Serotonergic psychedelic 5-MeO-DMT alters plasticity-related gene expression and generates anxiolytic effects in stressed mice

doi:10.21203/rs.3.rs-3787978/v1

Download PDF

Article

Serotonergic psychedelic 5-MeO-DMT alters plasticity-related gene expression and generates anxiolytic effects in stressed mice

https://doi.org/10.21203/rs.3.rs-3787978/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 04 Jul, 2024

Read the published version in Molecular Psychiatry →

You are reading this latest preprint version

Serotonergic psychedelics have potential therapeutic effects in treating anxiety and mood disorders, often after a single dose, and are suggested to have plasticity-inducing action. One lesser studied psychedelic, the 5-methoxy-N, N-dimethyltryptamine (5-MeO-DMT), is suggested to have anxiolytic effects yet a comprehensive mechanism of action is still lacking. Here, we investigated the effects of a single high-dose of the short-acting 5-MeO-DMT on gene expression from microdissected brain regions (anterior cingulate cortex - ACC; basolateral amygdala - BLA; ventral hippocampus CA1 region - vCA1 and dentate gyrus - DG) of naive and stressed mice. Specifically, we compared gene expression of Arc, Zif268, BDNF, CREB, mTORC1, NR2A, TRIP8b and NFkB in mice injected with 5-MeO-DMT or saline at different time points (1 hr, 5 hrs or 5 days prior). 5-MeO-DMT altered mRNA expression of immediate early genes Arc and ZiF268 in the ACC, BLA and vCA1, while only NR2A expression was altered after 5 hrs in the vCA1. We also found a long-term increase in TRIP8b, a gene related to the modulation of neuronal activity, in the vCA1 after 5 days. Behaviorally, 5-MeO-DMT treated mice showed mixed anxiolytic and anxiogenic effects in the elevated plus maze and open field test 24 hr or 5 days after treatment. However, pre-treated mice subjected to acute stress showed both lower corticosterone levels and robust anxiolytic effects of 5-MeO-DMT administration. Together, our findings provide insights into the molecular actions of 5-MeO-DMT in the brain related to anxiolytic effects of behavior.

Biological sciences/Neuroscience

Biological sciences/Physiology

Serotonergic psychedelics have been reported to mitigate anxiety and mood disorders symptoms after just a single dose (1–8) with long-lasting effects likely due to structural plasticity (9–17). Neuroplasticity impairment is presumed to be at the core of psychiatric mood disorders, as it promotes changes in neural circuits that may lead to malfunction (16). Recent studies have demonstrated that psychedelics such as lysergic acid diethylamide (LSD), N,N-Dimethyltryptamine (DMT), 2,5-Dimethoxy-4-iodoamphetamine (DOI), and psilocybin promote dendritic spine growth, increase dendritic arbor complexity and stimulate synapse formation, although results vary among studies (9, 18). Focusing on adult neurogenesis, an important mechanism of antidepressants (19), mainly DMT and its analog 5-methoxy-N,N-dimethyltryptamine (5-MeO-DMT) has shown to increase neurogenesis both in vitro and in vivo (11, 12). In the case of 5-MeO-DMT, a recent study revealed that a single high-dose increased dendritic spine density in the medial prefrontal cortex of mice for at least one month (20). We have previously shown in vitro that a single dose of 5-MeO-DMT stimulates cell proliferation, neuronal survivability, morphological and functional changes in the ventral dentate gyrus of adult mice (11). Furthermore, 5-MeO-DMT has been reported to alter expression of proteins related to cytoskeletal organization in brain organoids after 24 hours of acute treatment, indicating involvement in structural plasticity (21). In addition, for humans, 5-MeO-DMT appears as safe as other serotonergic psychedelics, and has been tested for treatment of anxiety, mood disorders, and alcohol use disorder (3, 4). Thereby, 5-MeO-DMT, similar to other psychedelics and psychotropics, appears to trigger long-term neuronal signaling leading to altered gene expression (22), yet details of how 5-MeO-DMT regulates gene expression is not well understood.

Classic psychedelics activate metabotropic 5-HT2A receptors through a cascade of Gα_q signaling, with downstream inositol phosphate generation and activation of protein kinase C that can modulate synaptic activity (22, 23). Curiously, the fast-acting 5-MeO-DMT has a much higher affinity for the 5-HT1A receptor than the 5-HT2A receptor (24–26), where the 5-HT1A receptor controversially signals via the Gα_i/o pathway to reduce neuronal activity (27, 28) yet also involved in neuritogenesis and synapse formation (29). 5-HT1A receptor activation has also been shown to suppress nitric oxide synthase expression that can lead to cyclic adenosine monophosphate (cAMP) response element binding protein (CREB) activation and mediate anxiolytic effects (28). Furthermore, 5-HT1A receptor activation can lead to stimulation of the transcription factor nuclear factor kappaB (NF-kB) and play a role in structural plasticity in the adult brain (28, 30), making psychedelics acting through 5-HT1A receptors interesting to study.

It has been shown that 5-MeO-DMT can bind the Sigma 1 receptor (31) and the sigma 1 receptor appears to contribute to the therapeutic effect of DMT in Ayahuasca (12, 32). Also, 5-MeO-DMT has been shown to modulate inflammatory response through the sigma-1 receptor in human monocyte-derived dendritic cells (31). Sigma-1 receptor activation also increases the expression of brain-derived neurotrophic factor (BDNF) possibly through the NR2A-CREB-BDNF signaling pathway that regulates synaptic plasticity and is an important factor in controlling stress and anxiety behavior (33–35). NR2A (or GRIN2A) is a gene that encodes the 2A subunit of the N-methyl-D-aspartate (NMDA) receptor, an important channel related to memory and neuronal plasticity. In turn, calcium influx through NMDA receptors can lead to expression of BDNF and other plasticity genes through CREB signaling (36). Next, alterations in BDNF expression can result in structural changes, such as neuritogenesis (9, 37) and increase in BDNF is correlated to antidepressant behavior in rodents (38). Another candidate gene regulating neuronal activity and synaptic plasticity is mTORC1 (9), where the rapamycin (mTOR) pathway is involved in long-term synaptic plasticity and protein translation through activation of BDNF in the synapse, where rapamycin inhibition of mTORC1 can prevent translation of proteins related to long-term potentiation (LTP) (39). Lastly, whether psychedelics such as 5-MeO-DMT affect genes controlling activity of voltage-gated ion channels important for setting neuronal activity is unknown. One gene of interest to study is the tetratricopeptide repeat containing, Rab8b interacting protein (TRIP8b), which is an auxiliary subunit of the hyperpolarization-activated cyclic nucleotide-gated (HCN) channel with potential antidepressant effects (40–42). Still, if 5-MeO-DMT modulates mRNA transcription of any of these plasticity and activity-related genes is largely unknown.

If 5-MeO-DMT has effects on immediate early genes (IEG), such as Arc and Zif268, is also not known but highly interesting as IEGs encode growth factors, such as BDNF, cytoskeletal proteins, and transcription factors, triggering further transcription of late-response genes (22, 43). For example, Arc mRNA is enriched in postsynaptic density regions, and contributes to generation of new synapses (43). Still, the effect of IEG activation and any subsequent long-term structural consequences depend on location of activity. Adult neurogenesis is specific to structures like the subventricular zone and the subgranular zone of the dentate gyrus of the hippocampus (44), while anxiety networks comprise several brain regions and their pattern of activation differs among subtypes of anxiety disorder (45). The prefrontal cortex and limbic system are brain regions involved in stress, anxiety and learned fear (46). Specifically, the ventral hippocampus (vHipp), basolateral amygdala (BLA), and medial prefrontal cortex (mPFC) forms complex circuits that are required for anxiety-like behavior (45, 47). The anterior cingulate cortex (ACC) in rodents comprise the caudal-dorsal division of the mPFC, has extensive connections to the BLA and regulates innate fear (48). Yet, if plasticity-related genes in anxiety-related regions are modulated by psychedelics like 5-MeO-DMT, and its role in anxiety behavior, is not well understood.

Here we analyzed mRNA expression fold changes of a selection of plasticity related genes after a single high-dose of 5-MeO-DMT specifically in the ACC, the BLA, the vCA1 and DG. We also studied emergent anxiolytic effects of 5-MeO-DMT (after 24 hr or 5 days) on mouse behavior under normal conditions as well as after acute stress.

Animals

Adult male C57BL6J mice (n = 66), 8–12 weeks old, housed under a 12 h light / dark cycle, with food and water ad libitum and controlled temperature at 23 ℃, were included and the study approved by the local ethics committee on animal care, Federal University of Rio Grande do Norte (Protocol 110.035/2018) and followed the guidelines of the National Council for the Control of Animal Experimentation (CONCEA), Brazil.

Pharmacology

5-Methoxy-N, N-dimethyltryptamine (5-MeO-DMT, Sigma-Aldrich, M2381) treatment: single intraperitoneal (i.p.) injection of 20 mg/kg, prepared fresh in saline (300µl, 0.9%), (11). Control treatment: saline i.p. injection. A subgroup of mice received an intracerebroventricular (i.c.v.) injection of 5-MeO-DMT (100 µg/µl, 1µl volume) or saline (1µl).

Laser Capture Microdissection (LCM)

C57BL6J male mice (n = 31) were euthanized and the brains quickly dissected and stored at -80 ℃ until cryosectioning, staining and fixation (PALM Protocols – RNA handling, Carl Zeiss). LCM of the ACC, BLA, ventral CA1 and the dentate gyrus was performed in a PALM MicroBeam system as we previously reported (49).

RT-qPCR

RNA extractions were done using the RNeasy Micro Kit (QIAGEN, CA, USA), including a genomic DNA elimination step. Purity and integrity were estimated using an ND8000 spectrophotometer (Thermo Scientific NanoDrop Products, DE, EUA) for quantity and microfluidic analysis (Agilent Technologies’ Bioanalyzer, Agilent, CA, USA). We only acquired samples with RNA Integrity Number over 8.5 (Bioanalyzer RNA 6000 Nano assay), indicative of high-quality RNA (Nogueira et al., 2022). First-strand cDNA was synthesized using the SuperScript IV Reverse Transcriptase (ThermoFisher Scientific, NY, USA) using 90 ng of extracted RNA per sample. Conditions for each cycle of amplification were as follows: heating the RNA-primer mix 5 min at 65 ℃; next, combining the RT reaction mix incubates at 10 min at 55 ℃, then 10 min at 80 ℃. The final cDNA products were amplified using

Green/ROX PCR Mix (QIAGEN, CA, USA) in 10 µL of a reaction mixture using previously designed primers for mouse glyceraldehyde-3-phosphate-dehydrogenase (GAPDH) housekeeping gene (forward: 5’-CCGCCTGGAGAAACCTGCCAAGTAT-3’, reverse: 5’-TTGCTCAGTGTCCTTGCTGGGGT-3’), the values used in the normalization was the mean of the mouse GAPDH gene. The genes of interest (GOI) primers used were as follows: TRIP8b (forward: 5’-TGAGCAACAAGAGAGCAGACC-3’, reverse: 5’-TTGGATGTCACTGGCTTTGC-3’), NR2A (forward: 5’-TGGGACAGTACCCAATGGAA-3’, reverse: 5’-CGTCCAACTTCCCAGTTTTC-3’), BDNF (forward: 5’-CTTTGGGGCAGACGAGAAAG-3’, reverse: 5’-TCTCACCTGGTGGAACTCAG-3’) and CREB (forward: 5’-AAGCAGTGACTGAGGAGCTT-3’, reverse: 5’-GGCATGGATACCTGGGCTAA-3’, mTORC1(forward: 5’- AGAAGGGTCTCCAAGGACGACT – 3’, reverse: 5’- GCAGGACACAAAGGCAGCATTG – 3’) and NFkB (forward: 5’- GAAATTCCTGATCCAGACAAAAAC – 3’, reverse: 5’- ATCACTTCAATGGCCTCTGTGTAG – 3’). Primers AB from control RNA were used from the cDNA synthesis kit. Real-time PCR was performed using a two-step cycling program, with an initial single cycle of 95 ℃ for 10 min, followed by 40 cycles of 95 ℃ for 15 seconds, then 60 ℃ for 1 min, in an ABI ViiA 7 Real-Time PCR System (Applied Biosystems, NY, USA) with Sequence Detector System software v1.2. A first derivative dissociation curve was built (95 ℃ for 1 min, 65 ℃ for 2 min, then ramped from 65 ℃ to 95 ℃ at a rate of ℃/min). Non-template control (NTC) was included in the plate to eliminate the possibility of PCR contamination. The amplification observed of the housekeeping gene was inside the reliable range (cycle threshold, CT > 12).

Open field tests and Elevated Plus Maze

Mice (n = 24, randomized) were tested in the Elevated Plus Maze (EPM, closed and open arms 33 x 6 cm; center 6 x 6 cm; height: 60 cm), or the Open Field (45 x 34 x 16.5 cm). For EPM, animals were placed in the middle facing a closed arm, and for the OF mice were placed in the center (60% of total area) and video recorded (Logitech C920 HD Pro, 30 frames/s) for 10 min/arena. Both arenas were cleaned with ethanol 70% and water between sessions. Ethological analysis of videos was done manually, quantifying protected and unprotected head dips, rearing, return (intends to enter arm but returns), grooming and fecal boli.

Acute Restraint Stress and corticosterone quantification

Mice (n = 11, randomized) were cloistered in a 50 ml conical propylene Falcon® tube (⌀3 cm, 11.5 cm length, customized with ⌀0.5 cm holes along sidewalls, spaced 2 cm) for 20 min. Immediately after the acute restraint stress, mice were tested in the EPM and OF. Tail blood samples were collected before restraint and after tests. Procedures were carried out between 13:00 and 16:00 h. Blood samples were centrifuged (10 min, 4°C at 3,000 rpm), serum collected in aliquots (20µL, stored at − 80°C). We used the DRG® ELISA (EIA-4164) for corticosterone dosage, which used a direct competitive technique for measurement (50). Absorbance was read by a spectrophotometer microplate reader (Epoch, Biotek Industries, Highland park, United States) with Gen5 Data Analysis software.

Analysis and statistics

Relative mRNA levels were determined using the 2^−ΔΔCt method with GAPDH as reference gene (51). Treatment group ΔCt of each gene of interest was compared using a Bayesian linear mixed effect (BLME) model. Random intercept and non-informative prior were used, with Credible Intervals (CIs) and the mean of the posterior distribution used for comparing group differences. A non-overlapping CI indicates that the means are statistically different. The BLME model analyses were implemented in R software (https://www.r-project.org), version 4.2.1, and the rstanarm package.

Locomotion in the EPM and OF was analyzed by custom software (available on https://github.com/xarmison/proj-pca) (52). Each animal was evaluated once (independent observations for experimental factors: treatment and time). The statistical inference of the effect of 5-MeO-DMT on behavior relied on a generalized linear model (GLM) and beta regression (R software). For each model, the mean of the response was equated to a linear combination of the predictors by means of a specific link function according to the requirement for adequate fitting of data. For the effect of 5-MeO-DMT by i.c.v injection, the nonparametric Mann-Whitney test was used. Statistical significance was reported for significance level α = 0.05. Stress-induced corticosterone levels and ethology parameters were compared using unpaired, two-tailed Student’s t-test, p < 0.05 was considered statistically significant. Bars indicate standard error of the mean (SEM).

5-MeO-DMT modulates gene expression in anxiety-related brain structures

To study the influence of 5-MeO-DMT on gene expression we administered 5-MeO-DMT (20 mg/kg, i.p.) or saline solution (0.9%), 1 hour, 5 hours or 5 days before laser capture microdissection of the ACC, BLA and vCA1 (Fig. 1A-B). Brains collected one hour after 5-MeO-DMT (n = 4) or saline administration (n = 4), showed that immediate early gene Arc expression was increased by 5-MeO-DMT in the ACC (fold change 1.2, Fig. 1C) and BLA (fold change 2.1), while decreased in the vCA1 compared to saline (fold change − 1.14). A Bayesian linear mixed effect (BLME) model confirmed Arc mRNA expression to be significantly different in 5-MeO-DMT treated mice compared to control for all regions of interest, as shown by non-overlapping credible intervals (CI) (ACC: 5-MeO-DMT [3.87; 4.35] vs saline [3.08; 3.63]; BLA: 5-MeO-DMT [3,38; 3,93] vs saline [4.49; 4.99]; vCA1: 5-MeO-DMT [5.49; 5.95] vs saline [4.85; 5.42]; blue and red lines, Fig. 1D). For Zif268 mRNA expression, only the BLA region showed a significant increase after 5-MeO-DMT compared to saline (fold change 1.8; CIs BLA: 5-MeO-DMT [-5.37; -4.74] vs saline [-4.54; -4.02]; Fig. 1C-D). Next, BDNF and CREB showed no significant change for either region 1 hr or 5 hrs after 5-MeO-DMT compared to saline treatment (Fig. 1C and 1E-F). Examining late response genes (mTORC1, NR2A, TRIP8b, and NFkB), analyzed 5 hrs after 5-MeO-DMT (n = 6) or saline (n = 6) only showed significant alteration for NR2A in the vCA1 region (fold change − 6.86; CIs vCA1: 5-MeO-DMT [-1.96; -0.61] vs saline [-5.69; -3.90]; Fig. 1E and 1G). The BLA and ACC presented no significant changes in expression of the late response genes (Fig. 1E and 1G). This shows that despite immediate early gene activation in the ACC and BLA areas, none of the examined late response genes altered expression in these regions.

As NR2A expression was decreased hours after 5-MeO-DMT treatment in the vCA1, we also examined possible longer-lasting alterations in mRNA expression 5 days after 5-MeO-DMT treatment (n = 6), or saline (n = 5) specifically in the ventral hippocampus including the dentate gyrus (11). Here, only TRIP8b showed a statistically significant upregulation in the vCA1 (fold change 1.5 vCA1; CI: 5-MeO-DMT [-0.03; 0.49] vs saline [0.51; 1.12]; Fig. 2B and 2D). The dentate gyrus showed no significant alteration in mRNA expression of either examined genes BDNF, CREB, TRIP8b, and NR2A (Fig. 2D). Thereby, our results show that a single dose of 5-MeO-DMT specifically increases TRIP8b expression in the vCA1 5 days after treatment.

5-MeO-DMT treatment promotes anxiolytic behavior in the EPM

Next, male mice (n = 24) were recorded in the elevated plus maze (EPM), either 24 hours or 5 days after administration of 5-MeO-DMT (20 mg/kg, i.p) or saline (four experimental groups, n = 6 per group, Fig. 3A-B). EPM locomotion was analyzed by trajectory traces and position heatmaps (Fig. 3C) focusing on the percentage the animals were inside, or entering, the unprotected open arms of the EPM (Fig. 3D-E). Exploring the statistical effect of 5-MeO-DMT treatment compared to saline using a generalized linear model (GLM) and beta regression showed no effect on time in open arms 24 hrs after treatment, however, 5 days after treatment the animals receiving 5-MeO-DMT spent 2.60 times more time in the open arms compared to the saline group, although not significantly different (Wald test: estimate = 0.98539, std. error = 0.53562, Z = 1.83972, p = 0.06581; Fig. 3F). Comparing the frequency of entries into the open arms (Fig. 3E) showed 5-MeO-DMT to increase the mean ratio of entries into open arms compared to saline (Wald test: estimate = 1.18149, std. error = 0.22676, Z = 5.21038, p = 1.8845e-7; Fig. 3G), independently of day (day 5 vs 24 hrs; Wald test: estimate = -1.04188, std. error = 0.22513, Z = -4.62789, p = 3.6942e-6). Thereby the mean proportion of entries into the open arms is 2.01 and 2.57 times higher after 5-MeO-DMT treatment compared to saline at 24 hrs and 5 days, respectively (Fig. 3G).

5-MeO-DMT treatment reduces entries into the OF central zone

Another test for exploring anxiety-like behavior is the open field (OF) where mice can show preference for staying next to protected edges compared to exploring the open central zone. Mice (n = 24; 4 experimental groups) were recorded in the OF and trajectory and heatmap of spatial position was analyzed from tests 24 hours or 5 days after saline or 5-MeO-DMT treatment (Fig. 4A-C). Quantifying time in the central zone showed no difference by treatment (Wald test: estimate = -0.05061, std. error = 0.20866, Z = -0.24253, p = 0.80837, Fig. 4D), nor over time (Wald test: estimate = -0.29906, std. error = 0.20941, Z = -1.42808, p = 0.15327). Instead, frequency of entries into the central zone showed 5-MeO-DMT treatment to reduce entries compared to saline (Fig. 3E). Statistically, the GLM estimated the effect of 5-MeO-DMT to reduce entries to the central zone by 35.96% compared to saline treatment (Wald test: estimate = -0.44569, std. error = 0.09226, Z = -4.83081, p = 1.3598e-6; Fig. 4G). Thereby the OF test indicated no effect, or opposite to the EPM, an increased anxiety after 5-MeO-DMT treatment.

5-MeO-DMT pretreatment increase resilience to stress

To clarify the contradictory results from the EPM and OF tests, we investigated possible anxiolytic effects of 5-MeO-DMT in stressed animals (acute restraint condition) and administered 5-MeO-DMT by intracerebroventricular (i.c.v.) injections (1µl, 100 µg/µl of 5-MeO-DMT; n = 6 or 1µl saline; n = 5) to avoid any possible metabolic effects (Fig. 5A). Five days after treatment, mice were subjected to an acute restraint condition (20 min) with tail blood samples collected before, and after the stressing condition and subsequent behavioral tests, to quantify corticosterone levels (Fig. 5A). Blood samples showed an increase in serum corticosterone for both groups after stress (saline baseline: 642.3 nmol/L, stress: 1267.1 nmol/L; 5-MeO-DMT baseline: 449.9 nmol/L, stress: 1203.5 nmol/L; p < 0.0001; student’s T-test; Fig. 5B). However, the initial corticosterone levels from 5-MeO-DMT treated mice was significantly lower than for the saline treated mice (p = 0.0327, student’s T-test, Fig. 5B). Stressed mice analyzed in the EPM (Fig. 5C) showed 5-MeO-DMT treated mice to spend longer time in the open arms of EPM compared to saline treated mice (Wald test; estimate = 1.58672, std. error = 0.42514, Z = 3.73221, p = 0.00019; Fig. 5C). Thereby, 5-MeO-DMT pretreatment made stressed mice stay in the open arms of the EPM on average 4.16 times longer compared to saline pretreated stressed mice (Fig. 5C). However, the frequency of entries into the open arms of the EPM was not statistically different between treatment groups (Wald test: estimate = 0.47041, std. error = 0.34213, Z = 1.37494, p = 0.16915, Fig. 5C, right). For the OF, pre-treatment with 5-MeO-DMT increased duration in the central zone by 154.92% (Wald test; estimate = 0.93576, std. error = 0.28351, Z = 3.30058, p = 0.00096; Fig. 5D) but no effect on entries into the central zone. Taken together, stressed mice pre-treated with 5-MeO-DMT spent more time in the unprotected areas of the EPM and OF compared to saline-treated mice. This effect might be due to initial lower levels of serum corticosterone before the acute restraint condition and suggests that 5-MeO-DMT can increase resilience to stress.

5-MeO-DMT treatment increase unprotected exploratory behavior

Lastly, ethological analysis of EPM videos (head dips, rearing, return, grooming, fecal boli) from i.p. injected mice (24hrs and 5 days prior to test) and i.c.v injected (5 days prior) stressed mice first showed significant decrease in protected head dips after 24 hours (Fig. 6A-B, p = 0.032). Five days after 5-MeO-DMT administration mice showed an increase in unprotected head dips, both under normal and stressed conditions (Fig. 6C-D, p = 0.018 and p = 0.016, respectively) and a decrease in protected head dips (Fig. 6C-D, p = 0.001 and p = 0.007, respectively) compared to saline treatment, without affecting baseline behavior (rearing, return, grooming, fecal boli). Thereby 5-MeO-DMT increased the proportion of unprotected head dips compared to protected head dips for all experimental groups (5-MeO-DMT: uDips 84% and pDips 16%; saline: uDips 59% and pDips 41%; Fig. 6E) indicating decreased anxiety-like behavior.

This study quantified genes associated with molecular pathways implicated in plasticity. Our results found 5-MeO-DMT to modulate immediate early genes related to synaptic plasticity and promotes anxiolytic behavior specifically in stressed mice. Particularly noteworthy is the strong downregulation of NR2A after 5 hours, and the enduring upregulation of TRIP8b, in the vCA1 following 5-MeO-DMT treatment. Surprisingly, under our experimental conditions, 5-MeO-DMT did not exert any effect on genes classically involved in synaptic plasticity, such as BDNF.

We found the ACC and BLA regions to show an upregulation of the immediate early gene Arc (or Arg3.1) that encodes an Activity-Regulated Cytoskeletal (ARC) protein related to strength and structure of synapses, plasticity and memory, and is an effector of BDNF, glutamatergic, dopaminergic, and serotonergic signaling (43). Interestingly, for the BLA, 5-MeO-DMT upregulated both Arc and Zif268, where Zif268 (also known as EGR-1) is a plasticity-related gene with expression dependent on synaptic activity and NMDA activation, such as LTP induction can increase Zif268 expression (53). It is interesting that the BLA showed upregulation of Zif268 when the ACC did not. The ACC sends projections to the BLA, providing top-down regulatory control over emotional responses, and in turn, the BLA projects back to the ACC, providing information about emotionally salient stimuli, and the unbalance of this circuit could lead to difficulties in regulating fear and anxiety (45, 48).

Our results revealed a reduction in the NR2A (also known as GRIN2A) in the ventral CA1 5 hours after 5-MeO-DMT treatment, but no change was seen 5 days after treatment. NR2A expression has been shown to promote LTP while NR2B subunit expression promotes long-term depression (LTD) in the CA1 via Ras-guanine nucleotide-releasing factor mediated signaling (54). Whether NR2A down regulation by 5-MeO-DMT causes homeostatic compensation by the NR2B subunit remains to be investigated, but genetic inactivation of NR2A has shown anxiolytic effects in mice (55).

Next, upregulation of TRIP8b (or PEX5l) in the vCA1 five days after 5-MeO-DMT treatment may also affect neuronal activity since TRIP8b regulate activation-kinetics, voltage-dependency and localization of HCN1 in CA1 pyramidal cells (40, 56). Interestingly, HCN channels have been shown to be involved in anxiety and depression (40, 41, 57). Here the net effect of TRIP8b regulation of HCN channels will depend on if channels are located to the soma or dendrites, as either depolarization or dampening of excitability, respectively, are both possible outcomes (42). Interestingly, 5-HT1A receptors are strongly expressed at distal dendrite of CA1 pyramidal cells (13).

As a classic psychedelic, 5-MeO-DMT exhibits non-selective agonism to several 5-HT receptors (58). However, 5-MeO-DMT demonstrates atypical characteristics among psychedelics due a higher (~ 1000 fold) binding affinity to the 5-HT1A receptor compared to the 5HT-2A receptor (18, 59, 60). The 5-HT2A receptor, predominantly expressed on layer 5 pyramidal cells in the prefrontal cortex, has an excitatory effect (14) and interacts with 5-HT1A receptors, to modulate neuronal activity (13). The 5-HT1A receptor is abundant in brain regions related to anxiety, mood, and emotions, and acts predominantly inhibiting local activity, which can have anxiolytic effects (27, 61). Furthermore, 5-HT1A agonists, such as buspirone, are commonly used to treat anxiety and depression and 5-HT1A receptors are highly expressed in the vCA1, and their stimulation leads to the inhibition of LTP (27). Considering these findings, it is reasonable to consider that 5-MeO-DMT acts through the 5-HT1A pathway to inhibit neuronal activity in the ventral hippocampus, thereby possibly contributing to reducing NR2A levels in the vCA1 region. A recent study suggested a metaplastic (dynamic regulation of synaptic plasticity) rather than a hyperplastic mechanism for psychedelic plasticity-induction (62), like previously reported for ketamine (63, 64).

The sigma-1 receptor has been shown to be regulated by N, N-DMT (65). Intracellularly located between the endoplasmic reticulum and the mitochondrial membrane, upon activation, the sigma-1 receptor translocate to the cell membrane and can modulate L-type calcium channels, inhibit voltage-gated sodium channels, inhibit several potassium channels, particularly the Kv1 subfamily (66, 67) and is a potential target for treatment for psychiatric diseases (65, 67, 68). Despite an apparent low affinity for the sigma-1 receptor (59), the potential synergistic effect of sigma-1 receptor and serotonergic receptors would be interesting to further study to understand the conditions that contribute to the long-lasting effects observed during 5-MeO-DMT treatments (31, 65). A recent study has demonstrated that psychedelics such as 5-MeO-DMT can easily cross the cell membrane (69). Thereby, it is possible that 5-MeO-DMT stimulates the translocation of the intracellular sigma-1 receptor to the cell surface, which may change cell membrane ion conductance. Furthermore, sigma-1 activation can increase the expression of BDNF, possibly through the NR2A pathway, and thus play a role in synaptic plasticity (70) and neurotransmission (71). Considering the overall picture, it is plausible that 5-MeO-DMT acts synergistically on several receptors leading to modulated neurotransmission and neuroplasticity, which should be further investigated.

Despite our previous findings, no modifications in the expression of BDNF, mTORC1, CREB, and NF-kB genes were detected. One limitation of our study is that we did not address dose-dependency of 5-MeO-DMT. While psychedelics such as DOI, DMT, and LSD have been reported to have no impact on BDNF mRNA expression, they do influence BDNF protein levels (9). Another study evaluated BDNF protein levels in brain organoids after 24h of 5-MeO-DMT treatment, and again, in this particular case, no changes were reported, although changes were noted in mTORC1, CREB, and NF-kB protein levels (21). This might indicate that 5-MeO-DMT may influence other signaling pathways beyond canonical BDNF, mTORC1, and CREB routes, or systemic factors such as alterations in the HPA axis or in the immune system, that can affect behavior of mice. For example, psychedelics were recently shown to bind directly to the BDNF receptor TrkB (72), thereby it is possible that 5-MeO-DMT could act through the BDNF pathway without altering levels of BDNF. In addition, post-transcriptional mechanisms can influence protein levels without changing RNA levels (73). Still, it is crucial to assess behavioral effects of 5-MeO-DMT to infer emergent behavior from molecular changes. Interestingly, stressed mice showed the clearest anxiolytic effects of 5-MeO-DMT pretreatment, corroborating lower corticosterone levels before the stress test. This highlights how 5-MeO-DMT can rapidly modify corticosterone mediated signaling related to both acute stress and persistent depression possibly by increasing resilience to stress.

In conclusion, this study found a single high-dose of the short-acting compound 5-MeO-DMT induces sustained anxiolytic effects by modulating the mRNA expression of immediate early genes, Arc and Zif268, as well as the NR2A and TRIP8b genes in a region-specific manner. Notably, this modulation occurs without concurrent changes in the expression of key genes associated with neuroplasticity, including BDNF, CREB, mTORC1 and NF-kB at the time points investigated. Moreover, molecular and behavioral findings five days after administration indicate that the therapeutic potential of 5-MeO-DMT extends beyond its subjective effects reported by humans. While subjective effects may enhance therapeutic outcomes, they do not appear to be a necessary condition for substance efficacy (74). In a translational context, these results suggest that 5-MeO-DMT holds promise as a potential therapeutic intervention for psychiatric disorders, and particularly anxiety.

Funding: The Coordination for the Improvement of Higher Education Personnel (CAPES)

Author contribution: MN conceived the project; MN and DG designed the experiments; MN, DG and RA performed the experiments; MN, DG, RA, NC, RM, AS & TZL analyzed the data; MN, TZL and KEL wrote the original-draft with input from DG, and RA; MN and KEL wrote the manuscript; HM and RNL provided resources.

Conflict of interest: The authors declare no conflict of interest.

Palhano-Fontes F, Barreto D, Onias H, Andrade KC, Novaes MM, Pessoa JA, et al. Rapid antidepressant effects of the psychedelic ayahuasca in treatment-resistant depression: a randomized placebo-controlled trial. Psychol Med. 2019;49(4):655–63.
Osório F de L, Sanches RF, Macedo LR, Santos RG dos, Maia-de-Oliveira JP, Wichert-Ana L, et al. Antidepressant effects of a single dose of ayahuasca in patients with recurrent depression: a preliminary report. Rev Bras Psiquiatr Sao Paulo Braz 1999. 2015;37(1):13–20.
Davis AK, So S, Lancelotta R, Barsuglia JP, Griffiths RR. 5-methoxy-N,N-dimethyltryptamine (5-MeO-DMT) used in a naturalistic group setting is associated with unintended improvements in depression and anxiety. Am J Drug Alcohol Abuse. 2019;45(2):161–9.
Barsuglia J, Davis AK, Palmer R, Lancelotta R, Windham-Herman AM, Peterson K, et al. Intensity of Mystical Experiences Occasioned by 5-MeO-DMT and Comparison With a Prior Psilocybin Study. Front Psychol [Internet]. 2018 [cited 2023 Nov 6];9. Available from: https://www.frontiersin.org/articles/10.3389/fpsyg.2018.02459
Ross S, Bossis A, Guss J, Agin-Liebes G, Malone T, Cohen B, et al. Rapid and sustained symptom reduction following psilocybin treatment for anxiety and depression in patients with life-threatening cancer: a randomized controlled trial. J Psychopharmacol Oxf Engl. 2016;30(12):1165–80.
Agin-Liebes GI, Malone T, Yalch MM, Mennenga SE, Ponté KL, Guss J, et al. Long-term follow-up of psilocybin-assisted psychotherapy for psychiatric and existential distress in patients with life-threatening cancer. J Psychopharmacol Oxf Engl. 2020;34(2):155–66.
Sanches RF, de Lima Osório F, Dos Santos RG, Macedo LRH, Maia-de-Oliveira JP, Wichert-Ana L, et al. Antidepressant Effects of a Single Dose of Ayahuasca in Patients With Recurrent Depression: A SPECT Study. J Clin Psychopharmacol. 2016;36(1):77–81.
Winne J, Boerner BC, Malfatti T, Brisa E, Doerl J, Nogueira I, et al. Anxiety-like behavior induced by salicylate depends on age and can be prevented by a single dose of 5-MeO-DMT. Exp Neurol. 2020;326:113175.
Ly C, Greb AC, Cameron LP, Wong JM, Barragan EV, Wilson PC, et al. Psychedelics Promote Structural and Functional Neural Plasticity. Cell Rep. 2018;23(11):3170–82.
Shao LX, Liao C, Gregg I, Davoudian PA, Savalia NK, Delagarza K, et al. Psilocybin induces rapid and persistent growth of dendritic spines in frontal cortex in vivo. Neuron. 2021;109(16):2535–2544.e4.
Lima da Cruz RV, Moulin TC, Petiz LL, Leão RN. A Single Dose of 5-MeO-DMT Stimulates Cell Proliferation, Neuronal Survivability, Morphological and Functional Changes in Adult Mice Ventral Dentate Gyrus. Front Mol Neurosci. 2018;11:312.
Morales-Garcia JA, Calleja-Conde J, Lopez-Moreno JA, Alonso-Gil S, Sanz-SanCristobal M, Riba J, et al. N,N-dimethyltryptamine compound found in the hallucinogenic tea ayahuasca, regulates adult neurogenesis in vitro and in vivo. Transl Psychiatry. 2020;10(1):331.
Savalia NK, Shao LX, Kwan AC. A Dendrite-Focused Framework for Understanding the Actions of Ketamine and Psychedelics. Trends Neurosci. 2021;44(4):260–75.
Benko J, Vranková S. Natural Psychoplastogens As Antidepressant Agents. Mol Basel Switz. 2020;25(5):1172.
de Vos CMH, Mason NL, Kuypers KPC. Psychedelics and Neuroplasticity: A Systematic Review Unraveling the Biological Underpinnings of Psychedelics. Front Psychiatry. 2021;12:724606.
Krystal JH, Tolin DF, Sanacora G, Castner SA, Williams GV, Aikins DE, et al. Neuroplasticity as a target for the pharmacotherapy of anxiety disorders, mood disorders, and schizophrenia. Drug Discov Today. 2009;14(13–14):690–7.
Jaster AM, de la Fuente Revenga M, González-Maeso J. Molecular targets of psychedelic-induced plasticity. J Neurochem. 2022;162(1):80–8.
Calder AE, Hasler G. Towards an understanding of psychedelic-induced neuroplasticity. Neuropsychopharmacology. 2023;48(1):104–12.
Santarelli L, Saxe M, Gross C, Surget A, Battaglia F, Dulawa S, et al. Requirement of Hippocampal Neurogenesis for the Behavioral Effects of Antidepressants. Science. 2003;301(5634):805–9.
Jefferson SJ, Gregg I, Dibbs M, Liao C, Wu H, Davoudian PA, et al. 5-MeO-DMT modifies innate behaviors and promotes structural neural plasticity in mice. Neuropsychopharmacol Off Publ Am Coll Neuropsychopharmacol. 2023;48(9):1257–66.
Dakic V, Minardi Nascimento J, Costa Sartore R, Maciel R de M, de Araujo DB, Ribeiro S, et al. Short term changes in the proteome of human cerebral organoids induced by 5-MeO-DMT. Sci Rep. 2017;7(1):12863.
Martin DA, Nichols CD. The Effects of Hallucinogens on Gene Expression. Curr Top Behav Neurosci. 2018;36:137–58.
Canal CE. Serotonergic Psychedelics: Experimental Approaches for Assessing Mechanisms of Action. Handb Exp Pharmacol. 2018;252:227–60.
Shen HW, Jiang XL, Winter JC, Yu AM. Psychedelic 5-Methoxy-N,N-dimethyltryptamine: Metabolism, Pharmacokinetics, Drug Interactions, and Pharmacological Actions. Curr Drug Metab. 2010;11(8):659–66.
Reckweg JT, Uthaug MV, Szabo A, Davis AK, Lancelotta R, Mason NL, et al. The clinical pharmacology and potential therapeutic applications of 5-methoxy-N,N-dimethyltryptamine (5-MeO-DMT). J Neurochem. 2022;162(1):128–46.
Ermakova AO, Dunbar F, Rucker J, Johnson MW. A narrative synthesis of research with 5-MeO-DMT. J Psychopharmacol (Oxf). 2022;36(3):273–94.
Polter AM, Li X. 5-HT1A receptor-regulated signal transduction pathways in brain. Cell Signal. 2010;22(10):1406–12.
Masson J, Emerit MB, Hamon M, Darmon M. Serotonergic signaling: multiple effectors and pleiotropic effects. Wiley Interdiscip Rev Membr Transp Signal. 2012;1(6):685–713.
Rojas PS, Fiedler JL. What Do We Really Know About 5-HT1A Receptor Signaling in Neuronal Cells? Front Cell Neurosci [Internet]. 2016 [cited 2023 Nov 6];10. Available from: https://www.frontiersin.org/articles/10.3389/fncel.2016.00272
Kaltschmidt B, Kaltschmidt C. NF-KappaB in Long-Term Memory and Structural Plasticity in the Adult Mammalian Brain. Front Mol Neurosci. 2015;8:69.
Szabo A, Kovacs A, Frecska E, Rajnavolgyi E. Psychedelic N,N-Dimethyltryptamine and 5-Methoxy-N,N-Dimethyltryptamine Modulate Innate and Adaptive Inflammatory Responses through the Sigma-1 Receptor of Human Monocyte-Derived Dendritic Cells. PLOS ONE. 2014;9(8):e106533.
Inserra A, De Gregorio D, Gobbi G. Psychedelics in Psychiatry: Neuroplastic, Immunomodulatory, and Neurotransmitter Mechanisms. Pharmacol Rev. 2021;73(1):202–77.
Xu Q, Ji XF, Chi TY, Liu P, Jin G, Gu SL, et al. Sigma 1 receptor activation regulates brain-derived neurotrophic factor through NR2A-CaMKIV-TORC1 pathway to rescue the impairment of learning and memory induced by brain ischaemia/reperfusion. Psychopharmacology (Berl). 2015;232(10):1779–91.
Ji LL, Peng JB, Fu CH, Tong L, Wang ZY. Sigma-1 receptor activation ameliorates anxiety-like behavior through NR2A-CREB-BDNF signaling pathway in a rat model submitted to single-prolonged stress. Mol Med Rep. 2017;16(4):4987–93.
Pittenger C, Duman RS. Stress, depression, and neuroplasticity: a convergence of mechanisms. Neuropsychopharmacol Off Publ Am Coll Neuropsychopharmacol. 2008;33(1):88–109.
Tao X, Finkbeiner S, Arnold DB, Shaywitz AJ, Greenberg ME. Ca2 + influx regulates BDNF transcription by a CREB family transcription factor-dependent mechanism. Neuron. 1998;20(4):709–26.
Cohen-Cory S, Kidane AH, Shirkey NJ, Marshak S. Brain-derived neurotrophic factor and the development of structural neuronal connectivity. Dev Neurobiol. 2010;70(5):271–88.
Castrén E, Antila H. Neuronal plasticity and neurotrophic factors in drug responses. Mol Psychiatry. 2017;22(8):1085–95.
Dwyer JM, Duman RS. Activation of mammalian target of rapamycin and synaptogenesis: role in the actions of rapid-acting antidepressants. Biol Psychiatry. 2013;73(12):1189–98.
Lewis AS, Vaidya SP, Blaiss CA, Liu Z, Stoub TR, Brager DH, et al. Deletion of the hyperpolarization-activated cyclic nucleotide-gated channel auxiliary subunit TRIP8b impairs hippocampal Ih localization and function and promotes antidepressant behavior in mice. J Neurosci Off J Soc Neurosci. 2011;31(20):7424–40.
Ku SM, Han MH. HCN Channel Targets for Novel Antidepressant Treatment. Neurother J Am Soc Exp Neurother. 2017;14(3):698–715.
Han Y, Lyman KA, Foote KM, Chetkovich DM. The structure and function of TRIP8b, an auxiliary subunit of hyperpolarization-activated cyclic-nucleotide gated channels. Channels Austin Tex. 2020;14(1):110–22.
Gallo FT, Katche C, Morici JF, Medina JH, Weisstaub NV. Immediate Early Genes, Memory and Psychiatric Disorders: Focus on c-Fos, Egr1 and Arc. Front Behav Neurosci. 2018;12:79.
Platel JC, Kelsch W. Role of NMDA receptors in adult neurogenesis: an ontogenetic (re)view on activity-dependent development. Cell Mol Life Sci CMLS. 2013;70(19):3591–601.
Adhikari A. Distributed circuits underlying anxiety. Front Behav Neurosci. 2014;8:112.
Padilla-Coreano N, Bolkan SS, Pierce GM, Blackman DR, Hardin WD, Garcia-Garcia AL, et al. Direct Ventral Hippocampal-Prefrontal Input Is Required for Anxiety-Related Neural Activity and Behavior. Neuron. 2016;89(4):857–66.
Adhikari A, Topiwala MA, Gordon JA. Single units in the medial prefrontal cortex with anxiety-related firing patterns are preferentially influenced by ventral hippocampal activity. Neuron. 2011;71(5):898–910.
Jhang J, Lee H, Kang MS, Lee HS, Park H, Han JH. Anterior cingulate cortex and its input to the basolateral amygdala control innate fear response. Nat Commun. 2018;9(1):2744.
Nogueira M, Golbert DCF, Landeira B, Leão RN. Laser Capture Microdissection Optimization for High-Quality RNA in Mouse Brain Tissue. Curr Protoc. 2022;2(7):e457.
de Almeida RN, Galvão AC de M, da Silva FS, Silva EADS, Palhano-Fontes F, Maia-de-Oliveira JP, et al. Modulation of Serum Brain-Derived Neurotrophic Factor by a Single Dose of Ayahuasca: Observation From a Randomized Controlled Trial. Front Psychol. 2019;10:1234.
Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods San Diego Calif. 2001;25(4):402–8.
Menezes R, de Miranda A, Maia H. PyMiceTracking: An Open-Source Toolbox For Real-Time Behavioral Neuroscience Experiments. In: 2022 IEEE/CVF Conference on Computer Vision and Pattern Recognition (CVPR) [Internet]. 2022 [cited 2023 Nov 11]. p. 21427–33. Available from: https://ieeexplore.ieee.org/document/9879797
Lonergan ME, Gafford GM, Jarome TJ, Helmstetter FJ. Time-dependent expression of Arc and zif268 after acquisition of fear conditioning. Neural Plast. 2010;2010:139891.
Li S, Tian X, Hartley DM, Feig LA. Distinct roles for Ras-guanine nucleotide-releasing factor 1 (Ras-GRF1) and Ras-GRF2 in the induction of long-term potentiation and long-term depression. J Neurosci Off J Soc Neurosci. 2006;26(6):1721–9.
Boyce-Rustay JM, Holmes A. Genetic inactivation of the NMDA receptor NR2A subunit has anxiolytic- and antidepressant-like effects in mice. Neuropsychopharmacol Off Publ Am Coll Neuropsychopharmacol. 2006;31(11):2405–14.
Piskorowski R, Santoro B, Siegelbaum SA. TRIP8b Splice Forms Act in Concert to Regulate the Localization and Expression of HCN1 Channels in CA1 Pyramidal Neurons. Neuron. 2011;70(3):495–509.
Santoro B, Shah MM. Hyperpolarization-Activated Cyclic Nucleotide-Gated Channels as Drug Targets for Neurological Disorders. Annu Rev Pharmacol Toxicol. 2020;60:109–31.
Riga MS, Lladó-Pelfort L, Artigas F, Celada P. The serotonin hallucinogen 5-MeO-DMT alters cortico-thalamic activity in freely moving mice: Regionally-selective involvement of 5-HT1A and 5-HT2A receptors. Neuropharmacology. 2018;142:219–30.
Ray TS. Psychedelics and the human receptorome. PloS One. 2010;5(2):e9019.
Sherwood AM, Claveau R, Lancelotta R, Kaylo KW, Lenoch K. Synthesis and Characterization of 5-MeO-DMT Succinate for Clinical Use. ACS Omega. 2020;5(49):32067–75.
Albert PR, François BL. Modifying 5-HT1A Receptor Gene Expression as a New Target for Antidepressant Therapy. Front Neurosci. 2010;4:35.
Nardou R, Sawyer E, Song YJ, Wilkinson M, Padovan-Hernandez Y, de Deus JL, et al. Psychedelics reopen the social reward learning critical period. Nature. 2023;618(7966):790–8.
Ali F, Gerhard DM, Sweasy K, Pothula S, Pittenger C, Duman RS, et al. Ketamine disinhibits dendrites and enhances calcium signals in prefrontal dendritic spines. Nat Commun. 2020;11(1):72.
Kavalali ET, Monteggia LM. Targeting Homeostatic Synaptic Plasticity for Treatment of Mood Disorders. Neuron. 2020;106(5):715–26.
Fontanilla D, Johannessen M, Hajipour AR, Cozzi NV, Jackson MB, Ruoho AE. The hallucinogen N,N-dimethyltryptamine (DMT) is an endogenous sigma-1 receptor regulator. Science. 2009;323(5916):934–7.
Kourrich S. Sigma-1 Receptor and Neuronal Excitability. Handb Exp Pharmacol. 2017;244:109–30.
Inserra A. Hypothesis: The Psychedelic Ayahuasca Heals Traumatic Memories via a Sigma 1 Receptor-Mediated Epigenetic-Mnemonic Process. Front Pharmacol. 2018;9:330.
Kourrich S, Su TP, Fujimoto M, Bonci A. The sigma-1 receptor: roles in neuronal plasticity and disease. Trends Neurosci. 2012;35(12):762–71.
Vargas MV, Dunlap LE, Dong C, Carter SJ, Tombari RJ, Jami SA, et al. Psychedelics promote neuroplasticity through the activation of intracellular 5-HT2A receptors. Science. 2023;379(6633):700–6.
Xu Q, Ji XF, Chi TY, Liu P, Jin G, Chen L, et al. Sigma-1 receptor in brain ischemia/reperfusion: Possible role in the NR2A-induced pathway to regulate brain-derived neurotrophic factor. J Neurol Sci. 2017;376:166–75.
Lukasiewicz K, Baker JJ, Zuo Y, Lu J. Serotonergic Psychedelics in Neural Plasticity. Front Mol Neurosci. 2021;14:748359.
Moliner R, Girych M, Brunello CA, Kovaleva V, Biojone C, Enkavi G, et al. Psychedelics promote plasticity by directly binding to BDNF receptor TrkB. Nat Neurosci. 2023;26(6):1032–41.
de la Fuente Revenga M, Zhu B, Guevara CA, Naler LB, Saunders JM, Zhou Z, et al. Prolonged epigenomic and synaptic plasticity alterations following single exposure to a psychedelic in mice. Cell Rep. 2021;37(3):109836.
Olson DE. The Subjective Effects of Psychedelics May Not Be Necessary for Their Enduring Therapeutic Effects. ACS Pharmacol Transl Sci. 2021;4(2):563–7.

The authors have declared there is NO conflict of interest to disclose

Download PDF

Journal Publication

published 04 Jul, 2024

Read the published version in Molecular Psychiatry →

Editorial decision: revise
22 Jan, 2024
Review #1 received at journal
16 Jan, 2024
Review #2 received at journal
05 Jan, 2024
Reviewer #2 agreed at journal
02 Jan, 2024
Reviewer #1 agreed at journal
25 Dec, 2023
Reviewers invited by journal
23 Dec, 2023
Submission checks completed at journal
22 Dec, 2023
First submitted to journal
21 Dec, 2023
Editor assigned by journal
21 Dec, 2023

You are reading this latest preprint version

Serotonergic psychedelic 5-MeO-DMT alters plasticity-related gene expression and generates anxiolytic effects in stressed mice

Status:

Journal Publication

Version 1

Abstract

Figures

Introduction

Material and Methods

Animals

Pharmacology

Laser Capture Microdissection (LCM)

RT-qPCR

Open field tests and Elevated Plus Maze

Acute Restraint Stress and corticosterone quantification

Analysis and statistics

Results

5-MeO-DMT modulates gene expression in anxiety-related brain structures

5-MeO-DMT treatment promotes anxiolytic behavior in the EPM

5-MeO-DMT treatment reduces entries into the OF central zone

5-MeO-DMT pretreatment increase resilience to stress

5-MeO-DMT treatment increase unprotected exploratory behavior

Discussion

Declarations

References

Additional Declarations

Status:

Journal Publication

Version 1