcoma-associated herpesvirus infection, Hepatitis C, and influenza A (Fig. 5D).

3.4 Identification of DEGs under LIPUS Treatment in the CUS model.

To confirm the results from RNA-sequencing, we performed qRT-PCR analysis on a selected set of ten RNAs. These genes were chosen based on the following criteria: 1. log₂ fold change > 1 or log₂ fold change < -1; 2. p-adj < 0.1; 3. reversal of gene expression by LIPUS treatment. The qRT-PCR results revealed that claudin2 (Cldn2), occludin (Ocln), growth hormone 1 (GH-1), glucokinase (GCK), and hypothetical protein LOC688459 exhibited high expression levels in the hippocampi of CUS rats, all of which were reversed after LIPUS treatment. Furthermore, LIPUS also reversed the reduced expression of hemoglobin subunit β (Hbb), ATP synthase peripheral stalk-membrane subunit b (ATP5BP), and hemoglobin subunit α (Hba) in CUS rats. No significant changes in the expression of phosphoglycerate kinase 1 (PGK1) were observed following CUS, but LIPUS down-regulated its expression (Fig. 6A).

In the PFC, the qPR-PCR analysis showed prominent reversals of gene expression by LIPUS on Hbb, 𝛽-globin, Hba, LOC688459, GH-1, PKG1, and GCK. Additionally, although the down-regulated expression of ATP5BP in the CUS group did not show a significant difference compared to the control group, LIPUS significantly improved its expression in the PFC. In contrast to the hippocampus, where Cldn2 and Ocln were down-regulated in the CUS group compared to the control group, the expression of these genes was further down-regulated by LIPUS in the PFC (Fig. 6B). Notably, LIPUS reversed the expression of Hbb, GH1, and GCK in both the hippocampus and PFC.

In our previous work, we demonstrated that LIPUS treatment on the ventral medial PFC effectively alleviated depressive-like behaviors in CUS model rats. In this study, we sought to unravel the underlying mechanisms by conducting a transcriptome analysis to investigate the changes induced by LIPUS at the molecular level. Interestingly, we observed significant differential expression of genes in response to ultrasound stimulation. In the hippocampus, 592 genes that were altered in the LIPUS vs CUS model group showed a reversal of expression after LIPUS treatment, out of a total of 1597 differentially expressed genes. Similarly, in the PFC, 254 genes out of 2110 differentially expressed genes in the CUS group were reversed by LIPUS. The functional analysis provided insights into the similarities and differences between the hippocampus and PFC in terms of the antidepressant effect of LIPUS. One common feature was the reversal of downregulated steroid biosynthesis caused by stress, which was observed in both brain regions. Enrichment analysis of the DEGs revealed that stress significantly reduced oxygen carrier activity in the hippocampus, which was reversed by LIPUS. Additionally, LIPUS down-regulated the adhesion function of endothelial cells in the hippocampus. In contrast, in the PFC, LIPUS significantly enhanced the immune response while reducing the adhesion function of endothelial cells.

The hippocampus and PFC are two limbic forebrain regions that play distinct roles in the depression process. The hippocampus, being highly susceptible to stress, serves as a central regulatory center for the HPA axis [12], while the PFC is responsible for integrating cognition and emotion [13]. Our findings in this study suggest that there are differences in the gene-level response to LIPUS between the hippocampus and PFC, indicating potential regional variations in the mechanisms underlying LIPUS-mediated alleviation of depression.

First, we observed that LIPUS treatment significantly enhanced the oxygen carrier activity in the hippocampus, which could contribute to its antidepressant effect. This finding aligns with the up-regulation of Hba and Hbb expression in the qRT-PCR analysis. Hba and Hbb are chains that, along with heme, form hemoglobin, which is crucial for oxygen transport in mammalian blood. Reduced peripheral hemoglobin levels have been associated with anemia, and several cross-sectional and longitudinal studies have established a link between anemia and depression [14, 15]. Furthermore, low hemoglobin levels have been correlated with fatigue and decreased brain energy [16], both of which are common symptoms in depressed individuals. However, the exact mechanism underlying this relationship is still not fully understood. It is hypothesized that the presence of anemia affects the function of the brain, an organ that consumes a significant amount of oxygen and energy.

In our study, we observed a decreased expression of Hba and Hbb in the hippocampus of CUS rats, which aligns with the abnormal peripheral hemoglobin trends observed in individuals with depression. Notably, LIPUS treatment significantly increased the expression of Hba and Hbb, nearly quadrupling their levels. These results not only confirm the therapeutic effect of LIPUS but also suggest a potential mechanism involving the promotion of hemoglobin production and subsequent improvement of cerebral oxygenation. It would be worthwhile to test whether the abnormal peripheral hemoglobin levels observed in animals subjected to LIPUS align with the changes in gene expression levels in the hippocampus.

Interestingly, in the PFC, we observed the opposite effect, where LIPUS down-regulated the expression of Hba and Hbb. This discrepancy could be attributed to the direct stimulation of the PFC by LIPUS, triggering compensatory mechanisms that lead to elevated hemoglobin subunits. These findings highlight the selective influence of stress on the hippocampus and PFC, resulting in differences in cerebral oxygenation between these two brain regions.

Second, we observed that LIPUS treatment down-regulated the adhesion function of endothelial cells in both the hippocampus and PFC, while up-regulating immune function specifically in the PFC. This suggests a contrasting effect of immune response induced by LIPUS between the two brain subregions. The tight junction proteins, Cldn2 and Ocln, are crucial components involved in tight junctions between endothelial cells, intercellular junctions, and the regulation of cell-cell contact and mucosal barrier function. The expression of these two substances typically reflects the adhesion function of endothelial cells, as shown in previous studies [17]. Although our qRT-PCR results showed noticeable down-regulation of Cldn2 and Ocln in both the hippocampus and PFC, their expression patterns in response to stress were opposite in these brain regions, further highlighting the brain area-specific changes in the response to stress. Abnormal immune function and inflammatory reactions are thought to play a prominent role in the progression of MDD [18]. However, our enrichment analysis revealed that LIPUS-induced reversal of increased immune function, observed in the CUS model, specifically occurred in the PFC but not in the hippocampus. This suggests potential differences in the sensitivity of different brain regions to inflammatory responses. While some studies have demonstrated consistent activation of glial cells and release of inflammatory factors in both brain regions, others have shown fewer changes in gene expression in the hippocampi compared to the mPFC following stress. For example, Posillico et al. found no significant effects or interactions of the reproductive state and/or stress on the expression of CD11b, IL-1β, IL-6, or BDNF in the hippocampus following either pregnancy or FST stress, in contrast to the mPFC [19] The differential effects of candidate drugs in alleviating depressive-like behavior by modulating cytokine release and neuroinflammation in specific brain regions may be attributed to the heterogeneity of glial cells in these specific brain subregions [20].

Third, we observed that DEGs induced by CUS were significantly enriched in the field of sugar metabolism and protein processing, which are known to have a profound impact on promoting stress-induced depression. However, the enrichment analysis of LIPUS-induced DEGs did not reveal their significance in these pathways. Accordingly, we selected several relevant genes for PCR verification to investigate whether LIPUS can meliorate depressive symptoms by modulating the disrupted function of sugar metabolism and protein processing. Our results demonstrated consistent changes in the levels of GH-1 and GCK in both brain regions. These genes were significantly up-regulated in the CUS group compared to the control group, but their expression was reversed after LIPUS treatment. GH-1, a peptide hormone that stimulates protein synthesis, plays a significant role in sleep, cognition, mood, and neuro-protective effects by binding to GH receptor − 1. It functions as a neurotrophic factor involved in synaptic function, neural survival, cell proliferation, and anti-oxidative stress [21]. GCK, on the other hand, catalyzes the conversion of glucose to glucose-6-phosphate, serving as the starting point of glycolysis. The consistent alteration of GCK in both the hippocampus and PFC suggests that glucose sensing and neural control of metabolism do not differ significantly between these brain regions, highlighting its crucial role in regulating glucose homeostasis in the brain. In contrast, the level of PKG-1, a key kinase in glycolysis, was only reversed by LIPUS in the PFC and not in the hippocampus. Abnormal levels of PKG1 are often associated with cancer, promoting cell metabolism and sugar metabolism [22]. These findings suggest that LIPUS may modulate the abnormal conditions in glucose metabolism and protein synthesis to achieve its antidepressant effect. Furthermore, the differential response of PKG1 suggests the presence of region-specific regulatory mechanisms within the brain.

Our published data has provided evidence that LIPUS significantly improves depression-related symptoms in rats subjected to stressors. Through the utilization of GO and KEGG analysis, and validation through qRT-PCR, we have identified LIPUS as an effective intervention for treating depression. This effect is achieved through the regulation of cerebral oxygenation, glycolipid metabolic processes, and immune function, ultimately promoting neural activity and exerting a neuroprotective effect. The transcriptome data obtained from LIPUS-treated rats can serve as a valuable molecular basis for further research on therapeutic mechanisms, ultimately contributing to a better understanding of the pathophysiology of depression.

Funding

This study was supported by the National Natural Science Foundation of China (82171525, 82171526), Beijing Municipal Administration of Hospitals' Youth Programme (QML20181901), and Beijing Young Top-Notch Talent Support Project (2018000021223ZK36).

Competing Interests

The authors have no relevant financial or non-financial interests to disclose.

Author contribution

S.Y Ren and Z.N Guo contributed to the investigation, validation, writing- original draft preparation, and visualization. J.N Zhang processed the methodology and resources. Y He contributed to review & editing and investigation. Z.L Sun and J Yang instructed all experiments, supervised this study and critically revised this manuscript.

Data Availability

The data used to support the findings of this study are available from the corresponding authors upon request.

Ethics approval

The study was approved in line withthe animal ethics requirements of the Animal Use and Care Committee at Capital Medical University (AEEI-2018-003)

Lu J, Xu X, Huang Y, Li T, Ma C, Xu G, Yin H, Xu X, Ma Y, Wang L, Huang Z, Yan Y, Wang B, Xiao S, Zhou L, Li L, Zhang Y, Chen H, Zhang T, Yan J, Ding H, Yu Y, Kou C, Shen Z, Jiang L, Wang Z, Sun X, Xu Y, He Y, Guo W, Jiang L, Li S, Pan W, Wu Y, Li G, Jia F, Shi J, Shen Z, Zhang N (2021) Prevalence of depressive disorders and treatment in China: a cross-sectional epidemiological study. Lancet Psychiatry. https://doi.org/10.1016/S2215-0366(21)00251-0
Penner-Goeke S, Binder EB (2019) Epigenetics and depression. Dialogues Clin Neurosci 21(4):397–405. https://doi.org/10.31887/DCNS.2019.21.4/ebinder
Uchida S, Yamagata H, Seki T, Watanabe Y (2018) Epigenetic mechanisms of major depression: Targeting neuronal plasticity. Psychiatry Clin Neurosci 72(4):212–227. https://doi.org/10.1111/pcn.12621
David DJ, Gourion D (2016) [Antidepressant and tolerance: Determinants and management of major side effects]. Encephale 42(6):553–561. https://doi.org/10.1016/j.encep.2016.05.006
Moncrieff J (2019) Persistent adverse effects of antidepressants. Epidemiol Psychiatr Sci 29:e56. https://doi.org/10.1017/S2045796019000520
Formolo DA, Lee TH, Yau SY (2019) Increasing Adiponergic System Activity as a Potential Treatment for Depressive Disorders. Mol Neurobiol 56(12):7966–7976. https://doi.org/10.1007/s12035-019-01644-3
Hu YY, Yang G, Liang XS, Ding XS, Xu DE, Li Z, Ma QH, Chen R, Sun YY (2023) Transcranial low-intensity ultrasound stimulation for treating central nervous system disorders: A promising therapeutic application. Front Neurol 14:1117188. https://doi.org/10.3389/fneur.2023.1117188
Sarica C, Nankoo JF, Fomenko A, Grippe TC, Yamamoto K, Samuel N, Milano V, Vetkas A, Darmani G, Cizmeci MN, Lozano AM, Chen R (2022) Human Studies of Transcranial Ultrasound neuromodulation: A systematic review of effectiveness and safety. Brain Stimul 15(3):737–746. https://doi.org/10.1016/j.brs.2022.05.002
Kim SJ, Roh D, Jung HH, Chang WS, Kim CH, Chang JW (2018) A study of novel bilateral thermal capsulotomy with focused ultrasound for treatment-refractory obsessive-compulsive disorder: 2-year follow-up. J Psychiatry Neurosci 43(5):327–337. https://doi.org/10.1503/jpn.170188
Lin CC, Huang TL (2020) Brain-derived neurotrophic factor and mental disorders. Biomed J 43(2):134–142. https://doi.org/10.1016/j.bj.2020.01.001
Zhang J, Zhou H, Yang J, Jia J, Niu L, Sun Z, Shi D, Meng L, Qiu W, Wang X, Zheng H, Wang G (2021) Low-intensity pulsed ultrasound ameliorates depression-like behaviors in a rat model of chronic unpredictable stress. CNS Neurosci Ther 27(2):233–243. https://doi.org/10.1111/cns.13463
Park SC (2019) Neurogenesis and antidepressant action. Cell Tissue Res 377(1):95–106. https://doi.org/10.1007/s00441-019-03043-5
Ray RD, Zald DH (2012) Anatomical insights into the interaction of emotion and cognition in the prefrontal cortex. Neurosci Biobehav Rev 36(1):479–501. https://doi.org/10.1016/j.neubiorev.2011.08.005
Lever-van Milligen BA, Vogelzangs N, Smit JH, Penninx BW (2014) Hemoglobin levels in persons with depressive and/or anxiety disorders. J Psychosom Res 76(4):317–321. https://doi.org/10.1016/j.jpsychores.2014.01.004
Umegaki H, Yanagawa M, Endo H (2011) Association of lower hemoglobin level with depressive mood in elderly women at high risk of requiring care. Geriatr Gerontol Int 11(3):262–266. https://doi.org/10.1111/j.1447-0594.2010.00672.x
Hansen JP, Pareek M, Hvolby A, Schmedes A, Toft T, Dahl E, Nielsen CT (2019) Vitamin D3 supplementation and treatment outcomes in patients with depression (D3-vit-dep). BMC Res Notes 12(1):203. https://doi.org/10.1186/s13104-019-4218-z
Tsukita S, Furuse M (1999) Occludin and claudins in tight-junction strands: leading or supporting players. Trends Cell Biol 9(7):268–273. https://doi.org/10.1016/s0962-8924(99)01578-0
Kiecolt-Glaser JK, Derry HM, Fagundes CP (2015) Inflammation: depression fans the flames and feasts on the heat. Am J Psychiatry 172(11):1075–1091. https://doi.org/10.1176/appi.ajp.2015.15020152
Posillico CK, Schwarz JM (2016) An investigation into the effects of antenatal stressors on the postpartum neuroimmune profile and depressive-like behaviors. Behav Brain Res 298(Pt B) 218–228. https://doi.org/10.1016/j.bbr.2015.11.011
Su WJ, Zhang T, Jiang CL, Wang W (2018) Clemastine Alleviates Depressive-Like Behavior Through Reversing the Imbalance of Microglia-Related Pro-inflammatory State in Mouse Hippocampus. Front Cell Neurosci 12:412. https://doi.org/10.3389/fncel.2018.00412
Furigo IC, Metzger M, Teixeira PD, Soares CR, Donato J Jr (2017) Distribution of growth hormone-responsive cells in the mouse brain. Brain Struct Funct 222(1):341–363. https://doi.org/10.1007/s00429-016-1221-1
Karakhanova S, Golovastova M, Philippov PP, Werner J, Bazhin AV (2014) Interlude of cGMP and cGMP/protein kinase G type 1 in pancreatic adenocarcinoma cells. Pancreas 43(5):784–794. https://doi.org/10.1097/MPA.0000000000000104

No competing interests reported.

graphicabstract.tif

Download PDF

Editorial decision: Revision requested
27 Mar, 2024
Reviews received at journal
22 Mar, 2024
Reviewers agreed at journal
27 Jan, 2024
Reviews received at journal
17 Jan, 2024
Reviewers agreed at journal
10 Jan, 2024
Reviewers invited by journal
04 Jan, 2024
Editor assigned by journal
28 Dec, 2023
Submission checks completed at journal
28 Dec, 2023
First submitted to journal
19 Dec, 2023

You are reading this latest preprint version

Transcriptomic Alterations in the Hippocampus and Prefrontal Cortex of Chronic Unpredictable Stress Rats Induced by Low-Intensity Pulsed Ultrasound.

Status:

Version 1

Abstract

Figures

1. Introduction

2. Materials and Methods

2.1 Animal experiment

2.2 Experimental Animals

2.3 CUS procedures

2.4 Low-intensity pulsed ultrasound

2.5 Behavioral tests

2.6 Clustering and sequencing

2.7 Real-time reverse transcription polymerase chain reaction (RT-PCR)

2.8 Statistical analysis

3. Results

3.1 LIPUS ameliorates depression-like behaviors in CUS rats.

3.2 LIPUS and CUS altered the hippocampus and prefrontal cortex transcriptome profile

3.3 Functional analysis of DEGs in LIPUS and CUS rats

3.4 Identification of DEGs under LIPUS Treatment in the CUS model.

4. Discussion

5. Conclusion

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1