Overexpression of AtDREB1 and BcZAT12 Genes Confers Drought Tolerance by Reducing Oxidative Stress in Double Transgenic Tomato (Solanum Lycopersicum Mill.)

doi:10.21203/rs.3.rs-378161/v1

Download PDF

Research Article

Overexpression of AtDREB1 and BcZAT12 Genes Confers Drought Tolerance by Reducing Oxidative Stress in Double Transgenic Tomato (Solanum Lycopersicum Mill.)

https://doi.org/10.21203/rs.3.rs-378161/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

A large number of genes has been targeted at the molecular level and transferred in tomato varieties from different sources for drought stress tolerance. Developed single transgenic (ST) plants exhibited better yield under drought stress, although the yield was comparatively lower and the plant growth was reduced. Hence, double transgenic plants were developed to improve yield potential without compromising drought tolerance; for this Dehydration Responsive Element Binding protein 1A (AtDREB1A) and Brassica carinata Zinc finger proteins (BcZAT12) genes were stacked. Developed double transgenic (DT) tomato plants by co-over expressing of both the genes exhibited more enzymatic and non-enzymatic antioxidative activities than control. Double transgenic (DZ1-DZ5) tomato lines, co-overexpressing AtDREB1A and BcZAT12 showed enhanced drought tolerance than their counterpart and wild type (WT) plants at 0, 07, 14, and 21 days of water deficit (DWD), respectively. DT plants showed increased activity of antioxidant enzymes, like catalase (CAT), superoxide dismutase (SOD), glutathione reductase (GR), ascorbate peroxidase (APX), dehydroascorbate reductase (DHAR), monodehydroascorbate reductase (MDHAR) and guaiacol peroxidase (POD) and accumulation of non-enzymatic antioxidants like ascorbic acid, glutathione as compared to ST and WT. Additionally, the transcript analysis of antioxidant enzymes revealed the level of gene expression in DT tomato plants. In the present study, co-overexpression of AtDREB1A and BcZAT12 genes in tomato showed superior drought tolerance as compared to ST and WT by elevating activity and quantity of enzymatic and non-enzymatic antioxidants. This is the primary report in tomato, which forms the basis for a multigene transgenic approach to cope with drought stress.

Plant Physiology and Morphology

Plant Molecular Biology and Genetics

AtDREB1A

BcZAT12

Co-overexpression

Drought

Gene pyramiding

Double transgenics

Solanum lycopersicum

Double transgenic tomato developed by AtDREB1A and BcZAT12 genes pyramiding showed significant drought tolerance by reducing oxidative stress. This gave significant higher yield under drought stress

In agriculture system plants generally face water scarcity due to different types of stresses which include drought, cold, and salinity. The water deficit severely affects growth, development, yield and crops quality depends on the duration, degree of water deficit, and crop stage (Krishna et al. 2019; Karkute et al. 2019; Krishna et al. 2021). Throughout the world about 20% of agricultural land is under irrigation; of which 14.51% is supported by good irrigation (FAO, 2012) while the remaining is rainfed, hence, frequently prone to drought/ water deficit stress. The most damaging abiotic stress considered is drought which alters the plant physiological activity primarily through disturbing plant-water relationship and by the generation of reactive oxygen species (ROS). Consequently, restricts plants’ overall genetically predetermined performance (Rai et al. 2013a). Thus, plants’ ability to resist drought stress is of great economic significance in changing the agro-ecosystem for agricultural sustainability. Abiotic stresses in general interrupt cellular homeostasis and produce an elevated level of ROS (Gill and Tuteja 2010); which acts as a signal to trigger responses related to stress (Liu et al. 2018). To cope with water-deficit, abscisic acid (ABA) synthesizes by plants, subsequently activates the closure of stomata and decreases the loss of water. The antioxidative defense machinery of plants relieves oxidative stress by ROS detoxification; thereby plays an important role in tolerance against drought (Sánchez Rodríguez et al. 2010; Sánchez-Rodríguez et al. 2016). These antioxidative defense systems comprised of low-molecular-mass non-enzymatic antioxidants like carotenoids, ascorbic acid, phenolics, flavonoids, and enzymes like catalase (CAT), superoxide dismutase (SOD) and ascorbate glutathione of Halliwell Asada cycle (Gill and Tuteja 2010). The enhancement in the activity of total foliar antioxidants under abiotic stresses is well documented (Rai et al. 2012a; Rai et al. 2012b; Karkute et al. 2019). When subjected to drought stress, a real-time increment in several other antioxidative defense system components also occur in tolerant cultivars (Rai et al. 2013a; Rai et al. 2013b; Baghour et al. 2018).

Tomato (Solanum lycopersicum) of family Solanaceae is considered as the most important vegetable fruit crop consumed worldwide. It was also extensively used as a plant model system for different genetic, molecular, and biological studies. Despite the fact that tomatoes can be cultivated profitably globally but its growth and development relatively sensitive to cold, drought, extreme temperatures, and salinity stresses (Foolad 2007; Rai et al. 2013a; Karkute et al. 2019). Drought potentially impacts tomato production globally (Pék et al. 2014), wherein plants are unable to give higher yields (Foolad 2007). The drought adaptation in plants is regulated at the transcription level and genes involve offer novel possibilities to improve drought stress tolerance and also to understand signaling pathways (Rai et al. 2013a; Rai et al. 2013b).

The Arabidopsis thaliana transcription factor AtDREB1A/CBF3 gene regulates drought tolerance, having significant importance for plants genetic engineering to attain improved drought tolerance (Rai et al. 2012b; Li et al. 2011; Krishna et al. 2021). Proteins encoded by AtDREB1A/CBF3 binds to C-repeat (CRT) cis-acting core DRE sequence CCGAC, present in A. thaliana various downstream drought-inducible genes promoter region of (Gilmour et al. 2000); and in transgenic plant systems such as Lolium perenne (Li et al. 2011), peanut and chrysanthemum (Hong et al. 2006; Bhatnagar et al. 2009). Furthermore ZFPs (Zinc finger proteins) are comparatively a large group of plants transcriptional regulators (Rai et al. 2012a; Rai et al. 2013b). The C₂H₂ is a type of ZFPs widely different in structure and function with respect to their interaction with DNA or RNA or protein (Kiełbowicz-Matuk 2012; Persikov et al. 2015) and provides a defense to various stresses; abiotic and biotic (Sun et al. 2010; Rai et al. 2012a). The ZAT12 is one such stress-responsive C₂H₂ type ZFP, which can manage numerous stress-induced gene expressions in plants arbitrated by ROS signaling (Miller et al. 2018; Krishna et al. 2021). Stress inducible transcription factors encoding genes additionally regulates the downstream expression of the gene, consequently a similar enhancement as in stress tolerance (Kiełbowicz-Matuk 2012).

In the present study analyzed antioxidant mechanisms, which alleviate oxidative stress generated due to drought stress in AtDREB1A and BcZAT12 pyramided double transgenic (DT) lines of tomato, by exploring the impacts of rd29A::AtDREB1A and Bclea1::BcZAT12 over-expression on key non-enzymatic antioxidant such as ascorbic acid (AsA), glutathione and antioxidant enzymes under an increase in the days of drought stress.

2.1. Plant material and drought stress

In the present study, Kashi Vishesh (H86), developed at Indian Institute of Vegetable Research, Varanasi, India using Solanum hirsutum f. glabratum B ‘6013’ as donor parent following backcross pedigree selection method, used for the experiments as performs very well in the Indian sub-continent and show moderate field resistance to tomato leaf curl virus. The research materials was consisted of a total eight (H86-cv. Kashi Vishesh, non-transgenic (NT); D86-AtDREB1A/CBF3 (Accession no. AF07460) and ZT1- BcZAT12 (Accession no. DQ166621.1) single transgenic (ST) lines and five (DZ1, DZ2, DZ3, DZ4, and DZ5) double transgenic (DT) lines expressing, AtDREB1A::BcZAT12 genes developed by crossing D86 and ZT1 transgenic lines were taken for the drought stress study. The 25 days old seedlings were transplanted in 7 kg earthen pots having 5:1 ratios of soil and manure which were kept in the transgenic glass house in a completely randomized design (CRD) at ICAR-Indian Institute of Vegetable Research, Varanasi. Transgenic glass houses were equipped with an air cooling system to maintain the standard growth condition of day/night temperature of 25°C/15°C and 50% relative humidity; 16 h/8 h of photoperiod with a light intensity of 350 mmol m^− 2 s^− 1 flux. For drought stress treatments different days of water deficit (DWD) imposed on 50 d old tomato plants (from seed germination), during late vegetative stage, by withholding 7, 14, or 21 d irrigation. The regularly irrigated plants were kept as control (0 d), which contains up to 80% moisture of total field capacity while 7, 14, 21 DWD exposed plants pot have nearly 40, 25 and 15% soil moisture contents of field capacity. After 0, 7, 14 and 21 DWD treatment, from the top fully expanded fourth leaf was collected and stored at -80°C till the completion of different analysis. The experiment was replicated thrice with three tomato plants in each replication. For various biochemical analyses, leaf samples were collected and pooled from three replications of each tomato lines/ events/ variety of each replicate.

2.2. Phyto-pigments (chlorophyll and carotenoid)

The leaf samples (200 mg) were homogenized in 80% acetone to extract phyto-pigments like chlorophyll and carotenoids as described by Porra et al. (1989). From the extract, the supernatant was collected and subsequently measured the absorbance at 663, 645 and 480, 510 nm for chlorophyll and carotenoid respectively, with SmartSpec 3000 UV/Visible Spectrophotometer (Bio-Rad, Hercules, California, USA). Arnon (1949) equation was used to compute the concentration of chlorophyll a (Chl a), chlorophyll b (Chl b), and carotenoids. Results were expressed in milligrams per gram of fresh weight of the sample.

2.3. Superoxide radical (O^·−₂) measurement

The superoxide anion (O^·−₂) generation rate was quantified by following the procedure of Shah et al. (2001). The assay reaction was set with 3 ml final volume of 100 mM sodium phosphate buffer (pH 7.2) containing 1 mM sodium diethyl dithiocarbamate and 0.25 mM nitro blue tetrazolium (NBT). Approximately 200 mg of fresh leaf sample was powdered with liquid nitrogen in sodium phosphate buffer (100 mM; pH 7.2) containing sodium diethyl dithiocarbamate (1 mM) to prevent the activity of SOD and 0.25 mM NBT to detect O^·−₂. Further centrifuged at 22,000 x g for 20 min and the supernatant was collected subsequently. In the presence of O^·−₂, NBT gets oxidized to form a dark blue insoluble precipitate. Absorbance was recorded at 540 nm using a SmartSpec 3000 UV/Visible Spectrophotometer (Bio-Rad, Hercules, California, USA) and O^·−₂ generation was expressed as ∆A₅₄₀ min^− 1 mg^− 1 protein.

2.4. Ascorbate peroxidase (APX) activity assay

According to the procedure of Nakano and Asada (1981) ascorbate peroxidase (APX; EC: 1.11.1.11) activity was estimated from 200 mg of fresh leaf sample homogenized in 5 ml of 50 mM potassium phosphate buffer (pH 7.8) having 1 mM EDTA, 1 mM ascorbic acid, 1% PVP; and 1 mM phenylmethylsulfonyl fluoride in a pre-chilled mortar and pestle at 4°C. The extract was centrifuged at 22,000 × g for 15 min at 4°C. The resultant supernatant was used for the enzymatic assay. A 3 ml assay reaction mixture prepared, comprising of 50 mM potassium phosphate buffer (pH 7.0), 0.2 mM EDTA, 0.5 mM AsA, 200 µl enzymatic extract and at last 0.2 mM H₂O₂ was mixed at last at 25°C. The absorbance of the reaction mixture was monitored at 290 nm for 5 min using SmartSpec 3000 UV/Visible Spectrophotometer (Bio-Rad, Hercules, California, USA) with an extinction coefficient of 2.8 mM^− 1 cm^− 1. The oxidation rate of ascorbate was measured and the specific activity of ascorbate peroxidase was expressed as µmol ascorbate oxidized mg^− 1 (protein) min^− 1.

2.5. Catalase (CAT) activity assay

As per the method suggested by Rai et al. (2012a); catalase (CAT, EC 1.11.1.6) activity was determined. Approximately 200 mg of fresh leaf tissue was homogenized in 50 mM Tris-NaOH buffer (pH 8.0) containing 0.5 mM EDTA, 0.5% (v/v) Triton X-100, and 2% (w/v) polyvinyl pyrrolidone (PVP), using pre chilled mortar and pestle. Further, the extract was centrifuged at 20,000 × g for 15 min at 4°C; the dialyzed supernatant was utilized for the assay. A 3 ml assay reaction mixture prepared to consist of 50 mM H₂O₂, 200 µl enzyme, and 100 mM KH₂PO₄ buffer (pH 7.0). Utilizing 0.036 mM^− 1 cm^− 1 of extinction coefficient and the consecutive decline in absorbance for five minute due to H₂O₂ decomposition was recorded at 240 nm with a SmartSpec 3000 UV/Visible Spectrophotometer (Bio-Rad, Hercules, California, USA). Enzyme specific activity was expressed in µmol of H₂O₂ oxidized mg^− 1 (protein) min^− 1.

2.6. Glutathione reductase (GR), dehydroascorbate reductase (DHAR) and monodehydroascorbate reductase (MDHAR) activity assay

The glutathione reductase (GR; EC 1.6.4.2), dehydroascorbate reductase (EC 1.8.5.1), and monodehydroascorbate reductase (MDHAR; EC 1.6.5.4) activity were assayed described by Sánchez-Rodríguez et al. (2010) from the fresh leaf (200 mg) sample. The leaf samples were homogenized in 5 ml of 100 mM Tris-HCl buffer (pH 7.8), 25 mM sodium phosphate buffer (pH 7.0), and 100 mM HEPES-HCl buffer (pH 7.6) respectively for GR, DHAR, and MDHAR at 4°C in a pre-chilled mortar and pestle. The enzymatic extract was centrifuged at 22,000 × g for 20 min on 4°C and the supernatant was collected for the estimation of enzymatic activity. For the GR, a reaction mixture of 2 ml was prepared with Tris-HCl buffer (100 mM, pH 7.8), oxidized glutathione (0.5 mM, GSSG), MgCl₂ (3 mM), NADPH (0.2 mM), and 200 µl of enzyme extract at 25°C. By adding NADPH to the mixture at room temperature, the reaction was initiated and the reduction in the absorbance of NADPH for 5 min was monitored at 340 nm with an extinction coefficient of 6.2 mM^− 1 cm^− 1 using SmartSpec 3000 UV/Visible Spectrophotometer (Bio-Rad, Hercules, California, USA), the GSSG absence ameliorated NADPH oxidation. The specific activity of the enzyme was expressed as µmol of NADPH oxidized mg^− 1 (protein) min^− 1. For DHAR, a 2 ml enzyme assay reaction mixture consisting of 200 µl enzyme extract, 25 mM sodium phosphate buffer (pH 7.0), 2.5 mM GSH, and 0.4 mM DHA. The enzymatic reaction was initiated by adding DHA at ambient temperature. The increase in absorbance due to ascorbate was monitored at 265 nm for 3 min with an extinction coefficient of 14 mM^− 1 cm^− 1 using SmartSpec 3000 UV/Visible Spectrophotometer (Bio-Rad, Hercules, California, USA) and as µmol of NADPH oxidized mg^− 1 (protein) min^− 1, the enzyme-specific activity was expressed. For non-enzymatic reduction in DHA by GSH, the reaction rate was corrected. The MDHAR activity measured by a reaction mixture of 2 ml was prepared from 200 µl of enzymatic supernatant with 0.15 mM NADP, 2.5 mM AsA and 100 mM HEPES-HCl buffer (pH 7.6). The NADPH oxidation rate detected as an increase in absorbance up to 3 min at 340 nm (extinction coefficient of 6.2 mM^− 1 cm^− 1) with SmartSpec 3000 UV/Visible Spectrophotometer (Bio Rad, Hercules, California, USA) and was expressed as µmol of ascorbate oxidized mg^− 1 (protein) min^− 1.

2.7. Superoxide dismutase (SOD) activity assay

According to the procedure as suggested by Nahakpam and Shah (2011) superoxide dismutase (SOD, EC 1.15.1.1) activity was determined from 200 mg of fresh leaf tissue samples crushed in a pre-chilled mortar and pestle with 5 ml potassium phosphate buffer (100 mM; pH 7.8), containing EDTA (0.1 mM), Triton X-100 (0.1% v/v), and polyvinyl pyrrolidone (PVP) (2% w/v). The enzymatic extract was then centrifuged in 4°C for 15 min at 22000 × g; and the resultant supernatant was dialyzed with the help of cellophane membrane tube against cold extraction buffer, sodium carbonate-bicarbonate buffer (50 mM; pH 9.8) for 4 hours. For the enzyme assay a 3 ml reaction mixture was prepared using 100 µl of enzyme extract and EDTA (0.1 mM), to which epinephrine was added finally. The formation of adrenochrome during next 5 min was monitored at 470 nm with a SmartSpec 3000 UV/Visible Spectrophotometer (Bio-Rad, Hercules, California, USA). The amount of enzyme required to stimulate 50 percent epinephrine oxidation under experimental conditions are described as one unit of SOD activity.

2.8. Guaiacol peroxidase (POD) activity assay

Guaiacol peroxidase (EC 1.11.1.7) activity was estimated according to the method suggested by Shah et al. (2001). The fresh leaf sample (200 mg) was crushed with 5 ml sodium phosphate buffer (60 mM; pH 7.0) at 4°C using a pre-chilled mortar and pestle. The supernatant collected after centrifuging the homogenates at 22,000 × g for 15 min, and used for enzymatic preparation. A reaction mixture of 2 ml set up consisting of 40 mM sodium phosphate buffer (pH 6.0), 9 mM guaiacol, 2 mM H₂O₂, and 50 µl enzyme extract. The absorbance of the reaction mixture was recorded at 470 nm using SmartSpec 3000 UV/Visible Spectrophotometer (Bio Rad, Hercules, California, USA) with 26.6 mM^− 1 cm^− 1 extinction coefficient for 5 min and expressed as µmol of H₂O₂ reduced mg^− 1 (protein) min^− 1.

2.9. Glutathione assay

Owens and Belcher (1965) described procedure was used for glutathione assay; in which a fresh leaf (200 mg) sample was powdered in mortar and pestle with liquid nitrogen and mixed with 5 ml of 5% (w/v) meta-phosphoric acid at 4°C. The extract was centrifuged at 22,000 × g for 20 min at 4°C and the supernatant collected for assaying both ascorbate and glutathione. Total glutathione and reduced glutathione (GSH) were assayed following the procedure. The reduced glutathione was oxidized by 5,5-dithio-bisnitrobenzoicacid (DTNB), and the reaction between GR and NADPH, the oxidized glutathione (GSSG) was reduced to GSH. A reaction mixture of 2 ml prepared by using 100 mM potassium phosphate buffer (pH 8.0), consisting of 50 µl of the extract, 30 µl of 4% (w/v) DTNB, and 1 mM EDTA. The reaction mixtures were incubated at room temperature for 4 min then the absorbance was recorded at 412 nm using SmartSpec 3000 UV/Visible Spectrophotometer (Bio Rad, Hercules, California, USA). Total glutathione was also assayed by adding 0.25 mM NADPH and 0.5 units of glutathione reductase to the same reaction mixture. The concentration of GSH and total glutathione was measured with a standard reference curve of 1–5 µg.

2.10. Ascorbate (AsA) assay

Ascorbate (AsA) DHA, total AsA, and reduced AsA were estimated according to Law et al. (1983) procedure. Total AsA was estimated using Dithiothreitol (DTT) by reducing DHA to AsA. Fresh leaf tissue (200 mg) the sample was crushed in 5% of metaphosphoric acid consisting of 100µl of 10 mM DTT and 500 µl of 150 mM sodium phosphate buffer (pH 7.5). The reaction mixture was incubated for 10 min at room temperature in dark, after incubation 100 µl of 0.5% (w/v) N-ethylmaleimide was added along with 200 µl FeCl₃ (3% w/v), 400 µl 2, 20-bipyridyl (4% w/v, in 70% v/v ethanol) and 400 µl orthophosphoric acid (44% v/v) followed by incubation for 30 min at 40°C in dark. The absorbance was recorded at 525 nm with SmartSpec 3000 UV/Visible Spectrophotometer (Bio Rad, Hercules, California, USA), the total AsA content was analyzed using a standard AsA reference curve. With the substitution of 100 µl of DTT with 100 µl of distilled water, the reduced AsA was measured in the similar method as described in the earlier procedure. The DHA was analyzed as a difference between the reduced AsA and total AsA and expressed as mg g^− 1 FW.

2.11. Total fruit number and fruit weight

The total number of fruit per plant counted and fruit yield per plant recorded by weighing total fruit and expressed in gram per plant.

2.12. Gene expression analysis

Antioxidative enzymes gene namely APX, CAT, DHAR, GR, MHDAR, POD, and SOD were selected and their sequences were retrieved from the NCBI database (www.ncbi.nlm.nih.gov) to study their expression analysis. qRT-PCR primer designing Primer3 v. 0.9 software (Rozen and Skaletsky 1998) was used (Table 1). RNA was isolated from top young leaves by utilizing TRI reagent (Ambion, CA, USA) according to manufacturer protocol. cDNA strand was synthesized using 1 µg RNA in a 20 µl of reaction volume using Bio-Rad cDNA synthesis kit (Bio-Rad, Hercules, USA), and for RT-qPCR IQ SYBR Green Supermix (Bio-Rad) was utilized, the reaction was set in thermal cycler (iQ5, Bio-Rad), actin gene was used as an internal control. The sequences of actin and other gene-specific primer are tabulated in Table 1. For PCR reaction 5 µl of cDNA was taken and PCR was programmed as initial denaturation at 95°C for 1 min, then at 95°C for 45 s denaturation, at 56–60°C for 45 s annealing, 72°C for 45 s extension, repeated for 36 cycles and a final extension of 72°C for 5 min. The relative gene expression was detected by using 2^−ΔΔCT method (Livak and Schmittgen 2001).

Table 1

List of primers used for PCR and real time PCR
Sr. No	Gene Name	Forward Primer (5’-3’)	Reverse Primer (5’-3’)	Tm (°C)
1	AtDREB1	AGGCGGTGATTATATTCCGACGCT	TCAGCGGTTTGAAATGTTCCGAGC	55
2	BcZAT12	TGTCCGATATGCGGAGTGGAGTTT	TTTCTTCAACGTCATCAACGCCGC	56
Real time
3	APX	GAGGTGGAGCTAATGGAAGC	ACATCCATCCTCCCATGTTT	52
4	CAT	TTCCATCACTGCAGCTTTGCTTCG	TTTGTTTGGGCCAGCTTCTCTCTC	54
5	GR	CGTGCTGTGATACTTGGTGG	TCGTGCAAGGATGCATAGTG	53
6	SOD	CGGA TGGGCCTGGCTTGCATA	AGCATGCTCCCAA ACGTCGA	55
7	DHAR	CCAGAATACCAAGGCTGAAGAAA	TGCTAACTACCCGAGACACAACA	54
8	MDHAR	GTGTTTCTGCTGGGTATGC	GGTATGCCTTGCTAAGTGC	51
9	POD	GAATGTGCCAACTGGTAGAAGA	GAGCAACGAGACACTCCAATAG	52
10	Actin	TGGTCGGAATGGGACAGAAG	CTCAGTCAGGAGAACAGGGT	51

2.13. Statistical analysis

Every analysis was done by SPSS statistical package (SPSS Inc., Version 16.0). Three samples were taken for each replication and the mean value was used for statistical analysis. One-way analysis of variance (ANOVA) was performed to estimate the significant value difference and Duncan’s multiple range analysis was also computed. The level of significance for post hoc test was set at 5% and P < 0.05 significance.

3.1. Chlorophyll and carotenoid

Total chlorophyll content measured under control and 7, 14 and, 21 DWD, and it was observed that the total chlorophyll was maximum under control condition in non-transgenic (NT), transgenic (ST), and double transgenic (DT), however, it get reduced after 7, 14 and 21 DWD (Table 1). Total chlorophyll under control condition recorded highest in DZ4 and DZ5 with value 3.90 mg g^− 1 FW for each, while it was lowest in H86 (3.11 mg g^− 1 FW). After 7 DWD the total chlorophyll content was higher in DZ5 (3.57 mg g^− 1 FW), while it was lowest in H86 (2.06 mg g^− 1 FW). Similarly, a continuous reduction in total chlorophyll content recorded after 21 DWD with a lowest value in H86 (0.823 mg g^− 1 FW) and highest in DZ5 (2.59 mg g^− 1 FW) (Table 1). Chlorophyll a and chlorophyll b ratio does not so any fixed trend, under control condition the chl a/chl b ratio was highest in DZ4 and DZ5 (2.28 mg g^− 1 FW each) whereas it was lowest in H86 (1.84 mg g^− 1 FW). After 7 DWD, it was the highest in DZ5 (2.56 mg g^− 1 FW) while lowest in H86 (1.60 mg g^− 1 FW). Similarly, after 14 and 21 DWD, it was maximum in DZ5 (2.06 mg g^− 1 FW) and ZT1 (2.20 mg g^− 1 FW), respectively. However, it was minimum in H86 (1.41 and 1.21 mg g^− 1 FW), respectively (Table 2).

Table 2

Total chlorophyll and chlorophyll a/b ratio in different tomato genotypes
Events	Total Chlorophyll (mg/g^− 1 FW)				Chlorophyll A/B (mg/g^− 1 FW)
Events	0 Days	07 Days	14 Days	21 Days	0 Days	07 Days	14 Days	21 Days
H86	3.109 ± 0.017^b	2.058 ± 0.135^b	1.732 ± 0.118^c	0.823 ± 0.034^b	1.840 ± 0.077^c	1.603 ± 0.115^c	1.417 ± 0.092^d	1.212 ± 0.087^c
D86	3.847 ± 0.023^a	3.441 ± 0.139^a	3.200 ± 0.135^ab	2.535 ± 0.125^a	2.044 ± 0.134^b	2.066 ± 0.093^b	1.770 ± 0.112^b	1.890 ± 0.138^b
ZT1	3.807 ± 0.019^a	3.412 ± 0.221^a	3.282 ± 0.192^a	2.487 ± 0.129^a	1.963 ± 0.119^c	2.010 ± 0.129^b	1.806 ± 0.135^ab	2.204 ± 0.119^a
DZ1	3.851 ± 0.028^a	3.432 ± 0.176^a	3.247 ± 0.138^a	2.556 ± 0.118^a	2.240 ± 0.172^a	2.204 ± 0.157^ab	1.818 ± 0.145^ab	1.940 ± 0.158^ab
DZ2	3.811 ± 0.015^a	3.372 ± 0.234^a	3.160 ± 0.223^a	2.489 ± 0.139^a	2.176 ± 0.138^ab	2.055 ± 0.089^b	1.649 ± 0.093^c	1.809 ± 0.137^b
DZ3	3.852 ± 0.023^a	3.473 ± 0.198^a	3.255 ± 0.167^a	2.521 ± 0.145^a	2.118 ± 0.145^b	2.342 ± 0.129^a	1.898 ± 0.137^a	1.862 ± 0.155^b
DZ4	3.905 ± 0.013^a	3.491 ± 0.251^a	3.268 ± 0.159^a	2.518 ± 0.113^a	2.282 ± 0.129^a	2.353 ± 0.114^a	1.900 ± 0.118^a	1.810 ± 0.129^b
DZ5	3.904 ± 0.019^a	3.573 ± 0.177^a	3.345 ± 0.128^a	2.596 ± 0.110^a	2.770 ± 0.112^a	2.569 ± 0.129^a	2.059 ± 0.074^a	2.156 ± 0.091^a
The results are mean ± SE of triplicate measurements. Means followed by the same letter along same row are not significantly different (P ≤ 0.05), according to Duncan’s multiple range test.

Similarly, carotenoid content measured under control, 7, 14, and 21 DWD, and it gets reduces with increasing DWD (Table 2). It was significantly higher in DZ4 (0.678 mg g^− 1 FW) under control condition while lowest in H86 (0.558 mg g^− 1 FW) After 7 DWD, DZ4 showed a significantly increased value of 0.643 mg g^− 1 FW, however it was minimum in H86 (0.409 mg g^− 1 FW). After 14 and 21 DWD maximum carotenoid content was noted in DZ3 (0.595 mg/g-1 FW) and DZ1 (0.517 mg g^− 1 FW), while it was minimum in H86 (0.425 and 0.247 mg g^− 1 FW). Chlorophyll/carotenoid ratio was highest in DZ2 (6.49 mg g^− 1 FW), DZ2 (6.27 mg g^− 1 FW), ZT1 (6.08 mg g^− 1 FW) and DZ2 (5.34 mg g^− 1 FW), under control, 7, 14, and 21 DWD, respectively. While it was lowest in H86, with respective values 5.64, 5.02, 4.12, and 3.31 mg g^− 1 FW, under control, 7, 14 and 21 DWD (Table 3).

Table 3

Carotenoids and chlorophyll/carotenoids ratio in different tomato genotypes
Events	Carotenoids (mg/g^− 1 FW)				Chlorophyll/Carotenoids (mg/g^− 1 FW)
Events	0 Days	07 Days	14 Days	21 Days	0 Days	07 Days	14 Days	21 Days
H86	0.558 ± 0.013^b	0.410 ± 0.031^d	0.426 ± 0.031^c	0.248 ± 0.011^c	5.644 ± 0.331^b	5.022 ± 0.343^d	4.124 ± 0.175^d	3.307 ± 0.178^d
D86	0.620 ± 0.019^a	0.586 ± 0.029^ab	0.559 ± 0.045^a	0.508 ± 0.035^a	6.194 ± 0.319^a	6.026 ± 0.291^a	5.780 ± 0.331^b	4.946 ± 0.295^c
ZT1	0.613 ± 0.011^a	0.584 ± 0.037^ab	0.539 ± 0.029^ab	0.483 ± 0.031^ab	6.192 ± 0.452^a	5.875 ± 0.373^b	6.082 ± 0.465^a	5.298 ± 0.382^a
DZ1	0.653 ± 0.024^a	0.615 ± 0.051^a	0.587 ± 0.047a	0.517 ± 0.035^a	5.889 ± 0.371^ab	5.604 ± 0.297^bc	5.583 ± 0.378^b	5.002 ± 0.245^b
DZ2	0.595 ± 0.029^ab	0.564 ± 0.031^c	0.527 ± 0.033^ab	0.472 ± 0.041^b	6.499 ± 0.451^a	6.271 ± 0.475^a	6.015 ± 0.313^a	5.341 ± 0.177^a
DZ3	0.658 ± 0.024^a	0.634 ± 0.045^a	0.595 ± 0.051^a	0.500 ± 0.037^a	5.836 ± 0.393^ab	5.482 ± 0.391^c	5.518 ± 0.475^bc	5.278 ± 0.378^a
DZ4	0.678 ± 0.037^a	0.643 ± 0.051^a	0.587 ± 0.019^a	0.490 ± 0.019^a	5.765 ± 0.413^b	5.436 ± 0.225^c	5.692 ± 0.199^bc	5.189 ± 0.292^ab
DZ5	0.670 ± 0.032^a	0.640 ± 0.033^d	0.572 ± 0.027^a	0.506 ± 0.017^a	5.789 ± 0.470^b	5.608 ± 0.313^bc	5.890 ± 0.377^b	5.236 ± 0.197^a
The results are mean ± SE of triplicate measurements. Means followed by the same letter along same row are not significantly different (P ≤ 0.05), according to Duncan’s multiple range test.

3.2. Superoxide radical (O^·−₂)

Superoxide anions increase with increase in DWD in NT, ST and DT plants, after 7 DWD the higher fold change noted in H86 while it was lowest in DZ5. While after 14 and 21 DWD maximum increases recorded in H86, while it was minimum in the case of DZ2 (Table 4).

Table 4

Super oxide radical in different tomato genotypes
Events	Super oxide radical (∆₅₄₀ min^− 1 mg^− 1 protein)
Events	0 Days	07 Days	14 Days	21 Days
H86	0.490 ± 0.031^a	0.822 ± 0.043^a	1.434 ± 0.118^a	2.285 ± 0.135^a
D86	0.239 ± 0.011^b	0.319 ± 0.022^b	0.432 ± 0.023^b	0.939 ± 0.071^b
ZT1	0.245 ± 0.012^b	0.264 ± 0.031^c	0.358 ± 0.033^c	0.822 ± 0.061^bc
DZ1	0.201 ± 0.005^c	0.226 ± 0.014^d	0.295 ± 0.008^d	0.728 ± 0.061^c
DZ2	0.226 ± 0.021^b	0.239 ± 0.024^c	0.314 ± 0.023^cd	0.753 ± 0.041^c
DZ3	0.220 ± 0.008^bc	0.245 ± 0.003^c	0.339 ± 0.011^c	0.734 ± 0.083^c
DZ4	0.220 ± 0.012^bc	0.276 ± 0.016^c	0.358 ± 0.022^c	0.804 ± 0.063^bc
DZ5	0.195 ± 0.007^c	0.213 ± 0.009^d	0.314 ± 0.012^cd	0.716 ± 0.053^c
The results are mean ± SE of triplicate measurements. Means followed by the same letter along same row are not significantly different (P ≤ 0.05), according to Duncan’s multiple range test.

3.3. Ascorbate peroxidase and catalase activity

APX increases up to 14 DWD in NT, ST, and DT plants, however, after 21 DWD it reduces in H86 and D86 but a continuous increase noted in ZT1, DZ1, DZ2, DZ3, DZ4 and DZ5. After 7 DWD highest, 2.23 fold increase compared to control noted in DZ5, while, it was least in case of H86 (1.23 fold). Highest 3.02 fold increase compared to control recorded in DZ5 after 14 DWD, while, it was lowest in H86 (2.08 fold). After a maximum 21 DWD, a higher increase compared to control noted in DZ5 (3.93 fold), whereas, it was lowest in H86 (1.91 fold) (Fig. 1a). Under control condition, highest catalase activity was recorded in DZ5, while it was lowest in H86. After 7 DWD increase in catalase activity recorded in NT, T, and DT lines with a maximum increase of 2.01 fold in ZT1, while it was lowest in the case of H86 with an increase of 1.49 fold. Similarly, after 14 and 21 DWD increase recorded, it was maximum for DZ1, whereas it was minimum for H86 (Fig. 1b).

3.4. Glutathione reductase and super oxide dismutase activity

GR specific activity noted maximum in ZT1 under controlled condition, it increases compared to control in NT, ST, and DT plants after 7 DWD with highest fold increase in DZ1 (1.93), and lowest fold change in H86 (1.50). After 14, and 21 DWD highest increase noted in DZ2 with respective fold increase of 3.43 and 4.36, while it was lowest in H86 with respective fold change of 1.76 and 1.0 (Fig. 1c). The activity of SOD enhanced with each water deficit treatment viz; 7, 14 and 21 DWD in each except in H86 and D86 in which after 21 DWD it gets reduced. Highest SOD activity after 7 DWD noted in DZ5 while it was lowest in H86. After 14 DWD significant increase in SOD compared to control noted in ZT1 (3.02 fold), while it was significantly lower in H86 (2.05 fold). Similarly after 21 DWD highest increase in SOD activity compared to control noted in ZT1 (3.22 fold) however it was decreased in H86 (0.889 fold) (Fig. 1d).

3.5. Dehydroascorbate and monodehydroascorbate reductase activity

Dehydroascorbate reductase activity increases up to 14 DWD in NT, ST, and DT, however, it gets reduced after 21 DWD. The highest value of 1.36 fold increase compared to control noted in ZT1 after 7 DWD, however, under the similar condition, it was lowest in H86 (1.01 fold). Similarly, after 14 DWD it was maximum in ZT1 with a 2.18 fold increase compared to control, while, it was minimum in H86 (1.56 fold) compared to control. A reduction in DHAR noted after 21 DWD with significantly highest value in ZT1 (1.39 fold compared to control), while it was minimum in H86 (0.64 fold compared to control) (Fig. 2a). Continuous enhancement in MDHAR recorded with rise in DWD, with maximum value after 21 DWD. Under control and 7 DWD condition minimum value 3.06 and 4.20 µmol ascorbate oxidized min-1 mg-1 protein and maximum value, 6.40 and 11.06 µmol ascorbate oxidized min-1 mg-1 protein noted respectively for H86 and DZ5. Similarly, after 14 DWD maximum increase in MDHAR compared to control recorded in DZ2 (3.12 fold) whereas minimum in H86 (2.08 fold). However, MDHAR was recorded maximum in DZ5 and while lowest in H86 under 21 DWD (Fig. 2b).

3.6. Guaicol peroxidase activity

Guaicol peroxidase activity was highest in DZ5 and minimum in H86 under controlled conditions. It gets reduced in H86 and D86, while increases in ZT1, DZ1, DZ2, DZ3, DZ4 and DZ5 after 7 DWD. Again it increases in NT, ST, and DT after 14 DWD, the increase compared to control was highest in DZ3 (2.07 fold) whereas lowest for H86 (1.41fold). After 21 DWD it reduces in all, the maximum reduction compared to control was recorded in H86 (1.16) and minimum in DZ2 (1.98) (Fig. 2c).

3.7. Ascorbate

Under control condition the value of dehydroascorbate was highest in DZ2 (0.693 mg g^− 1 DW) while it was lowest in H86 (0.277 mg g^− 1 DW). After 7 DWD the dehydroascorbate increases however again decreases after 14 DWD and the values were lower than the values under 7 DWD, however, still, it was higher than the value under control conditions. At the end of maximum 21 DWD, the value in fold change was highest in DZ4 (3.40) and lowest in H86 (1.20) as compared to control (Table 5). Reduced ascorbate after 7 DWD increases maximum in case of DZ5 (1.05 to 2.97 mg g^− 1 DW), while it increases minimum in case of H86 (0.577 to 0.959 mg g^− 1 DW) (Table 5). However, after 14 DWD reduced ascorbate was highest 2.57 mg g^− 1 DW in DZ5. Although, after 21 DWD, the reduced ascorbate recorded increase order D86 > DZ2 > DZ5 > DZ3 > DZ1 > H86 > DZ4 > ZT1 (Table 5). Compared to control total ascorbate increases highest by 3.47 fold in DZ2 after 7 DWD. However it gets reduces after 14 DWD, and the highest fold value as compared to control was 3.56 (Table 6). After maximum DWD of 21 days, results in increase of total ascorbate compared to control, with a maximum increase of 4.29 fold (DZ4) and a minimum of 2.19 fold (H86).

Table 5

Dehydroascorbate and reduced ascorbate in different tomato genotypes
Events	Dehydroascorbate (mg g^− 1 DW)				Reduced Ascorbate (mg g^− 1 DW)
Events	0 Days	07 Days	14 Days	21 Days	0 Days	07 Days	14 Days	21 Days
H86	0.591 ± 0.023^b	1.570 ± 0.121^cd	0.880 ± 0.037^c	1.720 ± 0.129^bc	0.802 ± 0.033^c	2.021 ± 0.123^c	1.730 ± 0.121^d	2.290 ± 0.178^ab
D86	0.495 ± 0.017^d	1.880 ± 0.119^ab	0.730 ± 0.031^d	2.230 ± 0.154^a	1.120 ± 0.097^a	2.090 ± 0.145^c	1.720 ± 0.158^d	1.590 ± 0.123^d
ZT1	0.547 ± 0.033^c	1.970 ± 0.125a	0.956 ± 0.041^b	2.130 ± 0.137^a	0.927 ± 0.052^b	2.656 ± 0.151^ab	2.420 ± 0.188^a	1.880 ± 0.119^c
DZ1	0.694 ± 0.053^a	1.780 ± 0.138^ab	1.120 ± 0.038^ab	1.560 ± 0.119^c	0.896 ± 0.038^bc	2.240 ± 0.171^b	1.890 ± 0.111^c	2.230 ± 0.176^ab
DZ2	0.609 ± 0.055^b	1.630 ± 0.132^c	1.020 ± 0.07^b	1.880 ± 0.125^b	0.969 ± 0.067^ab	2.521 ± 0.118^ab	2.270 ± 0.145^b	2.190 ± 0.166^b
DZ3	0.651 ± 0.043^ab	1.980 ± 0.131^a	0.873 ± 0.091^c	2.220 ± 0.152^a	0.958 ± 0.056^ab	2.448 ± 0.121^ab	2.090 ± 0.177^bc	1.810 ± 0.135^c
DZ4	0.684 ± 0.033^a	1.740 ± 0.112^b	1.240 ± 0.081^a	2.290 ± 0.138^a	1.052 ± 0.09^a	2.969 ± 0.143^a	2.570 ± 0.192^a	2.430 ± 0.155^a
DZ5	0.591 ± 0.027^b	1.570 ± 0.119^cd	0.880 ± 0.028^c	1.720 ± 0.183^bc	0.802 ± 0.05^c	2.021 ± 0.151^c	1.730 ± 0.115^d	2.290 ± 0.187^ab
The results are mean ± SE of triplicate measurements. Means followed by the same letter along same row are not significantly different (P ≤ 0.05), according to Duncan’s multiple range test.

Table 6

Total ascorbate in different tomato genotypes
Events	Total Ascorbate (mg g^− 1 DW)
Events	0 Days	07 Days	14 Days	21 Days
H86	1.880 ± 0.112^b	3.930 ± 0.223^c	3.550 ± 0.229^c	4.120 ± 0.299^d
D86	1.854 ± 0.131^b	5.400 ± 0.332^bc	5.190 ± 0.37^b	6.220 ± 0.432^c
ZT1	1.833 ± 0.119^b	5.790 ± 0.392^b	5.220 ± 0.323^b	7.380 ± 0.571^b
DZ1	2.000 ± 0.145^a	6.380 ± 0.161^ab	5.460 ± 0.273^b	7.390 ± 0.387^b
DZ2	2.115 ± 0.121^a	7.340 ± 0.532^a	6.880 ± 0.412^a	7.890 ± 0.541^ab
DZ3	2.146 ± 0.133^a	5.960 ± 0.232^b	6.430 ± 0.297^a	7.980 ± 0.612^a
DZ4	1.938 ± 0.127^ab	6.900 ± 0.321^ab	6.730 ± 0.354^a	8.330 ± 0.622^a
DZ5	2.240 ± 0.167^a	7.320 ± 0.312^a	6.810 ± 0.335^a	8.770 ± 0.572^a
The results are mean ± SE of triplicate measurements. Means followed by the same letter along same row are not significantly different (P ≤ 0.05), according to Duncan’s multiple range test.

3.8. Glutathione

Under control condition highest glutathione recorded in DZ5 (0.666 µg g-1 FW), however, it was lowest in case of H86 (0.312 µg g-1 FW). After 7 DWD it increases maximum by 1.47 fold in DZ3 compared to value under control condition, similarly after 14 DWD maximum 2.02 fold increase compared to control recorded in DZ2 and after 21 DWD highest 1.49 fold increase compared to control recorded for ZT1 (Table 7). The total GSH increases with an increase in DWD in NT, ST and DT, except in H86 after 21 DWD which reduces slightly compared to the value after 14 DWD. As in glutathione, the highest GSG recorded in DZ5 under control, 7, 14, and 21 DWD condition with respective values of 0.857 µg g-1 FW, 1.52 µg g-1 FW, 2.05 µg g-1 FW, and 2.57 µg g-1 FW, however it was lowest in H86 under the similar condition with respective values 0.40 µg g-1 FW, 0.542 µg g-1 FW, 0.884 µg g-1 FW and 0.855 µg g-1 FW (Table 7). Total glutathione increases after 7, 14 and 21 DWD in NT, ST and DT compared to control, maximum total glutathione recorded in DZ5 under control, and under all the drought treatments viz; 7, 14 and 21 DWD, with respective values 1.60 µg g-1 FW, 2.62 µg g-1 FW, 4.07 µg g-1 FW and 5.21 µg g-1 FW, while it was least in H86 under the similar conditions with respective values 0.67 µg g-1 FW, 0.85 µg g-1 FW, 1.11 µg g-1 FW, and 1.49 µg g-1 FW (Table 8).

Table 7

Oxidized glutathione and reduced glutathione in different tomato genotypes
Events	Oxidized Glutathione (GSSG) (µg g-1 FW)				Reduced Glutathione (GSH) (µg g-1 FW)
Events	0 Days	07 Days	14 Days	21 Days	0 Days	07 Days	14 Days	21 Days
H86	0.312 ± 0.017^d	0.262 ± 0.015^e	0.231 ± 0.014^e	0.347 ± 0.015^d	0.401 ± 0.025^d	0.542 ± 0.023^e	0.884 ± 0.035^e	0.855 ± 0.033^e
D86	0.578 ± 0.023^b	0.427 ± 0.025^d	0.875 ± 0.064^c	0.620 ± 0.036^c	0.762 ± 0.047^bc	1.010 ± 0.083^d	1.682 ± 0.094^c	2.160 ± 0.145^c
ZT1	0.409 ± 0.012^c	0.518 ± 0.033^c	0.702 ± 0.029^d	0.613 ± 0.041^c	0.603 ± 0.035^c	0.868 ± 0.041^e	1.415 ± 0.088^d	1.993 ± 0.165^d
DZ1	0.566 ± 0.023^b	0.712 ± 0.053^b	1.115 ± 0.089^a	0.787 ± 0.051^b	0.848 ± 0.043^a	1.343 ± 0.071^c	1.932 ± 0.135^ab	2.407 ± 0.171^ab
DZ2	0.529 ± 0.033^bc	0.715 ± 0.032^b	1.072 ± 0.078^ab	0.740 ± 0.029^bc	0.783 ± 0.037^b	1.302 ± 0.081^c	1.840 ± 0.154^b	2.307 ± 0.125^b
DZ3	0.596 ± 0.041^b	0.881 ± 0.063^a	1.158 ± 0.098^a	0.807 ± 0.057^a	0.823 ± 0.031^a	1.301 ± 0.071^c	1.903 ± 0.117^ab	2.368 ± 0.144
DZ4	0.572 ± 0.029^b	0.752 ± 0.055^b	1.128 ± 0.894^a	0.803 ± 0.033^a	0.741 ± 0.042^bc	1.452 ± 0.091^b	2.015 ± 0.135^a	2.740 ± 0.153^a
DZ5	0.666 ± 0.045^a	0.923 ± 0.063^a	1.182 ± 0.112^a	0.843 ± 0.057^a	0.858 ± 0.047^a	1.520 ± 0.081^a	2.025 ± 0.118^a	2.573 ± 0.147^a
The results are mean ± SE of triplicate measurements. Means followed by the same letter along same row are not significantly different (P ≤ 0.05), according to Duncan’s multiple range test.

Table 8

Total glutathione in different tomato genotypes
Events	Total Glutathion (µg g-1 FW)
	0 Days	07 Days	14 Days	21 Days
H86	0.667 ± 0.033^e	0.853 ± 0.054^e	1.115 ± 0.088^e	1.486 ± 0.113^f
D86	1.013 ± 0.087^d	1.869 ± 0.066^cd	3.300 ± 0.192^c	3.708 ± 0.253^d
ZT1	0.988 ± 0.065^d	1.713 ± 0.134^d	2.733 ± 0.235^d	3.525 ± 0.197^e
DZ1	1.347 ± 0.091^bc	2.203 ± 0.152^bc	3.817 ± 0.197^ab	4.717 ± 0.253^b
DZ2	1.247 ± 0.886^c	2.111 ± 0.156^c	3.567 ± 0.251^b	4.133 ± 0.229^c
DZ3	1.441 ± 0.073^b	2.369 ± 0.157^b	3.892 ± 0.244^a	4.800 ± 0.256^ab
DZ4	1.490 ± 0.011^ab	2.513 ± 0.138^a	3.917 ± 0.241^a	4.833 ± 0.291^ab
DZ5	1.598 ± 0.093^a	2.625 ± 0.181^a	4.075 ± 0.253^a	5.208 ± 0.342^a
The results are mean ± SE of triplicate measurements. Means followed by the same letter along same row are not significantly different (P ≤ 0.05), according to Duncan’s multiple range test.

3.9. Number of fruit number and fruit weight

With an increase in DWD total fruit number and fruit weight decreases in NT, ST, and DT plants. The highest fruit number recorded in DZ5 under control, 7, 14 and 21 DWD, while it was lowest in H86 under similar conditions. Similarly, total fruit weight was maximum in DZ5 under control, 7, 14, and 21 DWD, while it was minimum in H86 under similar conditions (Table 9).

Table 9

Number of fruits and total fruit weight in wild, transgenic and double transgenic under 0, 07, 14 and 21 days of water deficit
Events	Total fruit number				Total fruit weight
Events	0 Days	07 Days	14 Days	21 Days	0 Days	07 Days	14 Days	21 Days
H86	14.22 ± 0.65^ab	12.25 ± 0.44^b	7.22 ± 0.44^c	5.21 ± 0.22^c	1142 ± 89^d	1004 ± 39^d	0552 ± 19^e	361 ± 12^e
D86	15.12 ± 0.79^a	13.78 ± 0.53^ab	8.62 ± 0.59^ab	6.33 ± 0.45^b	1433 ± 45^c	1275 ± 55^c	0902 ± 56^d	623 ± 15^d
ZT1	16.88 ± 0.46^a	15.44 ± 0.78^a	9.03 ± 0.63^a	6.53 ± 0.51^ab	1477 ± 33^c	1334 ± 47^b	1029 ± 37^c	655 ± 23^c
DZ1	15.33 ± 0.39^a	14.98 ± 0.88^a	9.22 ± 0.44^a	6.39 ± 0.39^b	1488 ± 55^b	1339 ± 68^b	1093 ± 77^b	677 ± 37^b
DZ2	15.85 ± 0.77^a	14.33 ± 0.91^a	8.79 ± 0.22^ab	6.78 ± 0.22^ab	1502 ± 69^ab	1348 ± 79^b	1104 ± 52^ab	723 ± 33^ab
DZ3	15.35 ± 1.02^a	14.67 ± 1.11^a	8.63 ± 0.59^ab	6.93 ± 0.55^ab	1493 ± 63^b	1333 ± 53^b	1081 ± 26^b	678 ± 45^b
DZ4	16.67 ± 0.66^a	14.33 ± 0.73^a	8.55 ± 0.41^ab	7.43 ± 0.51^a	1559 ± 71^ab	1361 ± 38^b	1072 ± 51^b	653 ± 11^c
DZ5	17.88 ± 0.97^a	15.89 ± 1.05^a	9.88 ± 0.53^a	7.78 ± 0.44^a	1622 ± 33^a	1529 ± 55^a	1133 ± 22^a	764 ± 27^a
The results are mean ± SE of triplicate measurements. Means followed by the same letter along same row are not significantly different (P ≤ 0.05), according to Duncan’s multiple range test.

3.10. Relative gene expression

Relative expression of seven different antioxidant enzyme genes was measured under control, 7, 14 and 21 DWD through RT-PCR. Respective increase in APX gene expression measured after 7, 14, and 21 DWD, and it was observed that a continuous increase takes place in, NT, ST, and DT plants; however, it was higher in DT lines. After 7 DWD it was maximum for DZ5 with 1.98 fold increase compared to control plants (Fig. 3a). Further, CAT expression was measured under the similar condition and it was observed that the CAT expression increases maximum by 1.68, 1.92 and 2.38 as compared to control under 7, 14, and 21 DWD respectively for DZ5, DZ2, and DZ5, however, it was minimum for H86 under similar condition (Fig. 3b). GR expression increases maximum by 2.22 fold in DZ1 under 7 DWD than control plants. However, under 14 DWD it followed the trend DZ1 > DZ5 > DZ3 > ZT1 > DZ2 > D86 > DZ4. GR expression was highest after 21 DWD as compared control plants, with a maximum fold increase of 3.45 fold in DZ5 (Fig. 3c). The expression of SOD increases under 7, 14 and 21 DWD compared to control plants, under 7 DWD the expression level of SOD rises by 2.12 fold as compared to the respective value under control condition. Similarly, under 14 and 21 DWD the DZ5 and DZ3 noted maximum with respective fold increases in SOD expression of 4.52 and 4.93 than control plants (Fig. 3d). The rise in the expression level of DHAR and MDHAR genes were also recorded after 7, 14, and 21 DWD. After 7 DWD the DHAR expression increases highest by 1.77 fold DZ1 as compared to control plant. Similarly, it was highest 2.12 fold under 14 DWD and 2.89 fold in DZ4 under 21 DWD, for the same plants, compared to control condition (Fig. 4a). MDHAR gene expression was highest in DT line DZ4 with a respective fold increase of 3.13 compared to control, under 7 DWD. After 14 DWD it was highest in DZ5 with respective fold increase of 3.47. Similarly, it increases maximum by 3.62 fold for DZ4, and DZ5, as compared to the fold change under control conditions after 21 DWD (Fig. 4b). As in the case of APX, CAT, GR, SOD, DHAR, and MDHAR gene expression, the level of POD expression also rise under water-deficit condition. After 7 DWD POD expression level was highest in DT line DZ4 followed by DZ5 and DZ2 with respective fold change rise 2.45, 2.43 and 2.33. Similarly, after 14 and 21 DWD, it was noticed maximum in DZ5 with respective value 2.44 and 3.82, followed by DZ3 with respective fold change, 2.33 and 3.67 as compared to control (Fig. 4c).

Plant water interaction plays a significant role during initiation and modulation of the antioxidant protective system against water deficit stress. Expanding proofs are available which recommends the oxidative stress which might be the major plants harming factor presented under distressing conditions (Rai et al. 2012b). To increase resistance against drought stress in tomato plants developed DT plants over-expressing two transcription factors: AtDREB1A and BcZAT12. Longer exposer to drought stress causes ROS over-generation, which disrupts the metabolism of plants, prompts oxidative harm to the cellular components (Alexieva et al. 2001), and has significant involvement in decreased yield efficiency under stress conditions. APX, CAT, GR, SOD, DHAR, MDHAR, and POD are the crucial enzymatic antioxidants which perform a critical role in plants protection against severe damages generated due to oxidative stresses. Many reports suggested elevated antioxidant activities, in abiotic stress tolerance genes expressing transgenic plants (Krishna et al. 2019; Krishna et al. 2021). Earlier reports presented the impacts on enzymatic and non-enzymatic antioxidant system under drought stress in DREB1A and BcZAT transgenic plants (Rai et al. 2012a; Rai et al. 2013b), although, there combined impact was yet to be explored. Hence, the current experiment was conducted to explore the variation in transgenic tomato plants antioxidant mechanisms carrying AtDREB1A and BcZAT12 transcription factors jointly. The joint overexpression of AtDREB1A and BcZAT12 transcription factors observed effective and accepted strategy for genetic engineering of plant developed to increase tolerance against drought stress (Rai et al. 2012a; Rai et al. 2013b). Additionally, the gene-stacking strategy paves the way to make transgenic plants capable to grow and survive better under abiotic stress conditions (Kudo et al. 2017), by the following (a) ionic and osmotic maintenance through homeostasis, (b) growth and cell division control, and (c) cellular repair through detoxification (Saijo et al. 2000). The study showed that, AtDREB1A and BcZAT12 system might function mediated through protection of ionic and osmotic homeostasis. Increased expression of AtDREB1A and BcZAT12 genes enhance the quantity of GR, which most likely contribute in the detoxification of ROS, as AtDREB1A and BcZAT12 pathway genes control GSH homeostasis, supporting survival and growth of plants even under the number of abiotic oxidative stresses in distinct species (Rai et al. 2013b; Rai et al. 2102a). The two transcription factors additive overexpression is accepted to be an efficient approach for plant genetic engineering intended to elevate the tolerance against drought stress and improve plant growth.

An expanded drought stress resistance of tomato plants over-expressing AtDREB1A and BcZAT12 separately and regulation of AtDREB1A and BcZAT12 expression were accounted by Rai et al. (2012b, b). In the present study tomato plants over-expressing both AtDREB1A and BcZAT12 jointly were compared for their drought tolerance and various biochemical parameters with respect to ST and NT plants. Expression levels of various antioxidants genes were elevated in transgenic plants compared to NT plants, although, appeared higher in DT plants with respect to the single and NT plants, which showed their additive effects.

In the present study the enhanced O.⁻₂ level recorded with rising days of drought stress in NT, ST, and DT lines emerge to be linked with time and severity of stress. The generation of O.⁻² demonstrated to reliant on the level of stress, duration, plant age, and species (Rai et al. 2012a). Diminished superoxide anion generation is reminiscent of enhanced cell ROS homeostasis in DT tomato lines contrasted with ST and NT. In the current study, the drought stress treated AtDREB1A and BcZAT12 DT tomato plants showed significantly elevated CAT and SOD activity in comparison to their ST and NT corresponding plants, more specifically the DT lines DZ3 and DZ5. Under stress condition SOD mediates the removal of superoxide radicals; it evacuates O₂ by catalyzing its dismutation. Earlier under drought stress critical increment in SOD activity has been seen in a number of muskmelon genotypes with better drought tolerance capability (Ansari et al. 2017; Ansari et al. 2018; Ansari et al. 2019), and ST tomato plants over-expressing BcZAT12 (Rai et al. 2012a) and AtDREB1A (Rai et al. 2013a), additionally drought tolerant transgenic peanut (Bhatnagar et al. 2009), chrysanthemum (Hong et al. 2006), and Lolium perenne plants (Li et al. 2011) over-expressing AtDREB1A. In cherry tomato enhanced activity of CAT was reported particularly drought exposed tolerant varieties (Bhatnagar et al. 2009), and ST plants over-expressing AtDREB1A and BcZAT12, individually. Enhanced expression of CAT gene in transgenic tomato plants in reaction to heterologous over-expression of AtCBF1 has been reported (Gill et al. 2013). Similar to CAT gene expression, under drought stress catalase the activity was also higher in constitutively over-expressing DT plants of tomato comparatively with the ST and NT plants. In the current experiment, in addition to enhanced APX expression, increased APX activity was also recorded in DT and ST tomato plants exposed to different water deficit condition, however, it was higher in DT lines compared to ST and NT plants. When exposed to drought stress condition enhanced the expression of APX has been reported in many plants, viz., tomato (Rodriguez et al. 2010), muskmelon (Ansari et al. 2017), and APX enhanced activity in ST AtDREB1A (Rai et al. 2013a) and BcZAT12 (Rai et al. 2012a) separately over-expressing. In the present study, drought treated DT tomato lines showed significantly increased gene expression and activities compared to ST and NT plants, if see in DT lines DZ5 showed the highest gene expression and enzyme activities. An increased expression of GR was recorded in drought stress treated muskmelon (Ansari et al. 2017), and GR enzyme activity in rice (Sharma and Dubey 2005) and ST tomato (Rai et al. 2012b; Rai et al. 2013a) plants. In the current experiments, increased activities of DHAR up to 14 days and MDHAR up to 21 days of drought stress were observed in the DT tomato lines in comparison to counterpart ST and NT plants. Many reports are available which showed DHAR and MDHAR over-expressing transgenic plants exhibit a higher AsA level (Yin et al. 2010). The elevated MDHAR activity is responsible for drought tolerance in ST tomato (Rai et al. 2012a; Rai et al. 2013a) and cherry tomato (Rodriguez et al. 2010). As reported earlier AtDREB1A (Rai et al. 2012b) over-expressing transgenic tomato plants POD activity was random as it decreases initially then increases and again decreases, instead of this in BcZAT12 (Rai et al. 2012a) transgenic increase noted up to 14 days of water deficit then reduction observed after 21 days of water deficits, in the case of our DT lines the results were similar to BcZAT12, but the level of POD was higher, this might be due to the additive effects of both genes (Kudo et al. 2017). These enzymatic changes bolster the suggestion that AtDREB1A and BcZAT12 over-expressing DT tomato plants eases stress actuated oxidative damages and adjust promptly to the drought stress condition. Observations supplements the knowledge about the proper adjustment of oxidative stress in ST plants over-expressing AtDREB1A and BcZAT12 gene, which is mostly controlled through the enzymes like SOD, CAT, APX, GR and POD (Rai et al. 2012a; Rai et al. 2013b). It responds by neutralizing ROS to limit the harm, having the capability for electrons donation in various non-enzymatic and enzymatic responses, and furthermore goes about as an inherent substrate for numerous plant peroxidases (Gill et al. 2013). It is well recognized that amount of AsA enhances under drought conditions in plants, however, the buffering limit produced by AsA adds to resistance against the stress generated (Rai et al. 2012a). For instance, drought-resistant tobacco, poplar, and cherry tomato genotypes showed an increased leaf AsA and notwithstanding this AtDREB1A and BcZAT12 (Rai et al. 2012a; Rai et al. 13a) ST plants additionally indicated a higher measure of AsA which give plants improved resilience to oxidative stress (Rodriguez et al. 2010). The AsA redox framework comprises of MDHA, DHA and L-ascorbic acid. An elevated proportion of reduced to oxidized AsA is required to combat cells ROS (Rodriguez et al. 2010). In this context, transgenic (DT) tomato plants enlisted increased AsA contrasted with the ST and NT plants, and seem to have a more prominent ability to diminish ROS. In plants Glutathione is considered as important metabolite, moreover, its reduced structure GSH accepted as a significant part for intra-cellular defense against ROS-generated oxidative stress. It additionally assumes a significant role in the development and advancement of plants, including differentiation, death, and senescence of the cell, also regulation of enzymes (Rai et al. 2012a). Under drought stress, DT tomato lines displayed higher glutathione content contrasted with the ST and NT plants. GSH assumes a key function in the antioxidative protection pathway by recovering another potential water dissolvable antioxidant like AsA, by means of the AsA-GSH cycle (Gill and Tuteja 2010). The GSH and GSSG equilibrium are the vital requirements in continuing the cellular redox state. Continuation of an enhanced reduced to an oxidized ratio of AsA and glutathione is critical for the appropriate diminishing of the ROS in cells (Choudhury et al. 2017; Miller et al. 2018). An expansion in the AsA and glutathione levels in maize and wheat plants exposed to drought stress has been accounted (Xu et al. 2015; Nayyar and Gupta 2006). In the current experiment, drought stress treated DT tomato lines exhibited distinctly enhanced activities of these enzymes than their ST and NT counterparts. In short, the results of the present study showed that AtDREB1A and BcZAT12 additive overexpression brought about a more prominent actuation of the segments of Halliwell Asada cycle under the conditions of drought stress in DT lines (Fig. 5). The amount of AsA, reduced AsA, glutathione, and GSH in the DT tomato lines demonstrated a positive interaction with ROS level. Accordingly, it might be reasoned that the upgraded oxidative stress resilience under drought stress condition was related to the additive expression of DT lines, which expanded the activities of these enzymes. These backings the conclusion that the enhanced antioxidant levels in ST added to bring down the ROS and a superior osmotic alteration prompting improved drought stress resistance (Rai et al. 2012a). In the current investigation, the activities of the important antioxidant enzymes, were significantly higher in DT tomato lines, overall the DT tomato lines exposed to drought stress exhibited reduced oxidative stress comparatively the ST and NT plants. Under drought stress conditions in DT lines, the amount of enzymatic and non-enzymatic antioxidants was more prominent. This demonstrates about the DT tomato lines increased resistance against drought. The enhanced expression of genes linked with antioxidants may be an outcome of the additive expression of AtDREB1A and BcZAT12 genes under drought stress presenting the DT tomato lines increasingly valuable for zones affected with drought stress. Drought mediated diminution of leaf pigments is accepted as an indicator of oxidative stress which associates with the degradation of chlorophyll, photo-oxidation of pigment, or retardation in chlorophyll synthesis (Rai et al. 2012a). Similarly in the current experiments, the photosynthesis pigments degradation observed, however, it was lower in DT compared to the ST and NT plants.

Under drought stress, plants show lower fruit yield in tomato (Topcu et al. 2007; Jensen et al. 2010); which might be attributed to delayed physiological processes (Cabello et al. 2009; Ibrahim et al. 2014; Dasgan et al. 2018). On the contrary, the present study revealed that double transgenic tomato lines recorded higher fruit yield as compared single transgenic (AtDREB1A or BcZAT12 or NT) under different DWD. This increase in fruit yield may be attributed to normal physiological processes under water deficit conditions. Some earlier studies reported that quality parameters such as hardness, TSS, ascorbic acid, acidity, and colour get enhanced in tomato under water deficit condition. Furthermore, reduced fruit size and low dilution from decreased water levels may result in reduced water transport within the plant system but not the photo-assimilates (Zegbe et al. 2006); thereby the improvement in quality parameters. Under drought stress conditions, double transgenic tomato lines from the present study showed increased fruit size.

In conclusion, in the present study DT tomato lines showed an enhanced antioxidant enzyme activity under drought stress condition. Present results suggest that AtDREB1A and BcZAT12 stacked DT tomato line more specifically DZ3, DZ4, and DZ5 are increased tolerant to drought stress and able to survive due to increased antioxidant activity, suggesting their significance for enhancing the fruit yield in the drought-affected area. The findings of the present study demonstrate that genetic engineering of the plant by employing approaches like gene-stacking might be effective for transgenic plants generation which had better tolerance against drought stress. Additionally, co-overexpression of AtDREB1A and BcZAT12 increases the transgenic lines performance as depicted by various enzymatic and non-enzymatic antioxidants (Fig. 6), total chlorophyll content, and genes linked with various antioxidative enzymes, and phenotypic traits.

Funding: The present research work was funded by Indian Council of Agriculture Research (ICAR), New Delhi under the scheme National Project on Transgenic Crops (NPTC)

Conflict of Interest/Competing interests: All authors declare that there is no conflict of interest among the authors.

Availability of data and material: All the data are presented in the manuscript and the materials used in this research work are with ICAR-Indian Institute of Vegetable Research (IIVR), Varanasi, India

Code availability: Not Applicable

Author's contribution: RK performed all the experiment and initial manuscript draft writing. WAA analyzed the data and helped in manuscript preparation. DKJ helped in data recording. MS developed the project idea and fund. RP, MS and JPV edited the manuscript.

Acknowledgements: The present study is the part of National Project on Transgenic Crops (NPTC), funded by Indian Council of Agriculture Research (ICAR), New Delhi. The authors gratefully acknowledge to The Director, ICAR-Indian Institute of Vegetable Research (IIVR), Varanasi, India for providing infrastructure facilities to conduct the present study and Jay Kumar Patel for assistance in glass house experiments.

Alexieva V, Sergiev I, Mapelli S, Karanov E (2001) The effect of drought and ultraviolet radiation on growth and stress markers in pea and wheat. Plant Cell Environ 24:1337–1344. https://doi.org/10.1046/j.1365-3040.2001.00778.x

Ansari WA, Atri N, Singh B, Kumar P, Pandey S (2018) Morpho-physiological and biochemical responses of muskmelon genotypes to different degree of water deficit. Photosynthetica 56:1019–1030. https://doi.org/10.1007/s11099-018-0821-9

Ansari WA, Atri N, Ahmad J, Qureshi MI, Singh B, Kumar R, Singh B, Pandey S (2019) Drought mediated physiological and molecular changes in muskmelon (Cucumis melo L.). PLoS ONE 14:e0222647. https://doi.org/10.1371/journal.pone.0222647

Ansari WA, Atri N, Singh B, Pandey S (2017) Changes in antioxidant enzyme activities and gene expression in two muskmelon genotypes under progressive water stress. Biol Plat 61:333–341. https://doi.org/10.1007/s10535-016-0694-3

Arnon DI (1949) Copper enzymes in isolated chloroplasts. Polyphenoloxidase in Beta vulgaris. Plant Physiol 24:1. doi 10.1104/pp.24.1.1

Asada K (2006) Production and scavenging of reactive oxygen species in chloroplasts and their functions. Plant Physiol 141:391–396. https://doi.org/10.1104/pp.106.082040

Baghour M, Gálvez FJ, Sánchez ME, Aranda MN, Venema K, Rodríguez-Rosales MP (2019) Overexpression of LeNHX2 and SlSOS2 increases salt tolerance and fruit production in double transgenic tomato plants. Plant Physiol Biochem 135:77–86. https://doi.org/10.1016/j.plaphy.2018.11.028

Bhatnagar-Mathur P, Devi MJ, Vadez V, Sharma KK (2009) Differential antioxidative responses in transgenic peanut bear no relationship to their superior transpiration efficiency under drought stress. J Plant Physiol 166:1207–1217. https://doi.org/10.1016/j.jplph.2009.01.001

Choudhury FK, Rivero RM, Blumwald E, Mittler R (2017) Reactive oxygen species, abiotic stress and stress combination. Plant J 90:856–867. https://doi.org/10.1111/tpj.13299

Coyago-Cruz E, Corell M, Stinco CM, Hernanz D, Moriana A, Meléndez-Martínez AJ (2017) Effect of regulated deficit irrigation on quality parameters, carotenoids and phenolics of diverse tomato varieties (Solanum lycopersicum L.). Food Res Int 96:72–83. https://doi.org/10.1016/j.foodres.2017.03.026

FAOSTAT database, Food and Agriculture Organization Corporate Statistical Database (2012) Available at: http://www.faostat.fao.org

Foolad MR (2007) Current status of breeding tomatoes for salt and drought tolerance. In: Advances in molecular breeding toward drought and salt tolerant crops. Springer, Dordrecht, pp 669–700

Gill SS, Gill R, Anjum NA, Tuteja N (2013) Transgenic approaches for abiotic stress tolerance in crop plants. Plant Stress 7:73–83

Gill SS, Tuteja N (2010) Reactive oxygen species and antioxidant machinery in abiotic stress tolerance in crop plants. Plant Physiol Biochem 48:909–930. https://doi.org/10.1016/j.plaphy.2010.08.016

Gilmour SJ, Sebolt AM, Salazar MP, Everard JD, Thomashow MF (2000) Overexpression of the Arabidopsis CBF3 transcriptional activator mimics multiple biochemical changes associated with cold acclimation. Plant Physiol 124:1854–1865. https://doi.org/10.1104/pp.124.4.1854

Guo X, Zhang L, Zhu J, Wang A, Liu H (2017) Christolea crassifolia HARDY gene enhances drought stress tolerance in transgenic tomato plants. Plant Cell Tissue Organ Cult 129:469–481. https://doi.org/10.1007/s11240-017-1192-9

Hong B, Tong Z, Ma N, Li J, Kasuga M, Yamaguchi-Shinozaki K, Gao J (2006) Heterologous expression of the AtDREB1A gene in chrysanthemum increases drought and salt stress tolerance. Sci China Life Sci 49:.436–445. https://doi.org/10.1007/s11427-006-2014-1

Huang J, Yang X, Wang MM, Tang HJ, Ding LY, Shen Y, Zhang HS (2007) A novel rice C2H2-type zinc finger protein lacking DLN-box/EAR-motif plays a role in salt tolerance. Biochimica et Biophysica Acta (BBA)-Gene Structure and Expression 1769: 220–227. https://doi.org/10.1016/j.bbaexp.2007.02.006

Karkute SG, Krishna R, Ansari WA, Singh B, Singh PM, Singh M, Singh AK (2019) Heterologous expression of the AtDREB1A gene in tomato confers tolerance to chilling stress. Biol Plant 63:268–277. https://doi.org/10.32615/bp.2019.031

Kiełbowicz-Matuk A (2012) Involvement of plant C2H2-type zinc finger transcription factors in stress responses. Plant Sci 185:78–85. https://doi.org/10.1016/j.plantsci.2011.11.015

Krishna R, Karkute SG, Ansari WA, Jaiswal DK, Verma JP, Singh M (2019) Transgenic tomatoes for abiotic stress tolerance: status and way ahead. 3 Biotech 9:143. https://doi.org/10.1007/s13205-019-1665-0

Krishna R, Ansari WA, Jaiswal DK, Singh AK, Verma JP, Singh M (2021) Co-overexpression of AtDREB1A and BcZAT12 increases drought tolerance and fruit production in double transgenic tomato (Solanum lycopersicum) plants. Environ Exp Bot 184:104396. https://doi.org/10.1016/j.envexpbot.2021.104396

Kudo M, Kidokoro S, Yoshida T, Mizoi J, Todaka D, Fernie AR, … Yamaguchi-Shinozaki K (2017) Double overexpression of DREB and PIF transcription factors improves drought stress tolerance and cell elongation in transgenic plants. Plant Biotechnol J 15:458–471. https://doi.org/10.1111/pbi.12644

Law MY, Charles SA, Halliwell B (1983) Glutathione and ascorbic acid in spinach (Spinacia oleracea) chloroplasts. The effect of hydrogen peroxide and of paraquat. Biochem J 210: 899–903.

Li X, Cheng X, Liu J, Zeng H, Han L, Tang W (2011) Heterologous expression of the Arabidopsis DREB1A/CBF3 gene enhances drought and freezing tolerance in transgenic Lolium perenne plants. Plant Biotechnol Rep 5:61–69. https://doi.org/10.1007/s11816-010-0157-9

Liu T, Hu X, Zhang J, Zhang J, Du Q, Li J (2018) H₂O₂ mediates ALA-induced glutathione and ascorbate accumulation in the perception and resistance to oxidative stress in Solanum lycopersicum at low temperatures. BMC Plant Biol 18:34.

Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2 – ∆∆CT method. Methods 25:402–408. https://doi.org/10.1006/meth.2001.1262

Miller G, Suzuki N, Ciftci-Yilmaz S, Mittler R (2010) Reactive oxygen species homeostasis and signalling during drought and salinity stresses. Plant Cell Environ 33:453–467. https://doi.org/10.1111/j.1365-3040.2009.02041.x

Miller G, Coutu J, Shulaev V, Mittler R (2018) Reactive oxygen signaling in plants. Annu Plant Rev online 33:189–201. https://doi.org/10.1002/9781119312994.apr0353

Nahakpam S, Shah K (2011) Expression of key antioxidant enzymes under combined effect of heat and cadmium toxicity in growing rice seedlings. Plant Growth Regul 63:23–35. https://doi.org/10.1007/s10725-010-9508-3

Nakano Y, Asada K (1981) Hydrogen peroxide is scavenged by ascorbate-specific peroxidase in spinach chloroplasts. Plant Cell Physiol 22:867–880. https://doi.org/10.1093/oxfordjournals.pcp.a076232

Nayyar H, Gupta D (2006) Differential sensitivity of C3 and C4 plants to water deficit stress: association with oxidative stress and antioxidants. Environ Exp Bot 58:106–113. https://doi.org/10.1016/j.envexpbot.2005.06.021

Owens CWI, Belcher RV (1965) A colorimetric micro-method for the determination of glutathione. Biochem J 94:705–7011. https://doi.org/10.1042/bj0940705

Pék Z, Szuvandzsiev P, Daood H, Neményi A, Helyes L (2014) Effect of irrigation on yield parameters and antioxidant profiles of processing cherry tomato. Open Life Sci 9:383–395. https://doi.org/10.2478/s11535-013-0279-5

Persikov AV, Singh M (2014) De novo prediction of DNA-binding specificities for Cys2His2 zinc finger proteins. Nucleic Acids Res 42:97–108. https://doi.org/10.1093/nar/gkt890

Persikov AV, Wetzel JL, Rowland EF, Oakes BL, Xu DJ, Singh M, Noyes MB (2015) A systematic survey of the Cys2His2 zinc finger DNA-binding landscape. Nucleic Acids Res 43:1965–1984. https://doi.org/10.1093/nar/gku1395

Porra RJ, Thompson WA, Kriedemann PE (1989) Determination of accurate extinction coefficients and simultaneous equations for assaying chlorophylls a and b extracted with four different solvents: verification of the concentration of chlorophyll standards by atomic absorption spectroscopy. Biochimica et Biophysica Acta (BBA)-Bioenergetics 975:384–394. https://doi.org/10.1016/S0005-2728(89)80347-0

Rai AC, Singh M, Shah K (2012a) Effect of water withdrawal on formation of free radical, proline accumulation and activities of antioxidant enzymes in ZAT12-transformed transgenic tomato plants. Plant Physiol Biochem 61:108–114. https://doi.org/10.1016/j.plaphy.2012.09.010

Rai AC, Singh M, Shah K (2013b) Engineering drought tolerant tomato plants over-expressing BcZAT12 gene encoding a C2H2 zinc finger transcription factor. Phytochemistry 85:44–50. https://doi.org/10.1016/j.phytochem.2012.09.007

Rai GK, Rai NP, Kumar S, Yadav A, Rathaur S, Singh M (2012b) Effects of explant age, germination medium, pre-culture parameters, inoculation medium, pH, washing medium, and selection regime on Agrobacterium-mediated transformation of tomato. In Vitro Cell Dev Biol Plant 48:565–578. https://doi.org/10.1007/s11627-012-9442-3

Rai GK, Rai NP, Rathaur S, Kumar S, Singh M (2013a) Expression of rd29A:: AtDREB1A/CBF3 in tomato alleviates drought-induced oxidative stress by regulating key enzymatic and non-enzymatic antioxidants. Plant Physiol Biochem 69:90–100. https://doi.org/10.1016/j.plaphy.2013.05.002

Ravikumar G, Manimaran P, Voleti SR, Subrahmanyam D, Sundaram RM, Bansal KC, … Balachandran SM (2014) Stress-inducible expression of AtDREB1A transcription factor greatly improves drought stress tolerance in transgenic indica rice. Transgenic Res 23:421–439. https://doi.org/10.1007/s11248-013-9776-6

Reddy AR, Chaitanya KV, Vivekanandan M (2004) Drought-induced responses of photosynthesis and antioxidant metabolism in higher plants. J Plant Physiol 161:1189–1202. https://doi.org/10.1016/j.jplph.2004.01.013

Rozen S, Skaletsky HJ (1998) Primer3. Code available at http. www-genome. wi. mit. edu/genome_software/other/primer3. html

Saijo Y, Hata S, Kyozuka J, Shimamoto K, Izui K (2000) Over-expression of a single Ca2+‐dependent protein kinase confers both cold and salt/drought tolerance on rice plants. Plant J 23:319–327. https://doi.org/10.1046/j.1365-313x.2000.00787.x

Sánchez-Rodríguez E, Romero L, Ruiz JM (2016) Accumulation of free polyamines enhances the antioxidant response in fruits of grafted tomato plants under water stress. J Plant Physiol 190:72–78. https://doi.org/10.1016/j.jplph.2015.10.010

Sánchez-Rodríguez E, Rubio-Wilhelmi M, Cervilla LM, Blasco B, Rios JJ, Rosales MA, … Ruiz JM (2010) Genotypic differences in some physiological parameters symptomatic for oxidative stress under moderate drought in tomato plants. Plant Sci 178:30–40. https://doi.org/10.1016/j.plantsci.2009.10.001

Saxena I, Srikanth S, Chen Z (2016) Cross talk between H₂O₂ and interacting signal molecules under plant stress response. Front Plant Sci 7:570.

Shah K, Kumar RG, Verma S, Dubey RS (2001) Effect of cadmium on lipid peroxidation, superoxide anion generation and activities of antioxidant enzymes in growing rice seedlings. Plant Sci 161:1135–1144. https://doi.org/10.1016/S0168-9452(01)00517-9

Shah K, Singh M, Rai AC (2013) Effect of heat-shock induced oxidative stress is suppressed in BcZAT12 expressing drought tolerant tomato. Phytochemistry 95:109–117. https://doi.org/10.1016/j.phytochem.2013.07.026

Shah K, Singh M, Rai AC (2015) Bioactive compounds of tomato fruits from transgenic plants tolerant to drought. LWT-Food Sci Technol 61:609–614. https://doi.org/10.1016/j.lwt.2014.12.057

Sharma P, Dubey RS (2005) Modulation of nitrate reductase activity in rice seedlings under aluminium toxicity and water stress: role of osmolytes as enzyme protectant. J Plant Physiol 162:854–864. https://doi.org/10.1016/j.jplph.2004.09.011

Sharma P, Jha AB, Dubey RS, Pessarakli M (2012) Reactive oxygen species, oxidative damage, and antioxidative defense mechanism in plants under stressful conditions. J Bot 2012. https://doi.org/10.1155/2012/217037

Sun SJ, Guo SQ, Yang X, Bao YM, Tang HJ, Sun H, … Zhang HS (2010) Functional analysis of a novel Cys2/His2-type zinc finger protein involved in salt tolerance in rice. J Exp Bot 61:2807–2818.

Tateishi Y, Nakagawa T, Esaka M (2005) Osmotolerance and growth stimulation of transgenic tobacco cells accumulating free proline by silencing proline dehydrogenase expression with double-stranded RNA interference technique. Physiol Plant 125:224–234. https://doi.org/10.1111/j.1399-3054.2005.00553.x

Xu Y, Xu Q, Huang B (2015) Ascorbic acid mitigation of water stress-inhibition of root growth in association with oxidative defense in tall fescue (Festuca arundinacea Schreb.). Front Plant Sci 6:807. https://doi.org/10.3389/fpls.2015.00807

Yin L, Wang S, Eltayeb AE, Uddin MI, Yamamoto Y, Tsuji W, Takeuchi Y, Tanaka K (2010) Overexpression of dehydroascorbate reductase, but not monodehydroascorbate reductase, confers tolerance to aluminum stress in transgenic tobacco. Planta 231:609–621. https://doi.org/10.1007/s00425-009-1075-3

Zhang H, Liu Y, Wen F, Yao D, Wang L, Guo J, … Jiang M (2014) A novel rice C2H2-type zinc finger protein, ZFP36, is a key player involved in abscisic acid-induced antioxidant defence and oxidative stress tolerance in rice. J Exp Bot 65:5795–5809. https://doi.org/10.1093/jxb/eru313

Download PDF

Editorial decision: Minor revisions
29 Apr, 2021
Reviews received at journal
09 Apr, 2021
Reviewers invited by journal
07 Apr, 2021
Editor assigned by journal
04 Apr, 2021
First submitted to journal
27 Mar, 2021

You are reading this latest preprint version

Overexpression of AtDREB1 and BcZAT12 Genes Confers Drought Tolerance by Reducing Oxidative Stress in Double Transgenic Tomato (Solanum Lycopersicum Mill.)

Status:

Version 1

Abstract

Figures

Key Message

1. Introduction

2. Method And Materials

2.1. Plant material and drought stress

2.2. Phyto-pigments (chlorophyll and carotenoid)

2.3. Superoxide radical (O^·−₂) measurement

2.4. Ascorbate peroxidase (APX) activity assay

2.5. Catalase (CAT) activity assay

2.6. Glutathione reductase (GR), dehydroascorbate reductase (DHAR) and monodehydroascorbate reductase (MDHAR) activity assay

2.7. Superoxide dismutase (SOD) activity assay

2.8. Guaiacol peroxidase (POD) activity assay

2.9. Glutathione assay

2.10. Ascorbate (AsA) assay

3. Results

3.1. Chlorophyll and carotenoid

3.2. Superoxide radical (O^·−₂)

3.3. Ascorbate peroxidase and catalase activity

3.4. Glutathione reductase and super oxide dismutase activity

3.5. Dehydroascorbate and monodehydroascorbate reductase activity

3.6. Guaicol peroxidase activity

3.7. Ascorbate

3.8. Glutathione

3.9. Number of fruit number and fruit weight

3.10. Relative gene expression

4. Discussion

5. Conclusion

Declarations

References

Status:

Version 1

Overexpression of AtDREB1 and BcZAT12 Genes Confers Drought Tolerance by Reducing Oxidative Stress in Double Transgenic Tomato (Solanum Lycopersicum Mill.)

Status:

Version 1

Abstract

Figures

Key Message

1. Introduction

2. Method And Materials

2.1. Plant material and drought stress

2.2. Phyto-pigments (chlorophyll and carotenoid)

2.3. Superoxide radical (O·−2) measurement

2.4. Ascorbate peroxidase (APX) activity assay

2.5. Catalase (CAT) activity assay

2.6. Glutathione reductase (GR), dehydroascorbate reductase (DHAR) and monodehydroascorbate reductase (MDHAR) activity assay

2.7. Superoxide dismutase (SOD) activity assay

2.8. Guaiacol peroxidase (POD) activity assay

2.9. Glutathione assay

2.10. Ascorbate (AsA) assay

3. Results

3.1. Chlorophyll and carotenoid

3.2. Superoxide radical (O·−2)

3.3. Ascorbate peroxidase and catalase activity

3.4. Glutathione reductase and super oxide dismutase activity

3.5. Dehydroascorbate and monodehydroascorbate reductase activity

3.6. Guaicol peroxidase activity

3.7. Ascorbate

3.8. Glutathione

3.9. Number of fruit number and fruit weight

3.10. Relative gene expression

4. Discussion

5. Conclusion

Declarations

References

Status:

Version 1

2.3. Superoxide radical (O^·−₂) measurement

3.2. Superoxide radical (O^·−₂)