hUMSCs Regulate the Differentiation of Ovarian Stromal Cells via TGF-β1/Smad3 Signaling Pathway to Inhibit Ovarian Fibrosis to Repair Ovarian Function in POI Rats

doi:10.21203/rs.3.rs-37891/v1

Download PDF

Research

hUMSCs Regulate the Differentiation of Ovarian Stromal Cells via TGF-β1/Smad3 Signaling Pathway to Inhibit Ovarian Fibrosis to Repair Ovarian Function in POI Rats

https://doi.org/10.21203/rs.3.rs-37891/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 07 Sep, 2020

Read the published version in Stem Cell Research & Therapy →

You are reading this older preprint version

Read the latest preprint version →

Background: The basic pathological changes of primary ovarian insufficiency (POI) include ovarian tissue fibrosis and follicular development disorders. The human umbilical cord mesenchymal stem cells (hUMSCs) transplantation has been shown an effective method to improve the ovarian function in POI rat model; however, the exact mechanisms are still unclear. The purpose of this study is to investigate whether the recovery of ovarian function in POI rats are related to the inhibition of tissue fibrosis following hUMSCs transplantation. Furthermore, the transforming growth factor-β₁(TGF-β₁) signaling pathway is explored to determine the mechanisms of ovarian function recovery through its inhibition of tissue fibrosis.

Methods: The primary ovarian insufficiency (POI) rat model was established by intraperitoneal injection of chemotherapy drug cisplatin (CDDP) for 7 days, The levels of serum sex hormones were measured using enzyme-linked immunosorbent assay (ELISA). The tissue fibrosis in ovary was examined using masson staining and Sirus red staining. The collagen fibers in the ovarian tissues were detected by Western blot analysis. To investigate the mechanisms of ovarian function recovery following hUMSCs transplantation, ovarian stromal cells were isolated from the ovarian cortex of immature rats. The expression of Cytochrome P450 17A1 (Cyp17a1) and fibrosis marker of alpha smooth muscle Actin (α-SMA) in ovarian stromal cells were examined using immunofluorescence analysis. Also, the protein levels of Cyp17a1 and α-SMA in ovarian stromal cells were examined by western blot analysis. The expression of TGF-β₁ and Smade3 signals were measured by Western blot and quantitative reverse-transcription polymerase chain reaction (qRT-PCR) analysis.

Results: The results show that the function of ovary in POI rats were significantly improved after hUMSCs transplantation. The expression of fibrosis markers (α-SMA) and production of Collagen Type I (Collagen Ⅰ) and Collagen Type Ⅲ (Collagen Ⅲ) in POI rats was significantly inhibited in POI rats following hUMSCs transplantation. In the cultured ovarian stromal cells, the decrease of TGF-β₁and p-Smade3 protein expression was observed in hUMSCs treated POI rats. The treatment with TGF-β₁inhibitor of SB431542 further confirmed this signal pathway was involved in the process.

Conclusion: Our study demonstrated that the TGF-β₁/Smad3 signaling pathway was involved in the inhibition of ovarian tissue fibrosis, which contributed to the restoration of ovarian function in POI rats following hUMSCs transplantation.

Stem Cell & Developmental Cell Biology

primary ovarian insufficiency

human umbilical cord - derived mesenchymal stem cells

ovarian stromal cells

TGF-β1 signaling pathway

fibrosis

Primary ovarian insufficiency (POI) is defined by the loss of ovarian function before the age of 40 in women, which cause infertility and premenopausal syndrome [1-2]. The clinical manifestations are secondary or primary amenorrhea for at least 4 months, and characterized by a decrease in serum estradiol (E₂) levels and an increase in gonadotropin levels [3-4]. The basic pathological changes include ovarian tissue fibrosis and follicular development disorders, but the etiology and pathogenesis of POI is still unknown [5-6]. There are many reports that chemotherapy as a commonly used treatment for female tumor patients may lead to ovarian failure, including follicular loss, vascular damage and tissue fibrosis, especially in young female patients [7-10]. Therefore, it is urgent to find an effective treatment.

For the patients with primary ovarian insufficiency, the hormone replacement therapy (HRT) is the most commonly used treatment in clinical. Even though this treatment may alleviate the symptoms of patients with POI, it cannot fundamentally improve ovarian function. Moreover the patients need to take medicine for a long time which may increase the risks of breast cancer and endometrial cancer [11]. Recently, the studies have shown that transplantation of mesenchymal stem cells (MSCs) could restore ovarian structure and function in POI animal models [12-13]. The lower immunogenicity, higher proliferation capacity and less ethically controversial extraction methods to isolate the hUMSCs might serve as a promising approach for the stem cells transplantation therapy [14-16]. However, the exact mechanisms to protect ovarian function following the hUMSCs treatment have not been fully investigated. During the process of follicular development, the follicular stromal cells play various necessary roles such as multiplying and differentiating into inner theca cells (TCs) to maintain the integrity of the follicle structure and outer myofibroblast (MFB) to secrete extra-cellular matrix (ECM) including collagen fibers of type Ⅰ and type Ⅲ, promoting the formation of follicular capillaries, which provide nutrients for follicular growth and development and thereby affecting the development and atresia of follicles [17-19]. However, the role of stromal cells in the primary ovarian dysfunction is still unclear. The current studies on ovarian stromal cells have mainly focused on its role in polycystic ovary syndrome (PCOS). Since the ovarian stromal cells can differentiate into TCs or MFB which are closely related to fibrosis of ovarian tissues, our study has focused on the effect of hUMSCs transplantation on the proliferation and differentiation of ovarian stromal cells in POI rats.

TGF-β₁ is a member of TGF-β superfamily, which includes several groups of highly conserved multifunctional cell-cell signaling proteins of key importance in the control of cell growth, differentiation, embryogenesis, and immune suppression and repair after injury [20]. Some studies showed that the TGF-β signaling pathway mediated mainly by Smad proteins and TGF-β₁/Smad3 signaling pathway has been involved in the pathogenesis of renal fibrosis [21-22]. During the renal fibrosis, the mesenchymal cells, intrinsic cells, and infiltrating inflammatory cells in the renal all produced TGF-β₁, which leads to the transformation of fibroblasts in the stroma into MFB and the formation and deposition of ECM23]. In the ovarian tissue, stromal cells can proliferate and differentiate into MFB, and secret the extracellular matrix When the excess amounts of extracellular matrix are produced the organ fibrosis might develop in the tissues. Therefore, the goal of the current study is to investigate whether the hUMSCs transplantation could inhibit ovarian fibrosis development in POI rats and further explore its mechanisms to see if TGF-β₁/Smad3 signaling pathway is involved in this process.

Animals

The female Wistar rats (n=80) at the age of 7 weeks were purchased from Jinan Pengyue experimental animal breeding Co, Ltd (Shandong, China). The rats were housed in cage under reference atmospheres and free access to food and water. All the experimental procedures have been approved by the Institutional Animal Care and Use Committee at Binzhou Medical University. The study was conducted in accordance with the National Research Council Guidance for Care and Use of Laboratory Animals.

Chemicals

Cisplatin (CDDP) (Meilunbio, China) was dissolved in warmed distilled water (DW) at a stock concentration of 3.33 mM and added to stromal cells cultures at a final concentration of 0 - 60 µM. The TGF-β₁ inhibitor, SB431542 (Selleck, USA), was dissolved in DMSO at a stock concentration of 10mM and added to stromal cells cultures at a final concentration of 10 μM.

Group and treatment

According to reports in the literature, CDDP as a common anticancer drug can lead to POI [12, 25]. This study was conducted on the successful establishment of a CDDP - induced POI rat model. The rats were randomly assigned to four groups: control, POI + hUMSCs, POI and POI + PBS group. In the control group, normal rats were injected intraperitoneally with physiological saline for 7 days; in the POI + hUMSCs group, seven days after the injection of CDDP, 200 µl phosphate buffered saline (PBS) containing 2x10⁶ hUMSCs were injected into the tail vein of POI rats; in the POI group, the rats were injected intraperitoneally with CDDP for 7 days; in the POI + PBS group, the POI rats were injected with 200 µl PBS via the tail vein. After 1 - week treatment, four rats were randomly selected from each group for fertility testing. The remaining rats were necropsied for the study.

Isolation and culture of hUCMSCs

The umbilical cords were collected from healthy donors who received cesarean section and signed a written informed consent. The collected umbilical cord was washed twice with PBS, mechanically minced, and then cultured with low - glucose Dulbecco’ s modified Eagle’ s Medium containing (Gibco) supplemented with 10% fetal bovine serum (FBS), 1% 100 U/mL streptomycin sulfate, and 100 U/mL penicillin G in a humidified atmosphere with 5% CO2 at 37℃. To confirm the phenotype of hUMSCs, cell morphology was observed under light microscope. The differentiation ability to adipocytes and osteoblast was examined by alizarin red staining and oil red O staining. The cell surface and intracellular markers such as CD44, CD73, CD90, CD34, HLA - DR, and CD45 were examined using flow cytometry (FCM). The cells at the third to fifth generation were selected for the experiments.

Isolation,culture and identification of Ovarian Stromal Cells

Ovarian stromal cells were isolated from the ovarian cortex of normal immature 3 - to 4 - week - old rats. Briefly, the surface epithelium and ovarian medulla was removed by using forceps and, the granulosa cells (GCs) and oocytes were released by puncturing the follicles with a sterile needle. The remaining ovary tissues were cut into 1 mm³ fragments using scissors and washed with PBS for three times. The tissues were digested with type II collagenase that was dissolved in McCoy’ s 5A (Modified) Medium at 37℃ for 60 min. After digestion, the dispersed cells were washed with McCoy’ s 5A medium and centrifuged at 1000 rpm at 37℃ for 5 minutes. The pellet was suspended in McCoy’ s 5A medium containing 10% FBS, 1% 100 U/mL streptomycin sulfate, and 100 U/mL penicillin G and cultured in a 37℃ humidified incubator with 5% CO₂.

Fertility examination

Four rats were randomly selected from each group including control, POI + hUMSCs, POI and POI + PBS group. The rats were mated at 2:1 ratio with sexually mature male rats and euthanized 9 days after the appearance of vaginal plugs. The uterus was collected and examined for the number of developed fetuses.

Enzyme-linked immunosorbent assay (ELISA)

The serum of each rat was collected and stored at −80 ℃ after centrifuge for analysis. The serum levels of estradiol (E₂), follicle-stimulating hormone (FSH) and luteinizing hormone (LH) were measured using ELISA kit following the manufacturer’ s instructions (Mlbio, China).

Hematoxylin and eosin (H&E) staining

Ovaries were collected from the rats of each group and fixed in 4% paraformaldehyde for 24h. Then, the tissues were processed by paraffin embedding, sectioning (5 µm), and hematoxylin and eosin (H&E) staining. To analyze the ovarian morphology and count the numbers of ovarian follicles, the slides were examined under light microscope. The follicles were categorized as primordial follicles, primary follicles, secondary follicles, and atresia follicles according to the previous report [24].

Masson trichrome staining and Sirius red staining

Ovaries were collected from the rats of each group and fixed in 4% paraformaldehyde for 24h. Following the paraffin embedding and sectioning (5 µm) process, the tissues were stained with Masson trichrome and Sirius red. To evaluate the fibrosis of ovary tissues in each group, the slides were analyzed and photographed under light microscope. Five fields in each staining image were randomly selected for examination. Image J software was used to quantitate the degree of interstitial fibrosis in the ovary tissue.

CCK-8 cell viability assay

The effect of CDDP at different concentrations on the viability of stromal cells was measured using CCK-8 kit (Meilong Bio, China). The cells (5000 stromal cells / well) were seeded in 96-well plates and incubated overnight. After cell adhesion, the medium is replaced with media containing CDDP (0-60 µm). CCK-8 cells (10 µl) were added to the cell medium for 1 h. The absorbance was measured at 450nm using an ELISA assay kit. according to the manufacturer's instructions.

Inhibitor experiment

After achieving 80% confluence, stromal cells were seeded in 6 - well plates (1×10⁵ cells / well). Cells were divided into four groups according the different treatments for 20 hours: 1) Control group - untreated medium, 2) CDDP group - CDDP (20 µM) alone, 3) CDDP + hUMSCs group - CDDP + hUMSCs supernatants, 4) CDDP + SB431542 group - CDDP + SB431542 (10 µM).

Immunofluorescence staining

The expression of vimentin, Factor Ⅷ, Cytokeratin, Cyp17a1 and α-SMA proteins was detected by Immunofluorescence staining. Ovarian stromal cells were washed three times with PBS, fixed in 4% paraformaldehyde for 20minutes. After washing, the cells were blocked for 30 minutes in PBS containing 5% donkey serum (Santa Cruz Biotechnology). To identify the mesenchymal, epithelial, endothelial cells, TCs and MFB, the cells were incubated with the primary antibody of anti - vimentin (1:100, Proteintech, China) , anti - cytokeratin (1:100, Proteintech, China), anti - Factor VIII (1:100, Proteintech, China), and the mixture of anti - Cyp17a1 (1:100, abcam, UK) and anti - α - SMA (1:100, abcam, UK) at 4℃ overnight , respectively. After rinsing, the stromal cells were incubated with the second antibody of goat anti - Rabbite IgG, Alexa Fluor 488 (Invitrogen, USA), goat anti - Rabbite IgG, goat anti - Rabbite IgG, Alexa Fluor 596 (Invitrogen, USA) and the mixture of goat anti - Rabbite IgG, Alexa Fluor 488 and goat anti - mouse IgG, Alexa Fluor 596 (Invitrogen, USA) respectively at 37℃ for 1h with DAPI (Solarbio, China) staining solution. The staining of the cells were visualized using a fluorescent microscope (Leica, Germany).

Quantitative reverse-transcription polymerase chain reaction (qRT - PCR)

Total RNA was isolated from ovarian stromal cells using Trizol reagent (ambion,USA) and reversed transcribed into cDNA using Transcriptor HiFi cDNA Synth (Roche, Germany). The primers for quantitative real - time polymerase chain reaction were listed as follows: transforming growth factor-β₁ (TGF-β₁ ) forward primer: CATTGCTGTCCCGTCAGA and reverse primer: AGGTAACGCCAGGAATTGTTGCTA; Smad3 forward primer: GCACAGCAAGTTCCCAGTGTGTA and reverse primer: GCCATGCATCCACTGTTCC; Glyceraldehyde - 3 - phosphate dehydrogenase (GAPDH) forward primer: GGCACAGTCAAGGCTGAGAATG and reverse primer: ATGGTGGTGAAGACGCCAGTA. The housekeeping gene GAPDH was used for to normalize the gene expression. The testing in each group was repeated in triplicate.

Western blot

Proteins were isolated from ovary tissues and cultured stromal cells. The samples were electrophoresed on sodium dodecyl sulfatepolyacrylamide gels, and transferred to a PVDF membrane. After blocking with 5%~7% skim milk, the membranes were incubated with anti - TGF-β₁ (1:1000, abcam, UK), anti - Smad3 (1:1000, abcam, UK) , anti - p - Smad3 (1:1000, Proteintech, China), anti - Cyp17a1 (1:4000, abcam, UK), anti - α - SMA (1:1000, abcam, UK), anti - Collagen Ⅰ (1:400, Proteintech, China)), anti - Collagen Ⅲ (1:400, Proteintech, China)) and anti - GAPDH (1:20000, Proteintech, China) polyclonal antibodies for overnight. After incubation, the membranes were washed with TBS and Tween 20 (TBST) three times and then immunoblotted with HRP - conjugated secondary antibodies (Proteintech) for 1 h at room temperature. The expression of each protein was measured by an enhanced chemiluminescence reagent ( ECL) kit. The density of protein expression bands was measured using Image J software.

Data analysis

All data were expressed as mean ± SD. and analyzed by SPSS 22.0 software. Differences between two groups were determined using one-way analysis of variance (ANOVA) with post hoc Bonferroni test. A value of P< 0.05 is considered significant difference.

Characterization of hUMSCs

In order to confirm whether the isolated cells were hUMSCs, the examination with light microscopy, flow cytometry, osteogenesis induction, and adipocyte induction were performed. As shown in Figure (1i), the cells isolated from human placenta started to form a cluster of clones after 7 to 10 days of incubation. The morphology of cells appear similar to fibroblasts. Following staining, the cellular expression of CD44 was 99.7% while the expression of CD90 and CD73 were 99.9% and 97.1% respectively (Figure 1a-c). In comparison, the expression of CD45, CD34 and HLA - DR was all below lower than 5% as illustrated in Figure 1d-1f. After incubation for 28 days and 14 days, respectively, the cells showed the ability to differentiate into osteoblasts and adipocytes, which were confirmed by positive von Kossa staining and Oil Red O staining Figure 1g-1h. These results are consistent with the previous literature reports on the phenotypic characteristics of hUMSCs [25-27].

Effects of hUMSCs transplantation on ovarian function in POI rats

To explore the effects of hUMSCs transplantation on ovarian function in POI rats, the histological pathology of ovarian tissues the number of follicles at each developmental stage and the serum levels of sex hormones in the rats were examined. As shown in Figure 2a - 2d, the control group showed a large number of healthy follicles at each stage including primary follicles, primary follicles, secondary follicles and atretic follicles. In contrast, the ovarian tissue atrophy and the decrease of follicles number at each developmental stage were observed in POI rats compared to the control group (Figure 2e). Following hUMSCs transplantation, the number of developing follicles in the POI + hUMSCs group was significantly higher than POI + PBS group (Figure 2e). For the serum hormone measurement, it is noted that the lower level of E₂ and higher levels of FSH and LH in POI rats compared to the control group. However, one week after the transplantation of hUMSCs, the serum E₂ levels were significantly increased and the FSH and LH secretion were decreased in POI rats as summarized in Figure 2f - 2h. Overall, the data showed that the hUMSCs transplantation helps restore the ovarian function which was damaged by CDDP in POI rats.

Effects of hUMSCs transplantation on ovarian fibrosis in POI rats

In order to investigate if hUMSCs transplantation can reduce the ovarian tissue fibrosis in POI rats, the tissues were stained with Sirius red and Masson trichrome. Also, the Western blot analysis was performed on the collected ovarian tissues. As shown in Figure 3A and 3B, the staining results showed the increase of fibrotic tissues in ovarian of POI rats when compared to the control group. After the hUMSCs transplantation, the fibrosis area in the ovarian tissues of POI rats was significantly reduced. In addition, the results from the western blot analysis showed that the expression of TCs marker of Cyp17a1 [28-29] was significantly decreased in POI rats as shown in Figure 4c. However, the the expression of MFB marker α-SMA [30] was increased in POI rats. The amounts of Collagen Ⅰ and Collagen Ⅲ was significantly decreased in POI rats following hUMSCs transplant (Figure 4d and 4e). Collectively, these data indicated that the hUMSCs transplantation effectively inhibited the fibrogenesis of ovarian tissues in POI rats. This pathology changes contribute the restoration on the ovarian function and the development of ovarian stromal cells into membrane cells in CDDP induced POI rats.

Effects of hUMSCs transplantation on fertility of POI rats

To explore the effect of hUMSCs transplantation on fertility of POI rats, the embryo-implantation efficiency was examined in the rats of each group. As shown in Figure 5, the efficiency of embryo implantation in POI group was significantly lower than the control group (P<0.001). However, the hUMSCs implantation significantly increased the efficiency of embryo implantation in POI rats (P<0.001).

Effects of hUMSCs medium on stromal cell differentiation in cultured cells

The characterization of isolated ovarian stromal cells was confirmed by immunofluorescence staining with vimentin, cytokeratin and factor VIII [31]. As shown in Figure 6, the cells were positively stained with vimentin but not cytokeratin and factor VIII. We investigated whether hUMSCs transplantation affects stromal cell differentiation through the TGF-β₁ signaling pathway. In order to find the appropriate concentration of CDDP to treat stromal cells, according to previous reports, the CCK - 8 kit was used to detect the viability of stromal cells at different concentrations [32-34]. The CDDP concentration at 20µM was selected since the treatment resulted in the cell viability as 82.82%. The immunofluorescence staining showed that , the expression of Cyp17a1, a marker of TCs, was decreased in the CDDP-induced POI group.While the expression of α-SMA, a marker of MFB, was increased. Following the treatment with hUMSCs medium and TGF-β₁ inhibitor SB431542, the images showed an increase of Cyp17a1 expression and decrease of α-SMA expression in hUMSCs + POI and POI + SB431542 groups (Figure 7B). The western blot and qRT-PCR analysis showed that the expression of TGF-β₁ and p-smad3 was increased in POI group compared to the control group (P<0.001). Following the hUMSCs medium treatment, the increased express of TGF-β₁ and p-smad3 was reversed in both protein (P<0.05, P<0.001, P<0.001) and RNA levels (P<0.001). The treatment with TGF-β₁ inhibitor also resulted in the similar results as hUMSCs shown in Figure 8. In summary, these data suggested that the TGF-β₁/Smad3 signaling pathway was involved in the differentiation of stromal cells into TCs and subsequently inhibit the fibrosis of ovarian tissues in POI rats.

Recently, more and more researches have focused on the treatment of POI with mesenchymal stem cells (MSCs) [12-13]. Among the stem cells, the hUMSCs isolated from human umbilical cord gained great attention due to its availability,T immunodeficiency and multipolarity differentiation potential [35-37]. In our previous study, we have demonstrated hUMSCs transplantation can recover the function of impaired ovarian and endothelium receptivity in POF mice, which is mediated by the change of Th1/Th2 cytokine ratio [27].

To explore the mechanisms of the recovery of ovarian tissues following hUMSCs implantation in POI rats, we have investigated whether hUMSCs transplantation can inhibit ovarian fibrosis through the TGF-β₁ signaling pathway. The POI rats model was successfully established following the chemotherapy drug CDDP treatment as reported [12, 25]. Following the hUMSCs transplant, the damaged ovarian function of POI rats was significantly improved based on the changes of serum sex hormones such as E₂, FSH and LH. At the same time, the follicle numbers at each developmental stage and fertility ability have significantly increased in POI rats following hUMSCs transplantation. These results suggest that hUMSC transplantation has successfully restored the ovarian function in CDDP induced POI rats. The results are consistent with results of a previous study [38].

The basic pathological changes of POI include ovarian tissue fibrosis and follicular development disorders [5-6]. In the ovary, stromal cells are an important component of the tissue and can differentiate into theca cell layer, including inner TCs and outer outer MFB [17-19]. Some studies have shown that fibrosis is closely related to MFB. The possible mechanism is that FMB effectively secretes large amounts of ECM and eventually leads to organ fibrosis [39-41]. The results from our study demonstrated that the hUMSCs transplantation could reduce the ovarian tissue fibrosis in POI rats. The decreased expression of α-SMA and collagen in the in vitro cell culture study in the hUMSCs treatment group may help explain its mechanism to inhibit the ovarian tissue fibrosis in POI rats. These results suggest that hUMSC transplantation restores ovarian function in POI rats by improving ovarian stromal cell differentiation to reduce the ovarian fibrosis.

TGF-β₁ signaling pathway mediated by Smad protein plays an important role in the development of tissue fibrosis [42]. Recent studies have shown that the TGF-β₁/Smad3 signaling pathway is involved in fibrosis in many organs [43-44]. In our study, the data showed that the TGF-β₁/Smad3 signaling was involved in ovarian tissue fibrosis in POI rats. The results are consistent with those studies that have demonstrated that TGF-β₁ pathway plays an important role in the pathogenesis of tissue fibrosis. Following the hUMSC transplantation, the ovarian fibrosis in POI rats was significantly reduced. These findings were further confirmed by blocking the collagen production in cultured stromal cells with TGF-β₁ inhibitor SB431542 treatment. Also, the stromal cells co - cultured with CDDP and SB431542 were differentiated into TCs with less MFB presence. All these in vitro and in vivo experiment findings suggest that that TGF-β₁/Smad3 signaling plays an important role in the recovery of ovarian function through its inhibition of tissue fibrosis in POI rats following hUMSC transplantation. This provides useful information for the development of pharmaceutical therapies treatment methods for POF failure in the future.

The results from our study showed that hUMSCs transplantation can recover the function of ovarian function in POI rats. This recovery is associated with the inhibition of ovarian fibrosisin part hrough regulating stromal cell differentiation via the TGF-β₁/Smad3 signaling pathway. With the increase number of POI patients with chemotherapy treatment, the results of this study provide new therapeutic targets and strategies for promoting the repair and recovery of ovarian function in such patients.

POI: primary ovarian insufficiency; hUMSCs: human umbilical cord - derived mesenchymal stem cells; TGF-β₁: transforming growth factor-β₁; CDDP: cisplatin; ELISA: Enzyme - Linked Immunosorbent Assay analysis; Cyp17a1: Cytochrome P450 17A1; α-SMA: alpha smooth muscle Actin; qRT - PCR: quantitative real - time polymerase chain reaction; E₂: estradiol; HRT: hormone replacement therapy; MSCs: mesenchymal stem cells; TCs: theca cells; MFB: myofibroblast; ECM: extra-cellular matrix; PCOS: polycystic ovary syndrome; DW: distilled water; PBS: phosphate buffer saline; FBS: fetal bovine serum; FCM: flow cytometry; GCs: granulosa cells; FSH: follicle stimulating hormone; LH: luteinizing hormone; HE: hematoxylin and eosin; GAPDH: Glyceraldehyde - 3 - phosphate dehydrogenase; SDS - PAGE: sodium dodecyl sulfate polyacrylamide gel electrophoresis; PVDF: polyvinylidene fluoride; TBST: TBS added with Tween 20; ECL: enhanced chemiluminescence reagent; DAPI: 4,6 - diamino - 2 - phenyl indole; SD: standard deviation; ANOVA: Oneway analysis of variance; Th1: T-helper 1; Th2: T-helper 2.

Acknowledgements

All authors are acknowledged for their contribution to the study.

Authors’ contributions

CLL, BHC, FQ and ZHQ were in charge of experimental design and literature research. CLL, LZF, LQQ and HY were in charge of experimental studies. WSY, LHY and MXJ were in charge of data analysis and interpretation. BHC assisted with the experiments. FQ and ZHQ were in charge of the manuscript editing. All authors read and approved the ending version of the final manuscript.

Funding

Supported by the Xu Rongxiang Fund (NO. BY2019XRX01), the Major Science and Technology Innovation Plan of Shandong Province (NO. 2019JZZY020902), the Science and Technology Plan of Yantai city government (NO. 2019MSGY134).

Availability of data and materials

All data generated and/or analyzed during this study are included in this published article.

Ethics approval and consent to participate

Animals were treated in accordance with the Basel Declaration in the context of phase experimental animals. The use of animals was approved by the Ethics Committee of Binzhou Medical University. We have obtained the participants’ informed consent to donate the tissue for research use. The use of human tissue was approved by the Ethics committee of the Yantai Yuhuangding Hospital.

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Hewitt GD, Gerancher KR. ACOG Committee Opinion No. 760: Dysmenorrhea and Endometriosis in the Adolescent. Obstet Gynecol. 2018;132(6):e249‐e258.
Kuang H, Han D, Xie J, et al. Profiling of differentially expressed microRNAs in premature ovarian failure in an animal model. Gynecol Endocrinol. 2014;30(1):57‐61.
European Society for Human Reproduction and Embryology (ESHRE) Guideline Group on POI, Webber L, Davies M, et al. ESHRE Guideline: management of women with premature ovarian insufficiency. Hum Reprod. 2016;31(5):926‐937.
Vujović S, Ivović M, Tancić-Gajić M, et al. Premature ovarian failure. Srp Arh Celok Lek. 2012;140(11-12):806‐811.
Iorio R, Castellucci A, Ventriglia G, et al. Ovarian toxicity: from environmental exposure to chemotherapy. Curr Pharm Des. 2014;20(34):5388‐5397.
Ebrahimi M, Akbari Asbagh F. Pathogenesis and causes of premature ovarian failure: an update. Int J Fertil Steril. 2011;5(2):54‐65.
Meirow D, Dor J, Kaufman B, et al. Cortical fibrosis and blood-vessels damage in human ovaries exposed to chemotherapy. Potential mechanisms of ovarian injury. Hum Reprod. 2007;22(6):1626‐1633.
Lai D, Wang F, Yao X, et al. Human endometrial mesenchymal stem cells restore ovarian function through improving the renewal of germline stem cells in a mouse model of premature ovarian failure. J Transl Med. 2015;13:155.
Park MR, Choi YJ, Kwon DN, et al. Intraovarian transplantation of primordial follicles fails to rescue chemotherapy injured ovaries. Sci Rep. 2013;3:1384.
Yao X, Guo Y, Wang Q, et al. The Paracrine Effect of Transplanted Human Amniotic Epithelial Cells on Ovarian Function Improvement in a Mouse Model of Chemotherapy-Induced Primary Ovarian Insufficiency. Stem Cells Int. 2016;2016:4148923.
Sassarini J, Lumsden MA, Critchley HO. Sex hormone replacement in ovarian failure - new treatment concepts. Best Pract Res Clin Endocrinol Metab. 2015;29(1):105‐114.
Wang Z, Wang Y, Yang T, et al. Study of the reparative effects of menstrual-derived stem cells on premature ovarian failure in mice. Stem Cell Res Ther. 2017 Jan 23;8(1):11.
Wang S, Yu L, Sun M, et al. The therapeutic potential of umbilical cord mesenchymal stem cells in mice premature ovarian failure. Biomed Res Int. 2013;2013:690491.
English K, French A, Wood KJ. Mesenchymal stromal cells: facilitators of successful transplantation?. Cell Stem Cell. 2010;7(4):431‐442.
Fan C, Wang D, Zhang Q, et al. Migration capacity of human umbilical cord mesenchymal stem cells towards glioma in vivo. Neural Regen Res. 2013;8(22):2093‐2102.
Elfayomy AK, Almasry SM, El-Tarhouny SA, et al. Human umbilical cord blood-mesenchymal stem cells transplantation renovates the ovarian surface epithelium in a rat model of premature ovarian failure: Possible direct and indirect effects. Tissue Cell. 2016;48(4):370‐382.
Wang H, Andoh K, Hagiwara H, et al. Effect of adrenal and ovarian androgens on type 4 follicles unresponsive to FSH in immature mice. Endocrinology. 2001;142(11):4930‐4936.
Jiang JY, Macchiarelli G, Tsang BK, et al. Capillary angiogenesis and degeneration in bovine ovarian antral follicles. Reproduction. 2003;125(2):211‐223.
Nielsen ME, Rasmussen IA, Kristensen SG, et al. In human granulosa cells from small antral follicles, androgen receptor mRNA and androgen levels in follicular fluid correlate with FSH receptor mRNA. Mol Hum Reprod. 2011;17(1):63‐70.
Heldin CH, Landström M, Moustakas A. Mechanism of TGF-beta signaling to growth arrest, apoptosis, and epithelial-mesenchymal transition. Curr Opin Cell Biol. 2009;21(2):166‐176.
Al-Rasheed NM, Al-Rasheed NM, Al-Amin MA, et al. Fenofibrate attenuates diabetic nephropathy in experimental diabetic rat's model via suppression of augmented TGF-β₁/Smad3 signaling pathway. Arch Physiol Biochem. 2016;122(4):186‐194.
Sato M, Muragaki Y, Saika S, et al. Targeted disruption of TGF-beta1/Smad3 signaling protects against renal tubulointerstitial fibrosis induced by unilateral ureteral obstruction. J Clin Invest. 2003;112(10):1486‐1494.
Park J, Lee SY, Ooshima A, et al. Glucosamine hydrochloride exerts a protective effect against unilateral ureteral obstruction-induced renal fibrosis by attenuating TGF-β signaling. J Mol Med (Berl). 2013;91(11):1273‐1284.
Persani L, Rossetti R, Cacciatore C. Genes involved in human premature ovarian failure. J Mol Endocrinol. 2010 Nov;45(5):257-79.
Sun L, Li D, Song K, et al. Exosomes derived from human umbilical cord mesenchymal stem cells protect against cisplatin-induced ovarian granulosa cell stress and apoptosis in vitro. Sci Rep. 2017;7(1):2552.
Wen YC, Du MK, Li MW, et al. EphA2-positive human umbilical cord-derived mesenchymal stem cells exert anti-fibrosis and immunomodulatory activities via secretion of prostaglandin E2. Taiwan J Obstet Gynecol. 2018;57(5):722‐725.
Lu X, Cui J, Cui L, et al. The effects of human umbilical cord-derived mesenchymal stem cell transplantation on endometrial receptivity are associated with Th1/Th2 balance change and uNK cell expression of uterine in autoimmune premature ovarian failure mice. Stem Cell Res Ther. 2019;10(1):214.
Liu C, Rodriguez K F, Brown P R, et al. Reproductive, physiological, and molecular outcomes in female mice deficient in Dhh and Ihh.Endocrinology. 2018; 159(7): 2563-75.
Neto AC, Ball BA, Browne P, et al. Cellular localization of androgen synthesis in equine granulosa-theca cell tumors: Immunohistochemical expression of 17α-hydroxylase/17, 20-lyase cytochrome P450. Theriogenology. 2010; 74(3): 393-401.
Hinz B, Phan SH, Thannickal VJ, et al. The myofibroblast: one function, multiple origins. Am J Pathol. 2007;170(6):1807-1816.
Qiu M, Liu J, Han C, et al. The influence of ovarian stromal/theca cells during in vitro culture on steroidogenesis, proliferation and apoptosis of granulosa cells derived from the goat ovary. Reprod Domest Anim. 2014;49(1):170‐176.
Abdrakhmanov A, Kulikov AV, Luchkina EA, et al.Involvement of mitophagy in cisplatin-induced cell death regulation. Biological chemistry. 2019; 400(2): 161-70.
Wang SW, Xu Y, Weng YY, et al. Astilbin ameliorates cisplatin-induced nephrotoxicity through reducing oxidative stress and inflammation. Food and chemical toxicology. 2018; 114: 227-36.
Singh MP, Chauhan AK, Kang SC. Morin hydrate ameliorates cisplatin-induced ER stress, inflammation and autophagy in HEK-293 cells and mice kidney via PARP-1 regulation. International immunopharmacology. 2018; 56: 156-67.
Fan C, Wang D, Zhang Q, et al. Migration capacity of human umbilical cord mesenchymal stem cells towards glioma in vivo. Neural Regen Res. 2013;8(22):2093‐2102.
Elfayomy AK, Almasry SM, El-Tarhouny SA, et al. Human umbilical cord blood-mesenchymal stem cells transplantation renovates the ovarian surface epithelium in a rat model of premature ovarian failure: Possible direct and indirect effects. Tissue Cell. 2016;48(4):370‐382.
Liew A, O'Brien T, Egan L. Mesenchymal stromal cell therapy for Crohn's disease. Dig Dis. 2014;32 Suppl 1:50‐60.
Li J, Yu Q, Huang H, et al. Human chorionic plate-derived mesenchymal stem cells transplantation restores ovarian function in a chemotherapy-induced mouse model of premature ovarian failure. Stem Cell Res Ther. 2018;9(1):81.
Hiwatashi N, Bing R, Kraja I, et al. Stem Cell-Mediated Paracrine Signaling Alters Fibroplasia in Human Vocal Fold Fibroblasts in Vitro. Ann Otol Rhinol Laryngol. 2017;126(8):581-588.
Zong J, Zhang H, Li FF, et al. NLRP1 promotes TGF-β₁-induced myofibroblast differentiation in neonatal rat cardiac fibroblasts. J Mol Histol. 2018;49(5):509-518.
Humphreys BD. Mechanisms of Renal Fibrosis. Annu Rev Physiol. 2018;80:309-326.
Young VJ, Brown JK, Saunders PT, et al. The peritoneum is both a source and target of TGF-β in women with endometriosis. PLoS One. 2014;9(9):e106773.
Zhang L, Han C, Ye F, et al. Plasma Gelsolin Induced Glomerular Fibrosis via the TGF-β₁/Smads Signal Transduction Pathway in IgA Nephropathy. Int J Mol Sci. 2017;18(2):390.
Chen H, Xu Y, Yang Y, et al. Shenqiwan Ameliorates Renal Fibrosis in Rats by Inhibiting TGF-β₁/Smads Signaling Pathway. Evid Based Complement Alternat Med. 2017;2017:7187038.

Download PDF

Journal Publication

published 07 Sep, 2020

Read the published version in Stem Cell Research & Therapy →

Review #2 received at journal
07 Jul, 2020
Editorial decision: Major Revision
07 Jul, 2020
Review #4 received at journal
05 Jul, 2020
Review #3 received at journal
05 Jul, 2020
Reviewer #5 agreed at journal
03 Jul, 2020
Reviewer #4 agreed at journal
02 Jul, 2020
Reviewer #3 agreed at journal
01 Jul, 2020
Review #1 received at journal
01 Jul, 2020
Editor assigned by journal
30 Jun, 2020
Reviewers invited by journal
30 Jun, 2020
Reviewer #1 agreed at journal
30 Jun, 2020
Reviewer #2 agreed at journal
30 Jun, 2020
Editor invited by journal
29 Jun, 2020
Submission checks completed at journal
25 Jun, 2020
First submitted to journal
22 Jun, 2020

You are reading this older preprint version

Read the latest preprint version →

hUMSCs Regulate the Differentiation of Ovarian Stromal Cells via TGF-β1/Smad3 Signaling Pathway to Inhibit Ovarian Fibrosis to Repair Ovarian Function in POI Rats

Status:

Journal Publication

Version 1

Abstract

Figures

Background

Materials And Methods

Results

Discussion

Conclusion

Abbreviations

Declarations

References

Status:

Journal Publication

Version 1